My Crowdfunding Campaign: Here’s What Happened

Поділитися
Вставка

КОМЕНТАРІ • 2,3 тис.

  • @theoriginalbigmike
    @theoriginalbigmike 5 років тому +4545

    They look kinda like a honeycomb you could call it the busy bee calendar

  • @RndmMthd
    @RndmMthd 5 років тому +2462

    Should offer an "Expansion Pack" that is just a single standalone LED button with sticky Velcro and a "29" on it. =)

  • @amandagracia5585
    @amandagracia5585 5 років тому +4060

    omg i cant stop staring at her necklace

    • @Julq4
      @Julq4 5 років тому +36

      yeah where can i buy it??

    • @tinseltail
      @tinseltail 5 років тому +36

      poxodi it’s by a British company called Tatty Devine!

    • @eddynator5847
      @eddynator5847 5 років тому +17

      @@Julq4
      its a 125€ tho

    • @MrBibibip
      @MrBibibip 5 років тому +1

      What is it made of?

    • @Julq4
      @Julq4 5 років тому +8

      @@eddynator5847 aliexpress or ebay it is then lmaooo

  • @mytherrus2068
    @mytherrus2068 3 роки тому +141

    I just want to say, I really like the name 'Everyday Calendar'. While it's true that every calendar shows every single day, most calendars are split by month and you don't actually see every single day. Shifting the focus from months split into weeks into each individual day helps with the step-by-step process of routine, and 'Everyday Calendar' encapsulates that beautifully.

  • @heatherfreeman5274
    @heatherfreeman5274 5 років тому +175

    I'm a manufacturing engineer and LOVING how she's explaining the complexity

    • @tanmaypanadi1414
      @tanmaypanadi1414 5 років тому

      What products have you been part of ?

    • @dogcarman
      @dogcarman 3 роки тому +1

      @@tanmaypanadi1414 Hopefully none… 😉

  • @MikeFilemaker
    @MikeFilemaker 5 років тому +233

    Don’t feel guilty that we’re watching! We’re watching at work.

  • @KnowItAllNERD
    @KnowItAllNERD 5 років тому +1623

    "I feel guilty asking for money" is the most scandinavian thing ever

    • @catcatcatcatcatcatcatcatcatca
      @catcatcatcatcatcatcatcatcatca 5 років тому +18

      Scandinavia have a proud history of successful unions - but then again unions would work the same if all workers wanted fair compensation for all the other workers instead of themselves.

    • @theespatier4456
      @theespatier4456 5 років тому +15

      Hannah Steinum Kvalvik A few Swedish extreme-right municipalities have literally outlawed begging in recent years.

    • @stoffni
      @stoffni 5 років тому +41

      @@theespatier4456 lmfao... "EXTREME-RIGHT". Stop your bs.

    • @KnowItAllNERD
      @KnowItAllNERD 5 років тому +43

      @@theespatier4456 ...I was more talking about how I, as a scandinavian, hate asking for money. I don't ask for money from my parents because I get student loans and tuition is free, so if I blow through that money it is because I fucked up and failed at being independent (something that I feel is valued in society) Also I am lucky enough to have the privilege to not have to ask for money. #middleclassnorwegian

    • @98Zai
      @98Zai 5 років тому +9

      @@stoffni You know, it's all relative. Outlawing begging on one side, and having a generous welfare system on the other side is pretty much black and white. It's not extreme compared to US, so you're right in some sense.

  • @MyYoyoyoyoyo12345
    @MyYoyoyoyoyo12345 5 років тому +285

    When I was younger I wished there was a reusable calendar like this. Definitely waiting for it to become orderable.

    • @adamblomberg
      @adamblomberg 5 років тому +1

      But you can't write notes on it. I see it more as a decorative item.

    • @MyYoyoyoyoyo12345
      @MyYoyoyoyoyo12345 5 років тому +2

      It is yeah, but it's nice to keep track of the days like that. I don't like writing notes like appointments on paper calendars anyway, prefer to keep reminders on my phone.

  • @thebuffmeister89
    @thebuffmeister89 5 років тому +1332

    The calendar is cool and all, but where can I get that groovy dinosaur necklace?!

    • @WhatsBliss
      @WhatsBliss 5 років тому +38

      Joulery is the company that makes it.

    • @MyAncientSpirit
      @MyAncientSpirit 5 років тому +21

      typetrouble they’re apparently sold out of everything and I want the entire collection

    • @hoxton_hummingbird
      @hoxton_hummingbird 5 років тому +6

      @@MyAncientSpirit google showed me a similar one on rakuten for 12$
      store/pangaea/item/10000080/

    • @johnpeters7073
      @johnpeters7073 5 років тому +10

      Literally just Google “Dinosaur necklace” or “T rex skeleton necklace”. There are dozens upon dozens of of companies that make these.

    • @DeezN00tz99
      @DeezN00tz99 5 років тому

      Aliexpress for like 3 dollars or something

  • @Mawson6492
    @Mawson6492 5 років тому +37

    The everyday calendar is the perfect name. The everyday part isn't about having all of the days, it's about doing whatever you're doing everyday. Don't change it 🙂

  • @knedy
    @knedy 5 років тому +176

    *Next version you should add a speaker that makes bubble wrap popping sound when you press something! You don't even need to have the dates on it, just digital bubble wrap! I'll sell you this idea for a check for $10,000 made of macaroni!*

    • @zippoblackburn3106
      @zippoblackburn3106 5 років тому +3

      some things sound like a good idea - until one has children!

    • @alexsfilm-house3325
      @alexsfilm-house3325 5 років тому

      @@zippoblackburn3106 teach your children to behave then.

    • @TheLexiconDevils
      @TheLexiconDevils 5 років тому

      Nah programmable sound bites ‘nailed it’

  • @wouterx333
    @wouterx333 5 років тому +650

    Sign a couple of them or include a thank you macaroni art

    • @abouttogiveyasomefacts5574
      @abouttogiveyasomefacts5574 5 років тому

      Wouter Schip yas that would be cool

    • @vizionthing
      @vizionthing 5 років тому +7

      You barstewards, as if checking 366 days on all 200 isnt enough you now want to add to her work load!

    • @wissamelkadamani9750
      @wissamelkadamani9750 5 років тому +2

      @@vizionthing 100%

    • @Biosquid239
      @Biosquid239 5 років тому +3

      Macaroni art would take forever but signing might be nice to do on the first batch atleast.

    • @damongki
      @damongki 5 років тому +1

      @@vizionthing do you mean 365? cause there's no February 29th

  • @censusgary
    @censusgary 5 років тому +971

    So change the name to The Every Day Except February 29th Calendar.

    • @toysareforboys1
      @toysareforboys1 5 років тому +33

      I can't believe they didn't put the 29th on the calendar! insane.

    • @SternLX
      @SternLX 5 років тому +18

      Well, You could always buy a Gold Star sticker sheet and put a Gold Star on there that day when there's a leap year. It'd be the Calendars special day as it's the only one with a Gold Star. Of course it would be pealed off at the beginning of the next year. :)

    • @petersherman2552
      @petersherman2552 5 років тому +60

      @@toysareforboys1 you get the 29th off, no meditating or exercising that day. Lie on the couch and eat potato chips instead

    • @murirokcs5518
      @murirokcs5518 5 років тому +1

      Love it

    • @KarryKarryKarry
      @KarryKarryKarry 5 років тому +6

      The fact that this calendar has NO way of keeping a record is just baffling. Why would you make this?
      For the question at hand: You could just put a counter into the electronics so whenever you get to 2020 you can light up the 29th. I doubt you’ll keep it longer than that but to each his own.
      Or you could use the interwebs (January 1st) and send a time request to any NTP server to get the year. When thinking about that you could also put some calendar client software on there and have it light up dates you’ve marked in your calendar. TBH it would be ALOT simpler to just run the whole thing off a raspberry pi with WiFi and have it scoop all your caldav and outlook data along with a voice assistant that notes stuff in your calendar.
      My gods.. so many wasted possibilities.

  • @greatscott9231
    @greatscott9231 5 років тому +438

    Simone, you've run into the "80, 80 rule of project management." That is, the first 80% of the project takes 80% of the time, and the last 20% of the project takes the other 80% of the time. Except that's overly optimistic.

    • @lightwaveez7416
      @lightwaveez7416 5 років тому +50

      It's always nice to have 160% Time for a project ;)

    • @FranksReactions
      @FranksReactions 5 років тому +21

      And don't forget to multiply the time estimate by pi.

    • @SandiskCruzer
      @SandiskCruzer 5 років тому +15

      You could just say the 80-20 rule: 80% of the project takes 20% of the time, the rest is vice versa, with the side-note you thought the first 80% would take 80% of the total time. That would be a more realistic approach. ;)

    • @greatscott9231
      @greatscott9231 5 років тому +15

      @@SandiskCruzer, the point of the 80, 80 rule is that no one can guess all the unknowns correctly. Plus pressure from management to reject the "realistic" schedule because it shows the project taking too long, and therefore they want a shorter schedule. The result is that _everything_ takes twice as long as you thought... if you're lucky. Typically the employees end up working massive amounts of overtime to hit the release date (engineers and managers are usually salaried, so 40 hours or 80, they get paid a flat rate per week). If you're unlucky then you end up trapped in a "death march project" (there's even a book by that name).

    • @AsphaltAntelope
      @AsphaltAntelope 5 років тому +3

      Parkinson's law is the adage that "work expands so as to fill the time available for its completion". - en.wikipedia.org/wiki/Parkinson%27s_law

  • @shadowshifter5348
    @shadowshifter5348 3 роки тому +32

    Is there ever going to be a restock of the everyday calendar? I finally have a job to be able to buy stuff like this and I would love to use it for my pills

  • @Gozyization
    @Gozyization 5 років тому +349

    Oh, I love your necklace.

  • @d.e.s4432
    @d.e.s4432 5 років тому +528

    I can't stop laughing at the idea of having a new year's resolution to be more mysterious. I love it.

    • @GrinningGrey
      @GrinningGrey 5 років тому

      I want to copy that resolution hard. 😂 Although, now it will be no mystery where the idea came from...

    • @TheSqoou
      @TheSqoou 5 років тому +12

      That's like making a plan to be more spontaneous.

  • @noenken
    @noenken 5 років тому +159

    Feb 29 should be a tiny little add-on thing with just that one button. :D

    • @mrtyman408
      @mrtyman408 5 років тому +6

      Kickstarter-exclusive, of course!

    • @kishinslayer2228
      @kishinslayer2228 5 років тому +7

      A small drawer pulls out with the button in it

  • @Yoda19611
    @Yoda19611 5 років тому +1

    I have to admit that before seeing this video, I didn’t know who Simone was. After seeing this video and a few others that came up on me feed afterwards I can only say that I am am quite impressed with this young lady. She’s younger than all my children, hence then young lady. I saw the brain tumor videos and saw the strongest, bravest, and most optimistic person that was able to show her true feelings of how she was dealing the whole ordeal (for lack of a better term). What a great role model! Keep up the great work with your projects and your health!

  • @BlackMagicCraftOfficial
    @BlackMagicCraftOfficial 5 років тому +134

    You are such an amazing human.

    • @daniel4647
      @daniel4647 5 років тому +3

      Well that sounded genuine and not at all like you're promoting your channel, good job with the subtly there.

    • @arturoromero3166
      @arturoromero3166 3 роки тому +1

      Skin human*

  • @VOLAIRE
    @VOLAIRE 5 років тому +167

    Cool that you updated everyone
    Sometimes you don’t really hear about the behind the scenes stuff

    • @emc2mm
      @emc2mm 5 років тому +7

      Do not send anything back - to China. I have done product development for years. It’s not worth it. It’s the problem with off shore production, But I have several ideas for solutions. If you have not figured out shipping I could help you figure out green solutions that the shipping monkeys can’t destroy and the earth will be happy too.

    • @superbeavers7645
      @superbeavers7645 5 років тому

      @@emc2mm how does this relate to the comment?

  • @BucketCharlie
    @BucketCharlie 5 років тому +61

    That necklace is dope. That calendar is fantastic. That macaroni art is top notch.

  • @JesseDriftwood
    @JesseDriftwood 5 років тому +74

    Congrats on the progress thus far! Bummed I missed out on the first batch but will happily order once they become available. This is the ultimate UA-camr merch.

    • @AlexAlex
      @AlexAlex 5 років тому +1

      The term 'UA-camr merch' just cheapened the whole thing 😞

    • @JesseDriftwood
      @JesseDriftwood 5 років тому +2

      Alexatron it was a dumb joke relax

    • @daniel4647
      @daniel4647 5 років тому

      @@JesseDriftwood You're a dumb joke, you relax

  • @ckline5486
    @ckline5486 5 років тому +1

    Simone, you never have to feel guilty about asking people to watch your videos. They are all great and I always look forward to them. You are a fascinating, creative young lady and you are as cute as a basket of kittens. You look so healthy and happy now. It's great to see that after what you have been through. Congratulations on your new product. I am so happy for you! This made my day. : )

  • @treyfort4805
    @treyfort4805 5 років тому +159

    Me: How you doing?
    Simone: Great!
    Me: So what have you been doing?
    Simone: MACARONI ART!!!!!!!

    • @SheepdogSmokey
      @SheepdogSmokey 5 років тому +1

      I can't watch except on my phone which is tiny when at work, is she in remission again?

    • @treyfort4805
      @treyfort4805 5 років тому

      @@SheepdogSmokey yep. She gone straight crazy

  • @make.anything
    @make.anything 5 років тому +166

    So cool, congrats on the prototypes! If it's only a handful of units that have dodgy frames, I would tear those apart and make special custom framed units in your shop.

    • @TheSkepticSkwerl
      @TheSkepticSkwerl 3 роки тому +1

      From the ones I have seen photographed on her website, she redesigned the frames.

    • @couchpotat
      @couchpotat 3 роки тому

      why are there so few replys

  • @Lea19822
    @Lea19822 5 років тому +482

    Thats some excellent macaroni art 👍

    • @TheCimbrianBull
      @TheCimbrianBull 5 років тому +1

      Your profile picture is awesome! 😀

    • @Lea19822
      @Lea19822 5 років тому +1

      TheCimbrianBull thanks 👌

    • @zaptor1514
      @zaptor1514 5 років тому +1

      Leanna Cox I thought it was fishbones strung together.

  • @variationsofnoisev.o.n422
    @variationsofnoisev.o.n422 5 років тому +53

    maybe the best time to change the name is at the point you make them available for purchase? like this you have the first special backer version and the version to purchase :)

  • @pali1H
    @pali1H 5 років тому +660

    "I don't know how we could have done this in real time without Dropbox!"
    Google docs: WTF?

    • @JPower172
      @JPower172 5 років тому +18

      Nah the google drive alternate versions of microsoft office have way less functionality.

    • @MrMario616
      @MrMario616 5 років тому +78

      Git is would be even better, because you have a real history... And there's no chance of overwriting each others changes by accident

    • @Comhead1234
      @Comhead1234 5 років тому +16

      @@JPower172 Just link Google drive to any folder on you computer and upload your own word docs

    • @Lizlodude
      @Lizlodude 5 років тому +9

      If you are able to use the gDoc format, docs, sheets, etc., it's great, but as soon as you need to use something else, as I'm sure you would for board designs, code, forms, etc, it becomes a pain in the butt. Love Google Docs, but yeah some things its just not great at.

    • @MikeShyu
      @MikeShyu 5 років тому +47

      Because Dropbox is not banned in China. Google drive can’t be accessed without a VPN. If they were using Dropbox to keep their Chinese contacts up to date with the latest design drawings having a non VPN option is pretty important. Since the government can make VPN access difficult during politically sensitive events such as elections.

  • @jimmcnally2524
    @jimmcnally2524 3 роки тому +1

    It is heartwarming to see how people reward someone who is transparent, sweet and sincere.

  • @ClickingHeads
    @ClickingHeads 5 років тому +59

    You weren't asking for money. You put out a product that you thought people genuinely enjoy and people bought it. In fact this could help out alot of people who lack motivation in their goals.
    So thanks for the sweet calendar.

  • @vohiii
    @vohiii 5 років тому +412

    That Dinosaur is DOPE

    • @piemaster6512
      @piemaster6512 5 років тому +1

      My girlfriend would love the shit out of that. I want one.

    • @runklrgurlexe
      @runklrgurlexe 5 років тому

      It used to be available on wickedclothes.com but they stopped selling jewelry 😭

    • @simonegiertz
      @simonegiertz  5 років тому +39

      It's from Tatty Devine: www.tattydevine.com/products/dinosaur-necklace-gold-2368

    • @terriblej6107
      @terriblej6107 5 років тому

      If you Google search "dinosaur necklace" its like the first result. Wish for a buck, Amazon for 7

    • @bluef1sh926
      @bluef1sh926 5 років тому +3

      @@terriblej6107 If someone buys something for a gift, he should definitely stay away from Wish. You literally get what you paid for there, in the bad way.

  • @JoeBruin96
    @JoeBruin96 5 років тому +283

    I thought I was wasting my time watching this video, but the macaroni art made it worth it. Apology accepted Simone ;)

  • @justinh3d
    @justinh3d 5 років тому +433

    Simone, you’re my favourite skin human

    • @GrinningGrey
      @GrinningGrey 5 років тому +1

      😂😂😂

    • @jakew3
      @jakew3 5 років тому

      So racist

    • @oneseeker2
      @oneseeker2 5 років тому

      A skin human?

    • @eliza1498
      @eliza1498 4 роки тому +1

      who's ur favourite meat human

    • @booty_hunter4207
      @booty_hunter4207 4 роки тому +1

      @@jakew3 thought this was trolling but after looking at your other comments in seems that you're just stupid

  • @z-beeblebrox
    @z-beeblebrox 5 років тому +106

    The macaroni art "Sorry" has 'meme material' written all over it

  • @AverageMax13
    @AverageMax13 5 років тому +61

    The "Light up my day" calendar.

  • @femmechanic1931
    @femmechanic1931 5 років тому +18

    Simone, I just want to say that you inspire me everyday! I'm a female mechanic, and I take great joy out of seeing your engineering skills put to work. We need more women like you!💞🤘😘

    • @suprstraight2421
      @suprstraight2421 5 років тому +1

      What skills? xD

    • @tanmaypanadi1414
      @tanmaypanadi1414 5 років тому +1

      @@suprstraight2421 I agree she is more of an entertainer
      Most of these skills don't fall under mechanically they are general tools of any creators trade .

  • @marcusdire8057
    @marcusdire8057 5 років тому +35

    Don't feel guilty!! I LOVE your videos. Your quirky humor and upbeat attitude always makes my day so much better. :) Thank you for sharing a bit of yourself with all of us

  • @tinyphreak
    @tinyphreak 5 років тому +26

    "... and maybe I'll change the name at some point. I just don't know when a good time to do that is."
    Now! Much better to do it now rather than later. As the great Shia Labeouf once said; Don't let your dreams be dreams. Just, do it!

  • @Jorza4daWorld
    @Jorza4daWorld 5 років тому +41

    'Everyday calendar' is a great name!
    The whole point is that every day is on one panel, and you can see them all together. That's something unique and characteristic for your calendar.
    I think 'light-up calendar' is good too, but maybe too descriptive. I can tell it's light-up by looking at it, and the name doesn't add as much to how I see the product.

    • @booty_hunter4207
      @booty_hunter4207 4 роки тому

      Someone else came up with busy bee calendar and I think its perfect!

  • @boges11
    @boges11 5 років тому +122

    You could call it "the Lighten Up Calendar" as you made it to meditate and lighten up, and it also lights up.

  • @skeetsmcgrew3282
    @skeetsmcgrew3282 5 років тому +176

    February 29th is International Cheat Day

    • @bennylloyd-willner9667
      @bennylloyd-willner9667 5 років тому +7

      Yeah, I was looking for this, I just couldn't be the only one wondering about Feb 29th. The next version of the calendar should have a Feb 29 popping up when needed (like proper mechanically completely hidden away "normal" years)

    • @EATSLEEPDRIVE2002
      @EATSLEEPDRIVE2002 5 років тому +2

      One day a year? Tell that to my ex-wife !

    • @whack6102
      @whack6102 5 років тому +5

      @@EATSLEEPDRIVE2002 one day every four years. February 29 only occurs on a leap year

    • @bennylloyd-willner9667
      @bennylloyd-willner9667 5 років тому

      @Rebster ty for info, I'll check it out 👍

  • @57thorns
    @57thorns 5 років тому +40

    Thank you for being honest about Crowd Funding goals not having any connection to reality.
    Would you have been able to produce and ship if you just reached the goal?

  • @Bacoprah
    @Bacoprah 4 роки тому +1

    Can't believe its been over 2 years since your surgery. YAY, keep on keeping on!

  • @joker_g7337
    @joker_g7337 5 років тому +166

    Improvement idea: another color for the last-clicked/current day.

    • @c0r3n
      @c0r3n 5 років тому +21

      And if you press two second one day, its maybe light in blue¡ for mark a special day¡

    • @baitlord2932
      @baitlord2932 5 років тому +7

      Basically multiple color for marking
      P. S Also add a hold function to every day, to let you set to the current day
      P. S. S sync it with app

  • @virgilfulton4426
    @virgilfulton4426 5 років тому +5

    As a charter member of the Society for the Preservation of the Marconi Arts, I want to applaud your efforts in spreading the word for our cause. Thanks Simone.

    • @straybricks
      @straybricks 2 роки тому

      Macaroni? Marconi contributed to the invention of radio.

  • @PantsuMann
    @PantsuMann 5 років тому +15

    Omg that necklace!
    Also, I would love an automated calendar like that. Looks dope af!

  • @thgersrensen1855
    @thgersrensen1855 5 років тому +10

    I think you should call it something in the lines of "Brighter future calendar" because you use it to develop healthy habits, and every time you do so, you turn on a light. The calendar that brightens up every day of your life. It ain't perfect yet, but you get it!

  • @tantalumtt
    @tantalumtt 5 років тому +53

    Calendars will be shipped February 29th, 2020. Ok, byyyeeeee.

  • @lasivianleandros3558
    @lasivianleandros3558 5 років тому +5

    Don't feel guilty. I love your videos. :) You're one of the most "real" youtube personalities I know of.

  • @armstrongc02
    @armstrongc02 5 років тому +8

    As a product development engineer, I feel the "you think you're three weeks away, but then remember that's how you felt 5 months ago" sentiment. It can be so soul-crushing and frustrating at times but the first time you hold that thing you made in your hands

  • @cavenerd
    @cavenerd 5 років тому +115

    Whatever Simone wants Simone Giertz ;)

  • @uniquelyabledfamily9438
    @uniquelyabledfamily9438 5 років тому +59

    Well done you should be so proud it's a fantastic product I would love one x great job xx

  • @MystalurDimensh
    @MystalurDimensh 5 років тому +5

    "You can print more dollar bills, but you cannot print more trust into this world". Wow, this hit me more than it should...

  • @lroedit
    @lroedit 5 років тому +1

    Your ted talk is literally on my school curriculum to teach us about creativity! I was mentally screaming when my teacher put it on!

  • @brightontilifly
    @brightontilifly 5 років тому +53

    Please can we get a kit form, for people who like to solder and listen to BigClive?

  • @Gabe_Maher
    @Gabe_Maher 5 років тому +24

    I was just looking at that necklace the entire time, I love it!

    • @Judah.Rosenthal
      @Judah.Rosenthal 5 років тому +1

      Me too! Looks like a walking bird. Without a head.

    • @sparthir
      @sparthir 5 років тому

      I know right? Awesome necklace.

  • @Cyrax89721
    @Cyrax89721 5 років тому +16

    I like to think that there's an easter egg or two built in if you press a specific sequence of numbers. :-)

  • @Kenturaibutterfly
    @Kenturaibutterfly 5 років тому +16

    I love that they look like frames found in bee-keeping hives and that the buttons are HONEYCOMB SHAPED

  • @TheCatsMe00w
    @TheCatsMe00w 5 років тому

    Honestly really excited for these coming into the world. It's such an instant gratification of see the things light up and you get such a pretty picture at the end. This is going to hell a lot of people for healthy habits and meet their goals. It's also such a great reminder to do the thing. A lot of issues I run into when trying to start a new routine is to just remember it in the first place.

  • @radish6691
    @radish6691 5 років тому +50

    You don’t know what a business body is? It’s the body of a mantis shrimp!

  • @blakem9109
    @blakem9109 5 років тому +4

    You know what lights up my day, a new Simone video.

  • @Ephergie
    @Ephergie 5 років тому +5

    Simone... I SO LOVE that necklace! Well done on the campaign, the Calendar... and being the fabulous YOU that you are! Virtual High Five and Ghost Hug :-)

  • @allianceofsteel
    @allianceofsteel 5 років тому

    i tried a crowdfunding thing awhile back and it was a horrendous embarrassment (long story, rushed, not prepared, ect.) but this gives me hope that my other idea I'd like to bring to market might stand a chance at success. You put into words so many things I felt, like asking for help. I myself am usually the one helping, not needing or getting help. So to ask for stuff like that almost comes with a level of guilt. I really appreciate you taking the time to make this video. Gives some of us hope and thank you.

  • @bozire
    @bozire 5 років тому

    1st, congrats- you looked so excited, emotional and proud, and you should be. Second, I would just like to comment about how powerful checking off each day can be- especially when wanting to achieve that day's goal(s). I have this thing where, when I want to overcome or accomplish something that is impossible to do, I check off a daily "victory" over it- one day at a time, and it helps empower me as I see the daily victories pile up. It helped me overcome the most impossible thing for me to do- quit smoking, for example. I would see the victories mounting day by day, and if I slipped and messed up- it all got erased and I had to start over. This added value to how important each day really was. You can have a victory using yesterdays win- you have to win the day-TODAY. THIS is something I would buy and use the same way. The "Just For Today" or "Win the Day" calendar. The price would have to be fair, of course, but I am sure it would be. Again, congrats!!

  • @MarcoNoPolo
    @MarcoNoPolo 5 років тому +71

    "Everyday Calendar" is perfectly fine for the name. There's nothing wrong with it. At all.=)

    • @MasterTypoDemon
      @MasterTypoDemon 5 років тому +3

      Is it really an "everyday" calendar if it doesn't include Feb 29th? That makes it seem like it's an everyday calendar 3 out of every 4 years.

    • @kporter85db
      @kporter85db 5 років тому +2

      You should call it the Almost Everyday Calendar.

    • @MarcoNoPolo
      @MarcoNoPolo 5 років тому

      @@MasterTypoDemon I think more people would complain about that 1 day not being lit up for 3 years. Including myself. Your eye would always been drawn to it. It would make it look incomplete. (IMO)

    • @alex.cristescu
      @alex.cristescu 5 років тому

      @@MarcoNoPolo You could've lit it up with the 28th in those 3 years... for your OCD :)

    • @solarprogeny6736
      @solarprogeny6736 5 років тому +2

      @@MarcoNoPolo there should be a removable black hexagon at the bottom of february which you can remove to insert the 29th button every 4 years

  • @illitero
    @illitero 5 років тому +46

    _opens Toucheroni Calendar and a bunch of sand comes out_
    What the...beach?

  • @groofay
    @groofay 5 років тому +24

    If the "queen of shitty robots" thing falls through for some reason, "macaroni artist extraordinaire" might be a good backup.

  • @boozefort
    @boozefort 5 років тому +4

    I didn't have a resolution until seeing this. I will join you, but also give you a hand. I am now, also, going to be more mysterious. I am not going to say I am being mysterious, I am going to say stuff like "I have made some kind of important commitments for the new year, but I am not at liberty to discuss any of it at this time." You can add an apology if you feel you need to, I, however, do not feel that need. If you just can't have this resolution without telling everyone, then when you do tell everyone, you have to laugh and act like youre faking. Then it is still kinda mysterious.

  • @guymandude999
    @guymandude999 5 років тому

    I think it's going to be very helpful for people to stick to a daily regimen and develop healthy routines. It's sooo good to see your face again, Simone!!! Vancouver loves you!

  • @tyrred
    @tyrred 5 років тому +62

    Simone.... you're just.... such a gem. Skin human here, just waiting for my everyday calendar to arrive.
    Wait! I moved since backing the campaign! How do I update my shipping address?

    • @tanmaypanadi1414
      @tanmaypanadi1414 5 років тому +5

      Can you update this comment if you do get to change your shipping address

  • @TheGreatPyroWolf
    @TheGreatPyroWolf 5 років тому +35

    Can you make one abit smaller with a knob to switch between months, and RGB so you can have a red day or a blue day or green day .

  • @duckupine4345
    @duckupine4345 5 років тому +13

    Yeah, the calendar... BUT YOUR NECKLCE OH MY GOD ITS BEAUTIFUL

  • @Lp0onfire
    @Lp0onfire 5 років тому +12

    2:51 my "A-ha!" moment when I finally realized what her necklace was and felt extremely stupid for not realizing something so obvious earlier.

  • @ritual64
    @ritual64 5 років тому

    Don't feel guilty Simone, you are entertaining us whether its about your calendar or your TruckLA or even a simple update on one of your many inventions. We love to see you, you seem to be a very interesting person.

  • @emmahaggins3326
    @emmahaggins3326 5 років тому +151

    Can the next version have a feb. 29th? Would love to be able to have a birthday button!

    • @BarqueCat2
      @BarqueCat2 5 років тому +20

      There could be little round translucent colored discs (think the repositionable window decorations) that could go on the underside of the glass to tint given days like birthdays, anniversaries, vacations, etc. They could be moved or changed as desired. I'd definitely put them underneath rather than on top - but that would require removing the glass,which probably isn't recommended...

    • @vir042
      @vir042 5 років тому +18

      @@BarqueCat2 Or just a double click to change the LED color, leds are so cheap it shouldnt be much of a problem to at least have two color leds for each square and with that you could combine it to a ton of different variations. Also if you are worried that it wont look good, just make it so that normal is 100% yellow while birthday is 80% yellow 20% red..

    • @GrinningGrey
      @GrinningGrey 5 років тому +3

      Oh my! I hadn't considered it before, but what do people with Feb 29th birthdays do since they don't have a birthday day but every four years? Do you pick a day on either side? Tell people you're four times younger than you are because it's a technicality? Such a conundrum!

    • @mrspoons3970
      @mrspoons3970 5 років тому +1

      @@GrinningGrey I celebrate on February 28th, and no, a short year is still a year. Queue all the other silly questions I get asked upon meeting everyone...

    • @djhbomb2988
      @djhbomb2988 5 років тому

      Mr Spoons: As a fellow leap year baby I feel your pain.

  • @Moshicake
    @Moshicake 5 років тому +8

    I love this video, having it broken down like this was really awesome to see. And congrats on an awesome project! (The calendars loooook amazing btw!)

  • @weirdwind1
    @weirdwind1 5 років тому +128

    Next thing you know china’s Put out a “each day calendar “ for $100 that looks *suspiciously* similar...........

    • @MatthiasTTV
      @MatthiasTTV 5 років тому +13

      I mean yeah, there's no reason this thing needs to cost $300.

    • @witgangyounotube287
      @witgangyounotube287 5 років тому +21

      @@MatthiasTTV reason was unknown variables for small batch manufacturing, if the thing goes viral then yeah i could see it drop to 100$.
      would you rather have projects be more reasonable priced and fail to deliver to all backers because the manufacturing price they estimated was lower than what they had to pay?

    • @Mickeystwin33
      @Mickeystwin33 5 років тому +24

      @@MatthiasTTV They weren't just paying for the product though. They were also backing the product and helping to pay for production

    • @suprstraight2421
      @suprstraight2421 5 років тому

      Rather 10$ , the materials for this piece of crap coated 2$

    • @ragamuffin1588
      @ragamuffin1588 5 років тому +1

      @@suprstraight2421 Do you actually think the materials cost $2 ?

  • @malinw1910
    @malinw1910 5 років тому +6

    I like the idea of getting one day off from meditating every forth year.

  • @LykleSchepers
    @LykleSchepers 5 років тому

    Hi Simone, happy for you guys that you are shipping. I know personally what a trip that can be.
    You talked about the time planning and how it always gets delayed. There is a thing called Hofstaeter's law. It states that every project always takes twice as long as planned, even when taking Hofstaeter's law into account. And boy was he right!
    Keep it up, and good work on getting the product out there!

  • @atlasdeer
    @atlasdeer 5 років тому +10

    I am so stoked for this calendar!!

  • @waredog6966
    @waredog6966 5 років тому +10

    OKAY everybody: If Disney can have Disneyland, then I feel Simone can have the "GIERTZ CALENDAR" Who's with me on this??

  • @jeremycatches9766
    @jeremycatches9766 5 років тому +13

    I will take one with those messed up corners!

  • @SpidermanFan92
    @SpidermanFan92 4 роки тому

    I never saw that awesome necklace before until I saw you wear it. My time wasn't wasted here, thanks Simone!

  • @kerrykrishna
    @kerrykrishna 5 років тому

    Simone, this is first vid I have seen of yours in many months. Nice to see you active! I hope your health is doing better? NorthAmerica ( Canada especially!) Loves you and what you keep doing!

  • @Daxelinho9
    @Daxelinho9 5 років тому +4

    Wow, this looks soo good! Awesome work! An you even found time to make another one wich says "sorry"!.
    The calender is nice aswell.

  • @anchorbait6662
    @anchorbait6662 5 років тому +5

    Simone just pushed my birthday. You the best June 3rd!

  • @FatheredPuma81
    @FatheredPuma81 5 років тому +393

    "idk how we'd do this without dropbox"
    You'd do it with Google Drive is how you'd do it...

    • @moth.monster
      @moth.monster 5 років тому +9

      I'd do it with MEGA...

    • @angerock49
      @angerock49 5 років тому +7

      Yeah but you can't sync local folders on Google drive it's all just on the drive and you kinda have to re-upload if you change something

    • @JarmoHakala
      @JarmoHakala 5 років тому +41

      @@angerock49 You can sync local folders to drive. I've been using it for years to sync files between my computers.

    • @AD-hq2uz
      @AD-hq2uz 5 років тому +3

      @@moth.monster mega is more secure but the team sync isnt as good as dropbox

    • @FatheredPuma81
      @FatheredPuma81 5 років тому +2

      @@moth.monster You also can't see text documents get edited live.

  • @analogkid01
    @analogkid01 5 років тому +1

    Okay, so you had these manufactured in China, and I can understand the economic incentive to do so. What steps did you take to ensure that the employees of the Chinese factory are treated humanely, work in a safe environment, and paid a living wage?

  • @rosetyler9977
    @rosetyler9977 5 років тому

    I've had a very bad week and I was just laying in my bed relaxing to Bon Appetit vids when I saw that you have a new one and I immediatly dropped everything. I actually cried a little (a bad week, remember, I'm v emotional right now) when you pulled out that macaroni art with the word "Sorry" on it.

  • @Recidente1011
    @Recidente1011 5 років тому +8

    you are fine, everthing is ok

  • @JohnDoe-tx8lq
    @JohnDoe-tx8lq 5 років тому +23

    Version With Extra Interaction: The calendar has a random day that will give you an electric shock. The day changes each time you re-set the year.
    Not a fatal shock, obviously, just enough to send you to hospital with a 3rd degree finger burn, providing you with a good story to tell your friends as you laugh about it later on... 👍😎

    • @ribbitgoesthedoglastnamehe4681
      @ribbitgoesthedoglastnamehe4681 5 років тому

      A 1/7 chance to get a minor shock, a 1/7 chance to get chocolate candy. Get some excitement in your daily grind.
      Unless you are chocoholic, in which case you are guaranteed about 52 electroshocks a day.
      Lets just call it a therapy device then.

  • @ceejayrob
    @ceejayrob 5 років тому +22

    My friend Nils also says sorry for taking my time when he’s showing my something he’s made. Is it a Swedish thing?

  • @shelleynobleart
    @shelleynobleart 5 років тому

    So happy you're looking so clear and well. It's a fabulous product, beneficial and beautiful. Much respect and celebration.

  • @jaspergardner
    @jaspergardner 5 років тому +1

    Your necklaces are so dope! The scissors one is really cool as is this Dino one!

  • @RaindropsBleeding
    @RaindropsBleeding 5 років тому +9

    how in the heck am I just hearing about this. I would gladly have backed this

  • @Masterfighterx
    @Masterfighterx 5 років тому +47

    Lumen Callendar seems like a good name. Or, Lumos Callendar for the ultimate geek experience. Lumendar for short :-D

    • @sydneymomma11
      @sydneymomma11 5 років тому

      Yes, Lumendar is great!!!

    • @Masterfighterx
      @Masterfighterx 5 років тому

      @@sydneymomma11 Ah, it's an A as second last, oh well :-P

  • @RandomZephyr42
    @RandomZephyr42 5 років тому +60

    Everyday Calander is a bomb name, please don't change it!

    • @vizionthing
      @vizionthing 5 років тому +1

      To be fair, no one else thought of it

    • @themeatpopsicle
      @themeatpopsicle 5 років тому +4

      i think it's a GREAT name. you have to interact with it *Every Day*

    • @neolexiousneolexian6079
      @neolexiousneolexian6079 5 років тому +3

      @@themeatpopsicle Plus, it shows you every day at once, unlike those weak normal calendars that can only manage less than a tenth of a year at once!

    • @foodgeek320
      @foodgeek320 5 років тому

      ...huh? No, she's right, it was a stupid name. Every single daily calendar in existence is an "every day calendar". It's like calling your phone a "phone call phone", or your car the "driving car".
      It's okay to be a fan of hers, I am too - but complimenting stupid decisions is not helpful.

    • @foodgeek320
      @foodgeek320 5 років тому

      As well, there's NO reason they couldn't have included Feb 29th. So it's not even every day.

  • @TheHandToolery
    @TheHandToolery 5 років тому

    Gonna predict this now: there will be stop-motion everyday calendar light animation videos within exactly 1 minute of these amazing creations arriving in the hands of the backers. And I will gladly watch them! Congratulations! They really are stunning!

  • @TamarZiri
    @TamarZiri 5 років тому

    You make life better for all of us. No need to feel guilty about people watching your videos or asking for money.