The Case of Mark Twitchell | HasanAbi reacts to Filmmaker Directing His Own Confession

Поділитися
Вставка
  • Опубліковано 5 січ 2025

КОМЕНТАРІ • 348

  • @gratianray2
    @gratianray2 2 роки тому +713

    the worst serial killer meets his match, the worst interrogators

    • @jingbot1071
      @jingbot1071 2 роки тому +62

      Thumb war

    • @thelonewolfie34
      @thelonewolfie34 2 роки тому

      Canada is just an iron lobby for detectives and criminals

    • @bigroncoleman11
      @bigroncoleman11 Рік тому

      He’s not a serial killer though....

    • @deadlykitten3004
      @deadlykitten3004 Рік тому

      @@bigroncoleman11 he’s a self-proclaimed serial killer

    • @Sophia-vk5bq
      @Sophia-vk5bq Рік тому +9

      @@bigroncoleman11 The garaedj tells a different story eh?

  • @n1t_
    @n1t_ 2 роки тому +502

    True Crime is back on the menu. Nice

  • @Jutilaje
    @Jutilaje 2 роки тому +344

    The cop started folding because - as everyone knows - it's been scientifically proven that Canadians can only handle 7 seconds of confrontation at a time before apologizing, but he's trying to suppress the "sorey"

    • @flowersinawasteland
      @flowersinawasteland Рік тому

      they’re pretty good at gen0c1ding natives for longer than 7 seconds….

    • @Jutilaje
      @Jutilaje Рік тому +1

      @@flowersinawasteland they just got peer pressured into it by the US.

    • @CyberK4
      @CyberK4 Рік тому +2

      If that's your view of Canadians, clearly you've never been to Saskatchewan.

  • @zachtooill
    @zachtooill 2 роки тому +72

    I can’t believe the “Garage Technique” failed for the first time since 1916 (when the first garage was invented).

  • @ianianianianian
    @ianianianianian 2 роки тому +421

    Hasan confronting his hypothetical wife Nancy about her thumb uncle really cracked me up. and then the cop said garaedj and that really took it to another level. good shit

    • @Cussyzera
      @Cussyzera 2 роки тому +16

      Sorry chatter, your thumb son is going to say garaedj

    • @jheisz19
      @jheisz19 2 роки тому +28

      As a Canadian I saw nothing wrong with the cops pronunciation and now I’m reconsidering my entire life.

    • @ianianianianian
      @ianianianianian 2 роки тому +14

      @@jheisz19 I mean, at least you can be sure that you’ll always improve the mood of anyone who hears you say garage! it’s hilarious

    • @bacicinvatteneaca
      @bacicinvatteneaca 2 роки тому +2

      @@Cussyzera he didn't say that. There was no e. And he didn't pronounce the first a.

  • @dakotaloven1362
    @dakotaloven1362 2 роки тому +225

    Whenever hasan talks about thumb people I think about the thumb thumbs from spy kids just those dudes that were like 100% thumb for some odd reason

    • @cctomcat321
      @cctomcat321 2 роки тому +23

      Someone shared an image of one during one of his thumb comments. Indistinguishable from the real cop's photo.

    • @dakotaloven1362
      @dakotaloven1362 2 роки тому +20

      @@cctomcat321 well yea man most cops are literally thumb thumbs from the movie they weren’t cgi they were hired cops bro you didn’t know that?

  • @Jordan-kq3qw
    @Jordan-kq3qw 2 роки тому +94

    This dude wrote his confession, walked into the police station and thought, "You know what, changed my mind, I bet I can get away with this murder"

  • @camelorcaramel5732
    @camelorcaramel5732 2 роки тому +148

    “This is called the admitting everything technique” *they let him go* it’s very effective.

  • @cats1970
    @cats1970 2 роки тому +9

    4:19 “tf kinda name is twitchel lmao” completely took me out dude. was just sitting here spacing out and nearly choked

  • @BeTheAeroplane
    @BeTheAeroplane 2 роки тому +45

    In the book he changed "John" to "Jim" and thought he'd get away with it 😂

  • @BenjyF563
    @BenjyF563 2 роки тому +636

    I usually use this genre of content to fall asleep (JCS, Matt Orchard and co) and prefer Hasan’s reactions because all the pauses and stuff stretches the already long runtime out so I can just stick it on and check out
    thank you for the upload :)

    • @j.s.7894
      @j.s.7894 2 роки тому +99

      Are we living the same life wtf

    • @Goodenough_media
      @Goodenough_media 2 роки тому +25

      Lmaoo either Hassan’s true crime reactions or attack on titan nothing else puts me to sleep quite like these🤣🤣

    • @chav2002
      @chav2002 2 роки тому +22

      @@Goodenough_media aot I feel like I'd be too into the show to fall asleep

    • @rikititi1848
      @rikititi1848 2 роки тому +4

      Yess me too!!

    • @Goodenough_media
      @Goodenough_media 2 роки тому +3

      @@chav2002 even the first season ??? I’ve seen it like 10 times so it’s easy for me to knock out

  • @argosfe7445
    @argosfe7445 2 роки тому +220

    Innocent or not, if your answer is not "I want to talk to my lawyer", you are making a big mistake.

    • @chav2002
      @chav2002 2 роки тому

      Cops aren't interested in charging the correct person if they can coerce a confession out of an innocent person they'll be ecstatic. You're 100% correct the number one rule of dealing the police is to shut the fuck up

    • @stefaniedanchak2526
      @stefaniedanchak2526 2 роки тому +6

      Yess

    • @ararepotato1420
      @ararepotato1420 2 роки тому +34

      No, the proper answer is: "Get me my lawyer." Wanting means you have a desire for your lawyer. You want them to know that this is a demand. Then shut up.

    • @jjmitch1411
      @jjmitch1411 2 роки тому +24

      Yep. The first things should be “why am I here?” “What charges am I being tried against” and “I will not speak without a lawyer”

    • @trashm.1426
      @trashm.1426 2 роки тому +7

      I know this is an old comment but this is terrible advice. Guilty or innocent you get a lawyer and then you shut the f up.

  • @TheSneakyDuck
    @TheSneakyDuck 2 роки тому +59

    It's awful to see the authorities ga-radgelighting a suspect.

  • @ZERO_O7X
    @ZERO_O7X 2 роки тому +176

    Narrator: "Anyone who was innocent would instantly become confrontational" is the most bullsh!t statement I've ever heard. Some innocent people become immediately enraged when accused, some shut down in disbelief of their situation. I'm so sick of these "armchair psychological interrogation scholars" channels.

    • @CChissel
      @CChissel 2 роки тому +31

      This may just be me reaching, but I took it to mean confrontational as proclaiming their innocence and taking a stand, aggressively or passively. Confronting the interrogator by saying something like “what evidence do you have.” Or “that’s bullshit, I didn’t do a fucking thing.” But yeah idk.

    • @yee2urhaw246
      @yee2urhaw246 2 роки тому +22

      i think the point is not refuting direct accusations. if you're innocent and accused of something you didnt do, not everyone will fly off at the mouth, but most people would AT LEAST refute it pretty immediately

    • @auberry8613
      @auberry8613 2 роки тому +23

      It completely ignores traumatized/neurodivergent people who may shut down or even become agreeable with the accusations

    • @cats1970
      @cats1970 2 роки тому +4

      Meanwhile when I feel threatened I try to follow the conversation and hear out enough info as possible so I can find a way out.
      “I’m 100% convinced you killed that man.”
      “Yeah.”
      “People saw you two come in, only you came out.”
      “Sure.”
      “You have the exact same Ikea knives as the one used to stab him.”
      “I do have those yes.”
      “Since you just confessed, add your signature here please.”
      “.... ok so I’m gonna need a lawyer since everything you just said was bullshit.”
      My plan is to just never get suspected bro I’d be done for

    • @bobbobsled8843
      @bobbobsled8843 2 роки тому

      Lol isn’t confrontational and enraged the same thing buddy

  • @Maxisamo1
    @Maxisamo1 2 роки тому +35

    If you played a drinking game to take a shot every time the cop (and only the cop) says "Geraj", you'd be dead halfway through

  • @Gotrek-sk8rq
    @Gotrek-sk8rq 2 роки тому +50

    “Cop Phrenology” 🤣

    • @ZERO_O7X
      @ZERO_O7X 2 роки тому +4

      Human Thumbs

  • @Jettmingin
    @Jettmingin 2 роки тому +74

    Only oldheads would remember but Jim Smith is the only good cop ever

    • @AtulPYadav
      @AtulPYadav 2 роки тому +30

      Calm, cool, collected.
      Broke the Rapist Killer Colonel apart in about half hour.
      It was one of the only moments where Copaganda actually worked one me.

    • @zyyps
      @zyyps 2 роки тому +12

      Jim one of the coldest to ever do it fr

  • @bexkroezen5995
    @bexkroezen5995 2 роки тому +23

    I’m sorry but “backseat driving his own assault” is the best part of the whole video.

  • @storkksoundmedia7778
    @storkksoundmedia7778 2 роки тому +19

    My favorite garage is the British one.. “Garriage”
    *rhymes with marriage

  • @NatalieRose-u5t
    @NatalieRose-u5t 4 місяці тому +1

    This technique is called the Drop The Ball technique. Absolutely drop the ball, fumble it, recatch and somehow win.

  • @hyahe
    @hyahe 2 роки тому +79

    omg is hasan doing true crime reactions again? im so excited, theyre what got me into his stuff, i missed these so much!

  • @carysfaerie
    @carysfaerie 2 роки тому +35

    Zoned out at the beginning because I was thinking about the sauce the pizza delivery didn’t include..snapped back in the room when hasan said THE SAUCES ARE IN! weird

  • @Hemogoblin127
    @Hemogoblin127 2 роки тому +103

    I love hasans crime reactions. I love the long content while doing other stuff

    • @jazzyg6298
      @jazzyg6298 2 роки тому +9

      These are my favorite videos to watch while doing dishes

    • @slowloris2894
      @slowloris2894 2 роки тому +1

      I love when he isnt speaking about how Crimea is justifiably Russian lol. As long as he isnt speaking about the war or the broader left, I love Hasan. However some of the leftists he's been calling nazis(Adam something) or the trans woman (Jay Exci) is kind of disappointing tbh.

    • @bacicinvatteneaca
      @bacicinvatteneaca 2 роки тому

      @@slowloris2894 Adam Something is a nazi

    • @londonyes1380
      @londonyes1380 2 роки тому +2

      @@jazzyg6298 Good choice. I watched today while I changed my bedsheets 👍

    • @uyentran1234
      @uyentran1234 Рік тому

      same

  • @solace6700
    @solace6700 2 роки тому +31

    Narrator: dude disappears
    hasan: LETS FUCKIN GOOOOOO!!!!!

  • @slowloris2894
    @slowloris2894 2 роки тому +75

    It scares me to think about sociopaths like Ed Kemper who totally could of gotten out of this horrible interrogation.

    • @FrshChees91
      @FrshChees91 2 роки тому +6

      I wonder if he ever would have been caught had he not turned himself in.

    • @mursuka80
      @mursuka80 2 роки тому +14

      @@FrshChees91 He would. He killed his mother, so it was just a matter of time. He knew that, so he turned himself in. It had nothing to do with remorse or other BS he said in those interviews.

    • @PhilipADitko
      @PhilipADitko Рік тому +1

      No surprise Hassan thinks this detective is doing a poor job interviewing him, when he doesn't know the first thing about police interrogations. Detective Clark did a phenomenal job in the interview. He's only looking at one clip of it. You actually look at the transcript as well as the full video of the entire interview, even before he started pressing him a little bit, he would engage in certain police techniques like asking him where he went to lunch at and what did he have, and if you couldn't remember that's the hint that he's lying, as well as checking the drive-thru footage of a nearby McDonald's if he says he went there to eat. There are other police techniques that this moron is oblivious to, like having a suspect tell their story backwards. He also looks at his mannerism and behavior. Getting a confession isn't an easy peasy thing and for this ass wipe to armchair quarterback him how to do his job is unbelievably pretentious.

    • @korubi_eCSTatic
      @korubi_eCSTatic Рік тому

      @@PhilipADitkoacab tho

    • @PhilipADitko
      @PhilipADitko Рік тому

      @@korubi_eCSTatic ^Anime avatar

  • @18booma
    @18booma 2 роки тому +55

    My girlfriend's dad is a true thumb, but we're lesbians, so no chance of a thumb child.

    • @leethax100
      @leethax100 2 роки тому +15

      Make sure it's your eggs when the IVF conversation comes around

    • @solala1312
      @solala1312 2 роки тому +9

      adopt to stop the thumb lineage and own all pigs once again.

    • @amarevanhook7453
      @amarevanhook7453 9 місяців тому

      Ur lucky

    • @An0nymous_L0gic
      @An0nymous_L0gic 7 місяців тому

      I mean you could get a donor with thumb genes

    • @An0nymous_L0gic
      @An0nymous_L0gic 7 місяців тому

      ​@solala1312 how can you assure you don't adopt someone with thumb heritage?

  • @Spencer481
    @Spencer481 2 роки тому +51

    The police had a T ball of a case and still nearly fumbled it at every step.

    • @bingusenjoyer197
      @bingusenjoyer197 Рік тому

      fr, the interrogator didn’t even try to sympathize with him to draw the confession out of him or try to lock him into his original story to catch him in a lie, he just went straight to saying “i know you committed the murder, just admit it you pussy!!!” and mocking him in the car like thats gonna do anything. he’s literally just like that other cop from the JCS video that hasan watched that just said “STEVEN!! I KNOW YOU KILLED THAT PRETTY LIL LADY!! STEVEN COME ON MAN!!” except less hilarious to watch and more infuriating

  • @mechisweats4282
    @mechisweats4282 2 роки тому +12

    didnt know skill based matchmaking had made its way to police interrogations.

  • @twentylush
    @twentylush 2 роки тому +44

    "You'd be surprised with what I can live with" ok dude. this was his first murder as a serial killer. he won't even get a netflix series and a weird fandom, he can't be saying stuff like that its big cringe.

    • @solala1312
      @solala1312 2 роки тому +5

      serial killers talking and their inflated ego neven fail to amaze me.

  • @REDlikeBERRIES
    @REDlikeBERRIES 2 роки тому +26

    throughout my whole life as a Canadian, the way i pronounce 'garage" (I say it like the detective in the video) is the only word I have been made fun buy others hahaha

  • @Lexythegreat_
    @Lexythegreat_ 2 роки тому +8

    Bro as SOON as he tells him that he has no doubt in his mind that he's involved, a normal human would be like "gimme a lawyer. I want a lawyer. Lawyer. Lawyer please" lololol especially since he JUST offered him one 🤣 😂 😅

  • @bradennotbrendan
    @bradennotbrendan Рік тому +2

    Shoutout Edmonton, AB 💪 getting the kind of recognition we deserve
    1:47 Those look exactly like the condos I rented in Silverberry, lol

  • @apfelstrudeldk5130
    @apfelstrudeldk5130 2 роки тому +9

    I love to give my view to one of the the OG hasanabi clip channels appreciate ya

  • @amosbackstrom5366
    @amosbackstrom5366 2 роки тому +8

    "I don't understand..
    I don't understand how I got caught, I had the cleaning supplies, don't you remember when I told you about the cleaning supplies

  • @kaedence____
    @kaedence____ 2 роки тому +6

    Ahhhh takes me back to last spring/summer when we watched this stuff haha missed true crime

  • @0MVR_0
    @0MVR_0 Рік тому +2

    Alltinger is a Norwegian last name
    meaning more or less 'congressional representative'
    or senator.

  • @tbxvividos
    @tbxvividos 2 роки тому +8

    55:05 how u gonna not say anything when they literally show us his license plate was "DRK JEDI"

  • @playerhateroftheyear1084
    @playerhateroftheyear1084 2 роки тому +8

    the tribute to the victim is a sweet end to a video that takes the attention away from the killer. going to subscribe to the channel

  • @readussalehin3736
    @readussalehin3736 11 місяців тому +1

    My man said, “Let’s go dontcha know”😅

  • @Tachtress
    @Tachtress 5 місяців тому +1

    The interrogator sounds a little bit like the fitness gram pacer test at some moments

  • @flbreglass
    @flbreglass 2 роки тому +4

    This is one of the greatest throws of all time

  • @abbycareyyy7755
    @abbycareyyy7755 2 роки тому +2

    My parents are from Nova Scotia and both say “gradge” instead of garage 😂🤢

  • @johndey922
    @johndey922 2 роки тому +3

    It's crazy to hear that this happened right next to where I used to live...

  • @Sneak222
    @Sneak222 Рік тому +1

    cant believe I was just click baited for so long

  • @Ldogthe1nonly
    @Ldogthe1nonly 2 роки тому +2

    I hate that I say garage the way I do - a person from Calgary Alberta

  • @no_ononono3074
    @no_ononono3074 2 роки тому

    This entire video... I couldn't help but keep hearing I MISS GA RAGE over and over and over again in my head.

  • @eclairia404
    @eclairia404 2 роки тому +6

    I legit put up my thumb and compared it to his face.
    I will never look at my thumbs the same way.

  • @meghanpoplacean2216
    @meghanpoplacean2216 2 роки тому +11

    As someone who grew up in Edmonton, who the fuck says garage that way?!?

    • @tasman655
      @tasman655 2 роки тому

      People from out East who live on the north side

    • @llamaczech
      @llamaczech 6 місяців тому

      Tbh, and I don't know why Hasan didn't think of it... That's exactly how I'd imagine Schlatt would say "garage."

  • @limelightcapital7958
    @limelightcapital7958 2 роки тому +6

    TRUE CRIME HAS VIDS ARE BACK LFG BOIS!!!!

  • @blondebonetglamsey
    @blondebonetglamsey 9 місяців тому

    my favorite part is him calling it a suspense thriller and then willingly describing setting up a scene of torture porn

  • @hi_im_mello
    @hi_im_mello Рік тому +1

    "Ope, did I say I bought the car for $40? Ope, sorry, I meant I killed him then stole his car and took $40 from his wallet."

  • @garlicinthebread
    @garlicinthebread 2 роки тому +3

    4:30 right in this little ᵍᵃʳᵃᵍᵉ

  • @ToldFate
    @ToldFate 2 роки тому +3

    “Why!” That nigga panicking

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 2 роки тому +8

    “The first thing detective Clark did was opposing the four other digits assigned to the case”

  • @noodlz_666
    @noodlz_666 2 роки тому +6

    I'm so happy he's cover The Dork Jedi, Mark Twitchell.

  • @galexical
    @galexical 2 роки тому +1

    brooo the ending...from the car to the reveal of the confession 💀💀💀

  • @abit359
    @abit359 2 роки тому +4

    4:10 I would like to thank Skonk190 for his wonderful Veggietales fact.

  • @Take_Your_Time_
    @Take_Your_Time_ 6 місяців тому

    I transitioned to prevent myself from becoming a thumb.

  • @LyfeIllustration
    @LyfeIllustration Рік тому +1

    My dad says garaRge. Just gotta put that out there cuz I’ve always wondered how the hell he decided that was correct lol

  • @jare3959
    @jare3959 Рік тому +1

    I knew I recognized that name. I fell out of my seat when he said Edmonton. That's where I live. But I kinda blocked this case out of my mind.

  • @thendolethole2381
    @thendolethole2381 2 роки тому +3

    That cop has strong Thumb Genes hahahaha.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 2 роки тому +6

    Maybe the most effective interrogation methods are so effective because there are more innocent and scared people near any given crime than the few actually guilty people?

  • @jerrontaylor4611
    @jerrontaylor4611 2 роки тому +2

    "looks like interrogations are back on the menu boys!!!"

  • @ashleyandchloe
    @ashleyandchloe 2 роки тому

    The garage technique 😹🙌

  • @megshep
    @megshep 2 роки тому +8

    Why is it always Canadians?? I swear we aren't all nutjobs! 😂

  • @AnnaVictrix
    @AnnaVictrix Рік тому +2

    I know about this loser but I’ve never seen the escaped victim’s interrogation footage and I couldn’t stop laughing at him making fun of this Dexter wannabe using movie logic in his attempted murder

  • @brendandrislane4560
    @brendandrislane4560 2 роки тому +9

    What strikes me about true crime murder is how many of the murderers seem either of low intelligence, or reasonably intelligent people who made a mistake or were undisciplined. It makes me wonder about the 40,000 unidentified bodies every year in the US. It makes me wonder about the killers that are not caught. Serial killers that perhaps do not repeat their method, and select victims seemingly at random, with no common repeatable demographic. So their murders do not appear related, and so the existence of such a serial killer is unclear, allowing them to kill with impunity.

    • @bingusenjoyer197
      @bingusenjoyer197 Рік тому +1

      that level of serial killer precision and expertise is usually near impossible to get away with for a long time. a serial killer like this could probably get away with 3-4 murders before being caught, but for a serial killer to pull off what you’re describing long term they would need to have an extensive knowledge of what detectives look for in murder cases, of how to find and target victims, of cybersecurity to hide their digital footprint, proficiency in all weapons, disposal of bodies, hiding all of their physical tracks, and blending into society and appearing normal all before committing their first murder.
      murderers will also always be behind on time compared to detectives since they only have so much time to get rid of evidence while the police have a crew with an infinite amount of time to investigate. not to mention the stress and adrenaline serial killers get killing someone which leads to a high likelihood of making mistakes in the murder and cleanup.
      serial killers often get off on killing and will usually taunt the police after getting away with it for a long time believing that they’re invincible and start getting sloppy with their crimes. theres also a very high chance that over a long period of murders they could be caught red handed by dumb luck alone. a serial killer like this is highly highly unrealistic, i’m basically describing agent 47 from the hitman games.

    • @mandymentzer6357
      @mandymentzer6357 Рік тому

      Look up Israel keys

    • @llamaczech
      @llamaczech 6 місяців тому

      If you look into the vast majority of serial killer cases, they are kind of dumb as rocks and get away with it for as long as they do because of police incompetence, and often times especially with the big names, straight up negligence in the face of victims coming forward.
      I see no reason to think those 40,000 unidentified bodies a year are part of a different pattern.

  • @tiniaful
    @tiniaful 2 роки тому +7

    i do want to say garage is a french word and his giving the french intonation on the a. 10/10 prenounciation

  • @StanleyKubricksBeard
    @StanleyKubricksBeard 2 роки тому +1

    Is that guy wearing a John-5 shirt? Merch from the guitarist of Rob Zombie/Marilyn Manson? 🤔

  • @coderedcleaninginc.9942
    @coderedcleaninginc.9942 2 роки тому +6

    Why does nobody ever fucking ask for a lawyer in these videos I literally don’t understand 😭

  • @Ananasboat
    @Ananasboat 2 роки тому +2

    My mother, from northern Maine says "gaRWARdge" with the second r and everything. I hate it

  • @Cheezeblade
    @Cheezeblade Рік тому +1

    cop wasnt tilted. he had spent days appealing to his better judgement maybe his humanity. Maybe getting him to at least in his own mind still needing to see himself as at least not the bad guy. WHen all else fails. the guys a killer, go after his ego. Tell him hes NOT as smart or visionary as he mighhhtt might wanna seem. Cant rule out a cold ruthlessness. but antagonizing him through telling him hes a shitty serial killer and got caught first time might hit a nerve. I dont know if the cop even beleived thats who he was dealing with. might have just wanted to fish for a reaction to have him defend his mind or skills.

  • @nyracin
    @nyracin Рік тому +1

    The garage thing is so stupid, the word originates from french so ofc canadians would pronounce it that way. English pronunciation is probably the most inconsistent in the world literally why is the “c” in city and cross pronounced completely different (and that’s just a random example) or the “knight” and “night” nonsense 💀

  • @najatalfahham1086
    @najatalfahham1086 2 роки тому

    You should have not mentioned garage (Peter griffin) and let the chat go offffff 😆

  • @zoosmell_egbert
    @zoosmell_egbert 2 роки тому +2

    3:00 as a child of a cop, this is why I don't want kids I don't wanna pass down these fuckin thumb genes bro

  • @Notamberalertt
    @Notamberalertt Рік тому

    Cop interrogating him sounded like a wanna be actor 😂

  • @azazeeel5043
    @azazeeel5043 2 роки тому +1

    9 month old episode but i am still gonna comment because this is infuriating.
    After 54:00 the guy says 'on either side' and the subtitles just completely lie about 'the sun' in his words.

  • @LarryCalcGOAT
    @LarryCalcGOAT Рік тому

    the cop started sounding like me after I forgot what I was saying and am just hoping they don't notice.

  • @khafaniking1230
    @khafaniking1230 2 роки тому +1

    I want Hasan to react to more Orchard content, his video on JonBennet Ramsay case is enthralling and unsettling.

  • @monyfornow
    @monyfornow 2 роки тому +2

    1:01:50 my man spelt neighbour wrong 😂

  • @hannahcatherine4
    @hannahcatherine4 2 роки тому +1

    i can't hear garage properly now

  • @1f6ixwas9ine
    @1f6ixwas9ine Рік тому

    I remember hearing mrballen cover this story to see the interrogation of it is interesting

  • @billbutton8468
    @billbutton8468 2 роки тому +2

    HOLY SHIT i thought cop was dog shit like hasan but then at the end it shows he read him like a book with those confession writings lmaoooooo

  • @ThatGuyGoob
    @ThatGuyGoob 2 роки тому +3

    At 56:00 the detective straight up turned into Trump…

  • @Maxisamo1
    @Maxisamo1 2 роки тому +5

    I wanna see Jordan Peterson be the interrogator in these

  • @jappyhoy
    @jappyhoy 2 роки тому

    detail geek says garage the same way

  • @alyssabro9092
    @alyssabro9092 2 роки тому +2

    I never clicked a video so fast

  • @danielc8329
    @danielc8329 2 роки тому

    I ACCIDENTALLY FRAMED MYSELF LOL

  • @jennydiver100
    @jennydiver100 Рік тому

    None of these assistants will turn out to be real.

  • @Jeremo-FD
    @Jeremo-FD Рік тому

    1:00:25
    "There was something about urgently exploring my dark side that greatly appalled me" - Hasan Freudian slip bc he's a normal human with empathy.

  • @sayeedkizuk5822
    @sayeedkizuk5822 Рік тому

    Damn I used to live pretty close to there

  • @kandykess
    @kandykess 2 роки тому +7

    JCS IS BACK JCS IS BACK JCS IS BACK JCS IS BACK

  • @Hotlooksamerica
    @Hotlooksamerica 2 роки тому +1

    4:18 Detective TATTLER gonna tell on YOU!!!

  • @Itzskimpy
    @Itzskimpy Рік тому

    He even knew about some tactics and was cautious of that, I have no idea how that awareness didn't tell him to shut up the minute he went in there or leave when he was told he was free to go. Obviously don't side with the murderer at all but it's amazing how these people don't understand that even if you were innocent you should never talk without a lawyer

  • @bigspice4538
    @bigspice4538 2 роки тому +4

    Yessssss back to the murder shit

  • @DignanDerkin
    @DignanDerkin 2 роки тому

    my grandma unironically says g'rage (no a after the g, very important) she was raised in BC her whole life as far as i know

  • @beansfebreeze
    @beansfebreeze 2 роки тому +8

    It's ridiculous how hard these cops are trying to sound badass.

  • @abbybozek2928
    @abbybozek2928 Рік тому

    I could be wrong but i think the interrogator is using the Reed (or Rhett idk) technique - he was obviously there and he and the cop know that. The cop is trying to get him to admit to a lower offense - i.e. accident on movie scene - because then he can pinpoint that he was lying the whole time and then can book him in prison. Then they can actually grill him into what happened.

  • @TheGlassAddiction
    @TheGlassAddiction 2 роки тому +4

    Canada crimes time heck yeah. This time my province??? Wow

  • @srikothur2845
    @srikothur2845 2 роки тому

    What was date of the the live airing?