Android without Google: the Murena - /e/ Project blew me away!

Поділитися
Вставка
  • Опубліковано 25 січ 2025

КОМЕНТАРІ • 1,9 тис.

  • @boatymcboatface9683
    @boatymcboatface9683 4 роки тому +2361

    I'm a very happy that the UA-cam algorithm recommend me a video on how to remove google services 😁

  • @alejandrorivas404
    @alejandrorivas404 4 роки тому +1200

    I remember when i installed a custom rom on my Motorola moto g first generation, i forgot to install google apps and battery lasted for 2 days, and that day i realized that google do more on the background

    • @paulofreireslaw
      @paulofreireslaw 4 роки тому +96

      UA-cam vanced > newpipe

    • @fred-youtube
      @fred-youtube 4 роки тому +24

      @@DRSDavidSoft Try Firefox or Chromium on your phone insted

    • @Kuri0
      @Kuri0 4 роки тому +14

      @@DRSDavidSoft use microg

    • @Fruitarian.
      @Fruitarian. 4 роки тому +8

      Just like huawei phones these days

    • @fred-youtube
      @fred-youtube 4 роки тому +12

      @@paulofreireslaw I use YT Vanced, btw (you cant reply to comments or see them on newpipe)

  • @feelshowdy
    @feelshowdy 4 роки тому +110

    An important distinction: /e/ didn't start from AOSP, aka the "scratch" of Android. They started from forking LineageOS, and benefited from the de-googling and optimizations already done by Lineage contributors. This is why they could focus on beautifying the UI, adding branding, making their app store, and removing extra Google stuff Lineage didn't remove in order to replace it with their own implementations. I still think /e/ adds a fair amount of value to its Lineage base, though. It's precisely because they already had a good base that they could build good stuff on top it. The beauty of open source!

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +12

      Thanks for the precision !

    • @TheNerd
      @TheNerd 2 роки тому +2

      At the end of the day it doesn't matter. If you do not provide access to one of the 2 big AppStores, you need a BIIIIIG Appstore with all important Apps yourself.
      If you don't have it, you fail. I mean if Blackberry and Microsoft both fail, because of this exact issue, the e project is going to fail for sure.

    • @____-gy5mq
      @____-gy5mq 2 роки тому

      E started with markiplier, stop lying

    • @jacquelineliu2641
      @jacquelineliu2641 2 роки тому +3

      @@TheNerd apkpure, apkcombo, apkmirror: Are we a joke to you?

    • @MsDuketown
      @MsDuketown Рік тому

      Which version of Android and what date was it released? lol, as mobile history is being written.
      Plenty of OS'es to choose from, but it depends on your device and SoC.
      Open Hardware is still a little lagging.

  • @abubkurian1625
    @abubkurian1625 4 роки тому +1786

    I would like to see more linux phones, need a third OS in mobile world...

    • @NymezWoW
      @NymezWoW 4 роки тому +156

      Android IS Linux

    • @abubkurian1625
      @abubkurian1625 4 роки тому +241

      NymezWoW android only uses the linux kernels, everything else is built specifically for it. I meant GNU/linux, open source and free software.

    • @NymezWoW
      @NymezWoW 4 роки тому +55

      Abu b.kurian Android is free and open source.

    • @abubkurian1625
      @abubkurian1625 4 роки тому +91

      NymezWoW its free and open source but not a free-software, i meant like GNU...

    • @patternwhisperer4048
      @patternwhisperer4048 4 роки тому +175

      @@abubkurian1625 Abu is right, just because it has a linux kernel it doesn't mean that android adhers to linux distros general philosophy. Google's android has added many closed source proprietary parts to the android ecosystem. So yes, android is open source but google is strangelholding its ecosystem

  • @NoorquackerInd
    @NoorquackerInd 4 роки тому +510

    Allow *Calculator* to make and manage phone calls?

    • @NijiDash
      @NijiDash 4 роки тому +102

      Ikr, today I literally found a remote control app that needed access to my phone’s IMEI number. Wasn’t born yesterday, deleted that shit right away lmao.

    • @IntrovertedTechie
      @IntrovertedTechie 4 роки тому +46

      @@NijiDash Mi remote even has privacy policy 🤣🤣🤣

    • @NijiDash
      @NijiDash 4 роки тому +41

      @@IntrovertedTechie Yup that's the app I meant, well what did we expect from China right? 🤣

    • @IntrovertedTechie
      @IntrovertedTechie 4 роки тому +7

      @@NijiDash yeah

    • @MasayaShida
      @MasayaShida 4 роки тому +14

      @@NijiDash I've never used a xiaomi before but if you do abit of reading online they seem to be more trustworthy than companies like huawei and whatever the parent company is of oppo vivo and oneplus

  • @undertaken5200
    @undertaken5200 4 роки тому +253

    January 2021 gonna make this video very popular. Nobody like google, Apple, amazon, Microsoft, etc...

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +27

      Let’s hope so :D

    • @dopechannoodles9791
      @dopechannoodles9791 4 роки тому +24

      That’s what brought me here. About to trash my iPhone. Done with apple google amazon microsoft and all the rest. And waiting on a dip to buy into Bitcoin. Huge learning curve tho.

    • @bill6872
      @bill6872 4 роки тому +15

      @@dopechannoodles9791 I’m in the same boat. I have an iPhone 11 Pro Max. Nice phone, but i can’t support Apple anymore. I need to find another phone similar, but with tons more privacy. Any idea what might be a good alternative?

    • @Savage1776_
      @Savage1776_ 4 роки тому +21

      86 millions people had their VOTES crapped on!! So yea !!!!

    • @Savage1776_
      @Savage1776_ 4 роки тому +11

      @@bill6872 maybe Oneplus...but they use Google.. the sad thing is we made these companies what they are and now they're abusing their power on us

  • @njseashorechas2698
    @njseashorechas2698 4 роки тому +147

    Very impressive speaking skills! We need these phones in the USA! HUGE demand for anything Google free now!

    • @shanemangold8257
      @shanemangold8257 4 роки тому +3

      We have them! Get one now

    • @estebanjones2112
      @estebanjones2112 4 роки тому +3

      Dont forget about Apple Charles

    • @njseashorechas2698
      @njseashorechas2698 4 роки тому +9

      @@estebanjones2112 Apple is now censoring and blocking apps now in the USA

    • @estebanjones2112
      @estebanjones2112 4 роки тому +3

      @@njseashorechas2698 I know. That is what I was trying to add to your comment. We need to start changinf from web searches to mails and phones.

    • @njseashorechas2698
      @njseashorechas2698 4 роки тому

      @@estebanjones2112 Glad I Subscribed to your channel. Keep us updated!

  • @waltz9230
    @waltz9230 2 роки тому +2

    This is the best lighting setup I’ve ever seen on UA-cam ever.

  • @Seltyk
    @Seltyk 4 роки тому +417

    /e/ foundation has a history of bad open source behavior. The OS is a fork of a _really_ old build of LineageOS (not that forking is an issue, it's just out-of-date), they shamelessly remove credits from Lineage code, and everything on /e/ can probably be achieved on LineageOS in under 10 minutes manually

    • @jothain
      @jothain 4 роки тому +73

      Oh boy, I was about to comment that why not just go LineageOS, but if this is a ripoff of that. Well forget it.

    • @AbteilungsleiterinBeiAntifaEV
      @AbteilungsleiterinBeiAntifaEV 4 роки тому +33

      I don't know this YTber, but it looks like he has no clue about android.

    • @User9681e
      @User9681e 4 роки тому +6

      I don't like linage os as well but a fan of graphene os

    • @rockasaurio1771
      @rockasaurio1771 4 роки тому +21

      Thanks for the useful information! I was about to post the question about if the "e account" was something forced or optional; the moment i listened about it on the video, i immediately thought of it as suspicious.

    • @rockasaurio1771
      @rockasaurio1771 4 роки тому +1

      @@AbteilungsleiterinBeiAntifaEV Yes such truth can easily be inferred from the content of his channel.

  • @LordWaterBottle
    @LordWaterBottle 4 роки тому +37

    The highest praise for a product that was given temporarily for review is "I'm considering buying it instead of sending it back"

  • @SaynYT
    @SaynYT 4 роки тому +275

    So nobody is going to talk about how fast the operating system is without any google services installed?

    • @asthenyukimori9853
      @asthenyukimori9853 4 роки тому +43

      And more battery saved.

    • @janithcooray5546
      @janithcooray5546 4 роки тому +5

      it's faster. obviously.BUT Are you forgetting About Push Messages? only offered by google. Samsung too(horrible).

    • @openlink9958
      @openlink9958 4 роки тому +13

      @@janithcooray5546 ... I have a samsung and I have no idea what push messages are, lmao

    • @janithcooray5546
      @janithcooray5546 4 роки тому +5

      @@openlink9958 android phones and iOS phones use push services to receive notifications from web. Like what’s app messaging etc. it plays a huge roll in battery life. But you won’t receive messages

    • @laphlaes
      @laphlaes 4 роки тому +9

      @@janithcooray5546 That's what MicroG is for :)

  • @idk-sy3iu
    @idk-sy3iu 4 роки тому +43

    You: this is is Android without Google spying on you
    Also you: install YT Studio

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +6

      Well, I've got to try it 😅

    • @MarkHobbes
      @MarkHobbes 4 роки тому +5

      At least, less data is sent since there is no Google Play Services and it relies on microG :)

    • @idk-sy3iu
      @idk-sy3iu 4 роки тому +5

      @@MarkHobbes so better battery 😂😂😂

    • @Steve211Ucdhihifvshi
      @Steve211Ucdhihifvshi 3 роки тому +2

      Just put a firewall on your phone, allow what you want blovk everything else. Ive used it for yearrrs more recently google force the phone to try and restart around midnight and dump the firewall. So i turn data off etc.

  • @LordHolley
    @LordHolley 4 роки тому +16

    Glad I've kept some of my older phones, they will be perfect to set this up with.

    • @nguyen3075
      @nguyen3075 4 роки тому

      i did save my old phones, now the time dumb google

    • @Johnny-dp5mu
      @Johnny-dp5mu 3 роки тому

      If 3g goes off line then what??

    • @sranang-kino
      @sranang-kino 2 роки тому +1

      @@Johnny-dp5mu then you just got yourself a pocket PC use your imagination .

  • @zski1
    @zski1 4 роки тому +2

    This is a great start to shut these monopolies down. But my only skepticism is...it still has Android which the roots are from Google.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +1

      Yeah, that’s why I just released a video about pure Linux on a phone :)

  • @nottjohn9418
    @nottjohn9418 4 роки тому +18

    I use LineageOS and MicroG. After a short learning curve I can't really say I'm missing a lot.

  • @csr2537
    @csr2537 3 роки тому +2

    Huawei: We have Android with no Google preinstalled on our phones

  • @BxPanda7
    @BxPanda7 4 роки тому +20

    I'd love to see some benchmarks between this phone and it's google counter-part, i always wondered just how much processing power and battery these google services take up and if disabling them would make a noticeable difference or not.

  • @claudiacardinelli1867
    @claudiacardinelli1867 3 роки тому +1

    I subscribed.
    Also thanks for giving credit to the musical artist/song.
    If I like the the music, I like to know who it is.
    I'm sure they want to be known as well.

  • @hermanwooster8944
    @hermanwooster8944 4 роки тому +5

    Great video. A full Linux OS phone will happen when primary development switches from x86 to ARM. Until then, /e/ is the best thing going for people who are tired of corporations selling your data. The only issue now is getting privacy-respecting hardware.

    • @KSPAtlas
      @KSPAtlas 3 роки тому

      Me waiting for Linux to focus on POWER and RISC-V

  • @rklauco
    @rklauco 3 роки тому +1

    Thanks. This is what I needed to kick the effort off the start line. Purchased (bit damaged) old S9 to test, if I like it, I'll grab the S9+ from /e/. Thanks a lot!

  • @tralhasdojean
    @tralhasdojean 4 роки тому +14

    Nice video!
    I never understood Google Services... It slows down all the system just to open apps you could use directly from the browser... It's stupid.

    • @claudiacardinelli1867
      @claudiacardinelli1867 3 роки тому +4

      Tracking, hacking, to build a more complete profile of you, including biometrics and location. Then share it with Chinese businesses, etc.

    • @sranang-kino
      @sranang-kino 2 роки тому +1

      that's what responsibility brings ..

  • @johngiuffrida
    @johngiuffrida 3 роки тому +2

    Wow...that seemed like a really good, objective review. Thanks Stranger!

  • @SuperDesignguy
    @SuperDesignguy 4 роки тому +7

    This is a great video. We'll done. Thanks for sharing. Apple and Google have their teeth in everyone, and our data should be our data. Part of me feels a project such as this, could be bought up by a major phone manufacturer highlighting the advantages of being decoupled from Google. We need a major phone manufacturer to do this in my opinion. LG, Sony, even Samsung could do this and I think it would really take off.

  • @strsocerplaya9
    @strsocerplaya9 3 роки тому +1

    I'm so excited I found this. I fully support their efforts!

  • @gamingcollection270
    @gamingcollection270 4 роки тому +2

    Really interesting to see that these projects are coming out. And I'm really planning on switching to them in the future. Or use my older devices and just put that OS on it instead of buying something new. Enough options that respect the user and their privacy to choose from if you ask me.

  • @justinmcginty6815
    @justinmcginty6815 4 роки тому +3

    I just stumbled over this blog. This is great news. I'm not tech savvy though, so I'd have to wait for the installer app.
    I'm over these tech giants. Open source is the way to go. Keep on working on the installer. You will get my business.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому

      Yeah as soon as they can make this painless, they'll grab more market share !

  • @ariedov
    @ariedov 4 роки тому +7

    Most of the apps still use Google/Firebase analytics. So by installing any of the third-party closed-source apps - Google is still there.

    • @pmscalisi
      @pmscalisi 4 роки тому

      How many sites can be accessed without an app?

    • @rodnocker6172
      @rodnocker6172 4 роки тому

      That’s true but the trick is they can’t connect it too your identity!

  • @ahmd-mi9964
    @ahmd-mi9964 4 роки тому +9

    We need to support such alternative freedom for the masses platforms.

  • @pirosoffaireyes
    @pirosoffaireyes 4 роки тому +12

    How is their privacy policy like? I might have to check that out. Better than google using your data for everything adrelated I guess.

  • @rob-toolsandtech2521
    @rob-toolsandtech2521 4 роки тому

    This is pretty cool. The ultimate would be if you can run android in a virtual machine. Turn on VM when you need to use a google app, or another low privacy app, then turn it back off when you’re done. Even if the controls for the host OS take up a bit of room on the screen somewhere, most of the modern phones have enough screen real estate for that anyway. Plus, if you ever upgrade the phone, running the VM on the new phone would be as easy as copying the file to the new phone.

  • @BlenderDumbass
    @BlenderDumbass 4 роки тому +17

    The permissions on Android always annoyed me.
    I wish there was an option to install the package and not give it all the permissions it want. Like activate and deactivate them as I need to use this or that.
    Like allow camera in the web browser. If don't allow the site will say something like. Sorry this feature is not working. Bla bla.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +8

      I agree 100%

    • @hanschannel599
      @hanschannel599 4 роки тому +1

      I think it will do if you use some of AOSP flavor like LineageOS

    • @eduard647
      @eduard647 4 роки тому +2

      Some sites today straight up won't work i you just deny notifications from them, it's really shady stuff

    • @FullOilBarrel
      @FullOilBarrel 4 роки тому +1

      @@eduard647 dont use those shit sites

    • @jothain
      @jothain 4 роки тому +1

      OnePlus phones are quite nice on this. It'll ask if you want to give permission x for app y. It also more specifically gives that third and to me most interesting option "deny if program is running in background".

  • @user-mp3eq6ir5b
    @user-mp3eq6ir5b 3 роки тому

    Now that I have read thru the review, I will watch it. Very well written, informative & anytime I see "open source" my antennas start vibrating. Like Mozilla with the T-Rex Hammer & Sickle "stand alone" installer.

  • @yummiermussel5331
    @yummiermussel5331 4 роки тому +19

    Here in January 2021, and how right they were for creating this! We are getting more Orwellian every day...

    • @thomasmeunier8669
      @thomasmeunier8669 3 роки тому

      The original idea is right, but the work is badly done & i'd recommand using CalyxOS or even LineageOS instead of this OS that is a big security hole filled with bugs

    • @TheLinuxEXP
      @TheLinuxEXP  3 роки тому

      It’s far from badly done. I’ve been using it for months and it’s stable, and polished.
      Other roms aren’t close in terms of what they remove from Google.

    • @thomasmeunier8669
      @thomasmeunier8669 3 роки тому

      @@TheLinuxEXP what they remove? default dns? + what , connectivity check? ...
      it's BS

    • @TheLinuxEXP
      @TheLinuxEXP  3 роки тому +1

      It’s not. They have a page listing everything they removed.

  • @lucmorvan1867
    @lucmorvan1867 4 роки тому +1

    It also looks like the /E/ OS weather app is showing Brest as mostly cloudy, which by nature is an improvement versus the Android/IOS phones always listing rainy or showers... 🤔 Jokes aside the OS looks very interesting and definitely matching an increasing demand. Great videos as always! Keep up with the great work.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +2

      Hahaha yeah, it never rains in Brest, it's just slightly grey and moist outside 😅
      Thanks for watching :)

  • @wanderer8200
    @wanderer8200 4 роки тому +58

    This video: Android without Google
    Huawei: First time?

    • @matthew8153
      @matthew8153 4 роки тому +9

      AceOculus
      He means without Google OR China.

    • @wanderer8200
      @wanderer8200 4 роки тому

      @@matthew8153 i meant in an literal way

    • @jdtsb8856
      @jdtsb8856 4 роки тому +3

      I have a Huawei, it runs Google. What Huawei product doesn't have Google?

    • @wanderer8200
      @wanderer8200 4 роки тому +1

      @@jdtsb8856 clearly you live in an alternate universe

    • @jdtsb8856
      @jdtsb8856 4 роки тому +4

      @@wanderer8200@ Like I said, I own a Huawei. I asked a legit question. If you don't know the answer, don't waste your time replying with nothing.

  • @leighjenkins5601
    @leighjenkins5601 4 роки тому +19

    I'm running Lineage OS and fdroid instead of google play.

    • @Joshlul
      @Joshlul 4 роки тому +1

      This is better. /e/ are not magicians, nanodroid would accomplish something similar if you ran it in lineage, /e/ apps are proven insecure and send personal data over plaintext. BEWARE

    • @Joshlul
      @Joshlul 4 роки тому +1

      Neither is /e/

    • @jothain
      @jothain 4 роки тому +1

      @@SpaceTimeBeing_ It's pretty highly degoogled imo. I noticed quite many misbehaves because of those missing features from g's services.Though I can't say/claim it's 100%

    • @gibberishdump1610
      @gibberishdump1610 4 роки тому

      @@jothain ewwlo.void.partidopirata.com.ar/

    • @kwanare
      @kwanare 4 роки тому

      @@Joshlul what is the best alternative to the e foundation in 2020?

  • @goldfinger0072
    @goldfinger0072 4 роки тому +1

    Great, i have transformed my S8 to this operating system, and it looks indeed a little bit basic, but everything works fine and am very happy with it!..thanks!

  • @krono996
    @krono996 4 роки тому +5

    9:43 Google Firebase Analytics, Google Admob
    It's almost impossible to find bigger apps without anything Google related IMO. Obviously, since they are for Android.

  • @patricelauverjon2480
    @patricelauverjon2480 4 роки тому +2

    Beyond Systems: we depend on our abilities to react timely according to the present moments.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 4 роки тому +6

    Phones are the current frontier on pushing against Google and Facebook; but I think the key is efficient containers and limiting the amount of data matched from different sources. I can't see neither the public choosing to move past Facebook's apps and Google's services, nor those companies willingly giving up permissions or access to personal data.
    So we need one android that can effectively allow usage of the apps, while denying the corporations usage of the users. No amount of polishment or ease of use can cut that corner - and those parts will most likely follow naturally.
    Another option is to have a cultural movement to de-contaminate our life from excessive use of technology all together. If an OS that can deliver that catches enough interest, it can most likely force the corporations other than the tech giants to reposition on issues like privacy and maximising screen time.
    But I don't think this solves either problem. If the /e account could provide anonymity while using the most popular services, it could be useful. If their cloud services included a VPN and an account/password manager, things could be different. And if the apk-store included a way to actually limit the permissions, it might be more interesting for the general public.

  • @fernandoc6578
    @fernandoc6578 4 роки тому +1

    One thing I like about using SailfishOS is that for example, if you
    don't have WhatsApp opened, no message is gonna coming through and the
    people could think you are offline. Sometimes I put the device in
    Airplane Mode and switch on Wifi/Data when I want to use internet but
    don't want to be disturb. Is this possible to do with LineageOS or other
    DeGoogled options?

  • @enyvokaz
    @enyvokaz 4 роки тому +4

    Cool video, never heard of this project before. Thanks for the review 👍👍

  • @lucasnoritomi-hartwig3928
    @lucasnoritomi-hartwig3928 3 роки тому +1

    1:55 where do those figures come from?

  • @kosinusify
    @kosinusify 3 роки тому +3

    Now that's interesting. I heard about another French approach to de-Googling Android while maintaining user-friendlyness. It's a company called iodé, who have taken a pretty similar approach to /e/. Maybe you could make a review about them as well and compare them? I would definitely be interested in seeing that, because I am currently not sure about what to use as my next mobile OS.

  • @Revenant483
    @Revenant483 Рік тому

    Thanks for the honest review Nick! I will look into this. I did see that their Murena One phone does not support Verizon but other than that I might try to find one of the approved phones on their list.

  • @pascalr.7083
    @pascalr.7083 4 роки тому +4

    Hey Nick thx for this video. I was looking for a New OS for my smartphone and this one seems to be perfect.

  • @BWGPEI
    @BWGPEI 2 роки тому

    As a fan of LineageOS and it's ability to update older phones to a reasonable version of Andriod, I think it's nice to see additional work being done. The "pico" version of "google" stuff on top of LineageOS is just sufficient to get to the Play Store and download what you actually need to have on YOUR phone. As happens I don't need much, grin.

  • @kuyawill25
    @kuyawill25 4 роки тому +241

    "Android without Google"
    You mean Huawei Phones today?

    • @invntiv
      @invntiv 4 роки тому +101

      Is that a joke? Trading Google for Huawei is like being happy having the choice of which tool your torturer will use on you

    • @kuyawill25
      @kuyawill25 4 роки тому +27

      @@invntiv Can't take some kind of a Satire, Aren't you?

    • @gracefulcubix4730
      @gracefulcubix4730 4 роки тому +3

      Ah yes oak OS. Heard it is faster than android

    • @muyin
      @muyin 4 роки тому +25

      @@invntiv the CIA still haven't provide any evidence that Huawei collects user data tho.

    • @fenn_fren
      @fenn_fren 4 роки тому +47

      @@muyin Every Chinese based company provides data to the Chinese govt.

  • @timocarliermusic
    @timocarliermusic 4 роки тому +1

    I've been using /e/ on a Moto 3 for over a year now and like it. One thing you didn't address is that the /e/ phones, whether refurbished or rom flashed by the user, have their bootloaders unlocked, a potential security risk. I would love to see /e/ and Pinephone work together, as that would offer a budget level alternative.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому

      Well the unlocked bootloader is an added bonus, a good thing!

    • @timocarliermusic
      @timocarliermusic 4 роки тому

      @@TheLinuxEXP Can you explain what you mean? Doesn't having an unlocked bootloader mean that if someone else gets your phone, they can just bypass your password and access your phone? Great review, by the way. It's nice to see /e/ gaining some traction!

    • @thelinuxgamingexperiment1440
      @thelinuxgamingexperiment1440 4 роки тому

      Well, yeah, but it also means you can install anything you'd like on your own phone :)

    • @HellcatM
      @HellcatM 4 роки тому

      @@thelinuxgamingexperiment1440 Which also means anyone that gets a hold of your phone can install anything like tracking software or keylogger. I'd like a way to lock it down after unlocking it and installing the OS.

  • @python3.x
    @python3.x 4 роки тому +11

    Great content. Question: How to move from Gmail?

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +7

      I have already done a video on that, in the same playlist ;)

    • @simonebertini1813
      @simonebertini1813 4 роки тому +9

      @Linux CodeX protonmail and tutanota should be the best alternatives

    • @michaelenelmar
      @michaelenelmar 4 роки тому +2

      Pay a serious email provider and use a different app. I really recommend fair email, It is a great piece of work.

    • @speedflam
      @speedflam 4 роки тому +1

      Mailo is a simple alternative :)

    • @damienw4958
      @damienw4958 4 роки тому +2

      If you have have a server, you can make your own relay on it.

  • @KLiNoTweet
    @KLiNoTweet 3 роки тому

    I seriously consider buying one. Thanks for the recommendation!

  • @SuchtFaktorHoch10
    @SuchtFaktorHoch10 4 роки тому +5

    I have only one question:
    Can I finally make an actual backup of the whole phone?

    • @AbteilungsleiterinBeiAntifaEV
      @AbteilungsleiterinBeiAntifaEV 4 роки тому +1

      That's something u can do with the TeamWin Recovery, aka TWRP. It doesn't matter which ROM u use, because it's the recovery. In fact, I'd advise against this ROM, just get TWRP and any other ROM. Same difference, only that this ROM is outdated and ugly imo

  • @tibor8472
    @tibor8472 4 роки тому

    I have installed on Samsung A5 2016. Works very well. It has at least more than 700-800 MB of free space in RAM after system load, compared to factory system, which is Nougat (/e/ is Pie) and has maximum 300 MB in same situation. It gets updates frequently and install is quite simple. According to me, /e/ is recommended, if you did not need for latest technologies and eye candies and you have a compatible model.

  • @dagg497
    @dagg497 4 роки тому +3

    Firefox or Opera with Adblocker.
    Use duckduckgo search engine.
    Sideload apps from apk mirror.
    Use Vanced instead of UA-cam.
    Use microG for login to Google maps and UA-cam services..
    And use Microsofts outlook app instead of the stupid Gmail.
    I wish Android was stripped off all telemetric Google contact and Bloat apps..aswell as a virtual machine for running apps in so they dont bypass app permissions which the surely do. I still get very specifoc instagram ads even though i turned off mic and camera access on all Facebook apps

  • @arfism
    @arfism 4 роки тому +1

    What is the URL of the webpages at 2m55s which lists compatible phones?
    I could not find it at the e foundation website.
    Found it at doc.e.foundation/devices/

  • @hardiksrivastava9174
    @hardiksrivastava9174 4 роки тому +3

    I personally tried /e/ on my old Redmi Note 7 Pro last year, but honestly I did not like the replicated look and feel of iOS but I can see as to why they are trying to do that. Also from what i can see in the video the /e/ version seems to be based on Android 8.0 which is basically 3 years old at this point. Instead of /e/ I would personally install a more recent version of any custom rom based on Android 10 with microG and use that. I personally as a custom ROM user do not have any issues with aosp using ntp server default or anything else, but then that's highly subjective.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому

      Android 8 it seems, yes, but honestly there's not much difference anymore

    • @hardiksrivastava9174
      @hardiksrivastava9174 4 роки тому

      @@TheLinuxEXP From a technical point of view it does make a difference, sooner or later old versions of android would stop getting official security patches and /e/ team would need to rebase their project on newer sources on android. I'm not trying to say /e/ is bad or anything but then it would have been better if there was a more recent version of android as a base :)

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому

      Oh they'll probably do it when it's necessary :)

    • @kazzTrismus
      @kazzTrismus 4 роки тому

      half of googles updates are just another "communication" opportunity..
      honestly some of yall bleeding edge guys will download the "just spying on you" update.
      android has barely improved since marshmallow... mostly just google stealing customisation ideas

    • @nickvolt2816
      @nickvolt2816 4 роки тому

      " I did not like the replicated look and feel of iOS but I can see as to why they are trying to do that."
      LOL. Funny thing - Xiaomi also replicate iOS in many places and this is ok? ;)

  • @basdfgwe
    @basdfgwe 4 роки тому

    Hosting your eservices will get me buying this phone.

  • @uniqhnd23
    @uniqhnd23 4 роки тому +79

    Graphene OS is also completely degoogled and probably the most secure version of android ever

    • @ivanguerra1260
      @ivanguerra1260 4 роки тому +16

      That´ right, but it´s only available for Pixel Phones that are Google´s Spyware.

    • @hermanwooster8944
      @hermanwooster8944 4 роки тому +9

      @@ivanguerra1260 It's safe to say most phones are spyware. It's going to take time before open hardware is developed.

    • @ricecake1228
      @ricecake1228 4 роки тому

      Yes, but installing it is a hassle.

    • @t3ch-1t89
      @t3ch-1t89 4 роки тому +7

      I'd go with lineage, since pixel pretty much has a blackbox proprietary security chip, and security via obscurity is a bitch.

    • @UrbanaticLemonade
      @UrbanaticLemonade 4 роки тому +4

      I love it. e foundation can go suck on Toes

  • @Rod_Knee
    @Rod_Knee 4 роки тому +1

    Excellent review. I'll be trying /e/ after watching this. May breath some new life (and improved security) into my old phone, currently running LineageOS).

  • @trippinf472
    @trippinf472 4 роки тому +3

    As always great video!

  • @gamethecupdog
    @gamethecupdog 3 роки тому

    This led me to two very interesting discoveries, being that someones working on 3DS support on /e/, and that led to a continuation of linux on 3DS. Very fun stuff, if I learn how to I might contribute.

  • @threepercent490
    @threepercent490 4 роки тому +7

    Gotta get one of these to save myself from the covid genocide contact tracing Psychopathy. Thanks for making this video. Much appreciated.

  • @Skeleman
    @Skeleman 2 роки тому

    to put some context to that 12mb per day number:
    a lat and long take 16 characters or 16 bytes
    storing a copy of your exact location each second for a day would take just 1.3 MB (substantially less if you only stored when it changed and a timestamp)
    so with the remaining 11.5 MB they are certainly storing everyone you messaged, every website you visited, every app you opened, and who knows what else.
    a text description of every image you looked at? what do you think they trained their AI for.
    a transcript of every call you made? every word you spoke near your phone? what do you think they trained their AI for.

  • @johnbamber7374
    @johnbamber7374 4 роки тому +4

    This is an awesome review. I bet the /e/ Foundation is blown away by this reception. Excellent choice on their part to not actually sponsor it.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +3

      Had I known I would have liked it so much, I would have asked for money 😅

    • @johnbamber7374
      @johnbamber7374 4 роки тому +1

      @@TheLinuxEXP, I do wish you had been compensated, as I hope you're able to keep making videos indefinitely; however, I think it adds even more weight to your overwhelmingly positive review that it wasn't sponsored.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +1

      For now, I have no plans to stop :) I can't make a living on what UA-cam pays me, but it could happen if the channel keeps growing :)

  • @brianwild4640
    @brianwild4640 4 роки тому +1

    Nice video very clear. I have all mine working but still can’t get the web gui shows the same face on a webpage same as the e ink display

  • @d0g_0f_Christ0s
    @d0g_0f_Christ0s 4 роки тому +4

    Degoogled sounds tight ✊😉

  • @stephenmason5682
    @stephenmason5682 4 роки тому +1

    How can we flash an existing old spare android mobile please?

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +1

      The e.foundation has all the steps on their website :)

    • @stephenmason5682
      @stephenmason5682 4 роки тому

      @@TheLinuxEXP thanks for that! I'll follow it up!

  • @modm8843
    @modm8843 4 роки тому +3

    I love the word “DEGOOGLED”

  • @planetarytapestry8092
    @planetarytapestry8092 4 роки тому

    I have a BLU phone and would love to get rid of Google. How you reclaim everything from Google Drive etc...I am happy to simply. This sounds great. Very exciting. Thank you for sharing this.

  • @raz0229
    @raz0229 4 роки тому +3

    Why doesn't Huawei just team up with /e/ Project and use eOS in their latest phones

    • @josephanand16
      @josephanand16 4 роки тому

      I think Huawei would still not be able to use this. Because the phone is Android based which is still owned by Google. Since the eproject is AOSP users can do what they like , but will not be allowed to make a business out of it. Hence eOs is "non profit"

    • @raz0229
      @raz0229 4 роки тому

      @@josephanand16 Yea, makes sense

  • @trevormckellen5613
    @trevormckellen5613 3 роки тому

    I like the OS and the fact that you still have access to the regular apps like Spotify

  • @shubhamshejaval8526
    @shubhamshejaval8526 4 роки тому +8

    Fortunately this video haven't seen by any UA-cam employee.

  • @shanujwilson1204
    @shanujwilson1204 4 роки тому +1

    I'm confused. MicroG is supposed to give an alternative Google service, right? So how does microG prevent Google's tracking? Does it remove it partially or sth like that? Pls do enlighten me on this...

  • @corataylor2205
    @corataylor2205 2 роки тому

    Appreciated the Yuka mention, such a slept on app.

  • @gosth81
    @gosth81 4 роки тому +3

    I'm seriously thinking to try this OS, I'm actually using a Redmi Note 8

  • @RealDystopianFrog
    @RealDystopianFrog 3 роки тому +1

    How do you get phone service and data on them, though?

    • @TheLinuxEXP
      @TheLinuxEXP  3 роки тому +1

      Insert any SIM card :)

    • @RealDystopianFrog
      @RealDystopianFrog 3 роки тому

      @@TheLinuxEXP it's been my experience that a company hasn't accepted a phone that I had. This happened after I bought it.

    • @TheLinuxEXP
      @TheLinuxEXP  3 роки тому +1

      In France, and most of Europe, your SIM card works on every non simlocked phone, but maybe it’s different elsewhere!

  • @owaisparkar
    @owaisparkar 4 роки тому +6

    Huawei wants to know your location

    • @TheZenytram
      @TheZenytram 4 роки тому +2

      Is deGoogle but not deChina.

    • @khatuntsovmikhail6223
      @khatuntsovmikhail6223 4 роки тому

      Huawei is more fair than Google! theybare saying we are selling cellphones. Google sell you service =)

    • @onebiglotus7347
      @onebiglotus7347 3 роки тому

      Totally not a huawei employee

  • @nescius2
    @nescius2 4 роки тому +1

    youtube app replacement - newpipe
    they are struggling with keeping on top with changes of youtube page, but it mostly works.
    i am using lineageos, its also based on aosp and google packages are optional and with option to install google apps replacement allowibg to have google like api.

    • @nescius2
      @nescius2 4 роки тому

      when you have rooted phone, afwall (available on google app store or via f-droid) is an application interface to iptables, allowing to selectively block applications from accessing internet/vpn/local network.

    • @ADeeSHUPA
      @ADeeSHUPA 4 роки тому

      @@nescius2 uP

  • @pointlessink6084
    @pointlessink6084 4 роки тому +4

    Sadly many apps needs google services to work, tho it's true we need another system.

    • @AbteilungsleiterinBeiAntifaEV
      @AbteilungsleiterinBeiAntifaEV 4 роки тому +2

      That's what MicroG is for. Look it up.

    • @pointlessink6084
      @pointlessink6084 4 роки тому

      @@AbteilungsleiterinBeiAntifaEV Hopefully that would be possible, tho a lot of companies in and out of the western market still depends on a "secured" google services.

    • @harshvithlani9399
      @harshvithlani9399 4 роки тому

      There is also harmony os coming

  • @Landofalcon007
    @Landofalcon007 4 роки тому +1

    Your outro music is really funky, I love it.

  • @ahmada.562
    @ahmada.562 4 роки тому +3

    I'm glad I got this recommendation 🙂 That said though, I find that this eOS is a major downgrade compared to the extremely feature-packed experience Samsung offers on their devices. Where's DeX mode? Where's Edge Panels? Where's the extremely versatile notes app? Where's GoodLock?
    I'd much rather just uninstall all the scroogle software that came on my Note 8 and stick with Samsung's extremely feature-packed, yet privacy-friendly offerings. Then control the traffic from my Note 8 with AdGuard Premium. Which is what I've done thus far.
    Make it OneUI based then we're talking.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +2

      That's features I had never used on my Samsung phone, they just clutter Android IMO with all that stuff that creates duplicate features :)

    • @ahmada.562
      @ahmada.562 4 роки тому +3

      @@TheLinuxEXP Duplicate features? Lol, sounding like one of them uninformed reviewers. Samsung's software offerings are miles more feature-rich compared to scroogle's. So much so, literally EVERYTHING "new" to pitifully-limited stock Android 11 has been on my Note 8 right out of the box with Android 7.
      Heck, stock Android's desktop mode is still merely been in beta all this while, whereas Samsung DeX is already replacing chunky windows Laptops/Desktops in police vehicles and offices. How do you consider that "duplicate features"?
      Those duplicate apps you get out of the box are merely there for the user's convenience in deciding whether they want scroogle's data-harvesting services or Samsung's feature-rich and privacy-friendly services. The user can simply uninstall/disable the ones they don't want, which is what I did to all the scroogle apps on my Note 8.

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому +1

      I'm not uninformed. I used Samsung phones for 6 years now.
      These features are, IMO, clutter. The Android experience in general is super messy.
      The settings are mostly illegible, Samsung adds their own apps in too of Google's and also i stalls some Microsoft apps by default.
      There are tons of hidden features in the settings that are just useless to me. Swipe for a screenshot? Wake up the phone when you lift it? That sidebar thing, which you can bring up by swiping the power button ?
      It's just totally unnecessary to my experience with a phone. If other people use them, then good for them, but I would much prefer a simpler skin, like the one /e/ offers.

    • @ahmada.562
      @ahmada.562 4 роки тому +2

      @@TheLinuxEXP You're certainly entitled to your opinion, but having experienced the Note 8 as my first ever Samsung Smartphone (after over half a decade of using just jailbroken iPhones then switching to Android on a OnePlus One in 2014), I simply can NEVER settle for anything less versatile than this.
      That palm swipe to capture has come in handy for capturing screenshots of various apps that respond to the press of my Note 8's buttons. I'd much rather have the choice when I need it than be stuck hunting around for some 3rd party solution when I need it.
      Raise to wake, although I personally didn't enable it, I can certainly see its use for the situation where your phone's power button got damaged. Instead of always having to use some pin to reach the button on the motherboard each time you want to wake up the device, you simply pick it up. Again, I'd much rather have the choice than be scrambling for some 3rd party solution when required.
      Finally, the Edge Panels, that's a MAJOR feature I use EVERYDAY on my Note 8. It provides a whole bunch of time saving functions, so much so, I can NEVER settle for a device without it. Below are just a handful of uses:
      - It provides quick access to my favorite apps and app pairs from ANY screen, including the lockscreen
      - It allows quick opening of apps like the calculator in floating window mode (I simply drag it from the Apps edge panel to the center of my screen) so I can calculate whatever is on my screen at the moment without wasting time switching between apps.
      - It enables quick tracking of my stocks on the stock market, via the Yahoo Finance Edge panel.
      - Enables quick tracking of breaking news headlines.
      - Enables quick access to my special bookmarks, including my Kodi stream pairing websites, getting to which needs to be fast before it times out in Kodi.
      - Enables quick access to a compass/leveler/ruler/flashlight/tally counter
      - Enables quick access to my favorite contacts
      - Enables quick access to weather information
      - Enables quick access to data usage information
      All of that, accessible from ANY screen (including lockscreen) with merely a swipe (configurable on a per panel basis). Plus, it is further extendable with 3rd party apps from the app store. I certainly ain't settling for any device without it. Stock Android would likely implement it in another decade like all their other "new" features...

  • @gabriel360
    @gabriel360 4 роки тому +1

    thanks a lot for sharing! very happy to discover this

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому

      No problem :) Glad to be of service !

  • @greyman1104
    @greyman1104 4 роки тому +5

    I don't trust them a single bit tbh.

    • @erwindee7384
      @erwindee7384 4 роки тому +1

      Why not? I'm getting a weird vibe too but can't put my finger on it.

    • @Kevin-yh8ol
      @Kevin-yh8ol 4 роки тому +1

      @@erwindee7384 is it because the letter e is just a flipped letter G from Google?

    • @erwindee7384
      @erwindee7384 4 роки тому

      @@Kevin-yh8ol No. I think I was feeling like they were ignoring the elephant in the room that is LineageOS. Can't remember now.

  • @modiflasher9988
    @modiflasher9988 4 роки тому +1

    This is like Custom rom but without Opengapps installed ?

  • @MaiONerds
    @MaiONerds 4 роки тому +5

    The real question is how will they feed their employees?

    • @darylrobbins2325
      @darylrobbins2325 4 роки тому +7

      You can buy refurbished phone with /e/ installed on it. You can also buy storage upgrade. Also donations.

  • @RuffRides
    @RuffRides 4 роки тому

    cant get a fairphone without android on their shop, only one option on UK shop no /e/

  • @nullcorebyte
    @nullcorebyte 4 роки тому +6

    Lol newpipe (open source) or YT vanced (apk mod) with MicroG (open source reimplemention of the brat) can be good enough

    • @michaelenelmar
      @michaelenelmar 4 роки тому +3

      I'm using both for quite a long time now. Both are ad free and allow background playback. New Pipe downloads audio and video. It's sometimes a bit buggy, but definitely worth the patience. It also includes ad free soundcloud which is also very cool. You even can search on the sound cloud app and then play it with New Pipe. Get F-Droid to keep it updated. UA-cam Vanced is on XDA Developers, watch out there are some fakes.

    • @MarkHobbes
      @MarkHobbes 4 роки тому

      UA-cam Vanced has features that are only available for UA-cam Premium, pretty nice and no need to pay, also it removes entirely the ads (that's why a lot of UA-camrs avoid talking and recommending using it) = Less revenue for them.

  • @PaulTaka123
    @PaulTaka123 4 роки тому

    In any case as much as you want to run away from google and ios, and them harvesting data. The e account you sign to they will also harvest data. As long as you are going to sign in somewhere your data will be collected, and used somehow.
    There is no running away from data harvesting, its just that who do u want to give your data to

    • @TheLinuxEXP
      @TheLinuxEXP  4 роки тому

      Except you'll be able to host these services yourself in the future if you want :)

  • @thomaswalton9089
    @thomaswalton9089 4 роки тому +3

    What a cheap company making you send it back after reviewing it for free smh

  • @TONYSESLCAFE
    @TONYSESLCAFE 4 роки тому

    This guy is straight up. Quality channel.

  • @Thedownliner2015
    @Thedownliner2015 4 роки тому +1

    I like LineageOS 17.1. Been using 16 for about 6 months now without issues. The only problem was when the OS switched from 16 to 17 it required flashing the new OS rather than doing an auto update. In fact @ 07:59 you show in About Phone its using LineageOS llama.

  • @-indeed8285
    @-indeed8285 4 роки тому

    @The Linux Experiment can you make video about, how can we compile de-google for our device which is not listed in de-google website.

  • @goldensilence5841
    @goldensilence5841 4 роки тому +1

    how much does it cost i tries the website and the homepage loaded but the page to buy a phone didnt load and the page to install the os only loaded minimal stuff for some reason

  • @ragilmalik
    @ragilmalik 4 роки тому +2

    android is a registered trademark. It actually falls under AOSP, not android. If you're not google, you can't name any os Android

  • @VMGChannel
    @VMGChannel 4 роки тому

    Is the second telephoto lens working on aosp?

  • @fuseteam
    @fuseteam 4 роки тому +2

    makes me wonder how feasible a collaboration between /e/ and ubports foundations is

    • @redrock9319
      @redrock9319 4 роки тому

      They both make different OS why a collaboration?

    • @fuseteam
      @fuseteam 4 роки тому

      @@redrock9319 like the cloud services and perhaps drivers and what not both are linux oses after all

  • @ElectromagneDikk
    @ElectromagneDikk 4 роки тому +1

    I am so damn excited by this, oh man. It's literally going to be that kid on Christmas moment when I get one of these.

  • @Grishanof
    @Grishanof 4 роки тому +1

    How is this any different from AOSP or Lineage builds without gapps?

  • @ElectricUAM
    @ElectricUAM 4 роки тому +1

    I've been watching Eelo and /e/ since day one and know it will be my next phone. Since I've never flashed a phone before, I'm waiting on their installer to flash my old S7 but will soon get something from them directly. I hope it works well in the US, that's the only thing I have to make sure.