Friday the 13th makes NO SENSE

Поділитися
Вставка
  • Опубліковано 5 січ 2025

КОМЕНТАРІ • 644

  • @hannabelphaege3774
    @hannabelphaege3774 5 років тому +483

    Jason VS Muppets: Manhattan is a solid gold pitch.

    • @KevlarNinja
      @KevlarNinja 5 років тому +20

      Yeah, just have Jason be the only character not played by a Muppet. It'd be great. XD

    • @aarondelmer8581
      @aarondelmer8581 5 років тому +33

      @@KevlarNinja Or have Jason be the only muppet and all the Muppets are horrific cats style cgi monstrosities
      now that's a spook

    • @Aconitum_napellus
      @Aconitum_napellus 5 років тому +10

      @@aarondelmer8581 Genuinely disturbing.

    • @justincoleman3805
      @justincoleman3805 4 роки тому +2

      I want at least a trailer cut from the two movies.

    • @koomori
      @koomori 4 роки тому +4

      It needs a scene with Muppet Jason, and I don't care if it's just a throw away dream sequence.

  • @Kutulhu
    @Kutulhu 5 років тому +409

    Jason is left home when his parents go on vacation to Europe. He ends up wrecking his dad's Jaguar and the only job he can get to make money for the repairs is... a camp councilor.

    • @morganalabeille5004
      @morganalabeille5004 4 роки тому +8

      Holy shit

    • @LucianCorrvinus
      @LucianCorrvinus 3 роки тому

      Never work, id never believe Jason could bag Rabecca Mornay....

    • @spacecadet9663
      @spacecadet9663 3 роки тому +3

      God why does that sound like a south park joke? Like in my head I immediately heard "starring Rob Schneider" when I finished reading your comment.

    • @Jane-oz7pp
      @Jane-oz7pp 3 роки тому

      @@spacecadet9663 "First he was The Animal, then he was The Hot Chick, now Rob Schneider is... The Stapler!" plays in my head at least once a day.

    • @Heathen-vy9em
      @Heathen-vy9em 3 роки тому

      @@Jane-oz7pp "Rated Pee Gee Thirteen!"

  • @walbado
    @walbado 5 років тому +243

    See, that's why Jason is the perfect character. You can dump him in any situation and it would still make something entertaining. Exemple: Friday the 13th: Jason Goes to Ikea

    • @Napoleon.Blown.Aparte
      @Napoleon.Blown.Aparte 3 роки тому +10

      🤣 whahahaah YES please!!
      tagline would be: "Jason goes shopping!"

    • @kevincrady2831
      @kevincrady2831 3 роки тому +17

      As Jason lurches toward the teenagers with bloody knife in hand, they struggle to assemble a bookcase to block his path. "No, Tommy! Screw _2-A_ goes into hole C-1!"
      In the end, it turns out the Final Girl is really handy with a hex-wrench.

    • @bepisthescienceman4202
      @bepisthescienceman4202 3 роки тому +10

      Friday the 29th: Jason goes to therapy

    • @Misora7303
      @Misora7303 3 роки тому +5

      Jason Faboulous BEACH vacation

    • @Eamonshort1
      @Eamonshort1 3 роки тому +6

      Oh my god, let's just remake all of the "Ernest goes too..." Films with Jason Voorhees

  • @z-beeblebrox
    @z-beeblebrox 5 років тому +257

    Not gonna lie, Jason murdering Santa and then inadvertently becoming Santa a la "The Santa Clause" would be a movie a legitimately want to see

    • @jesusramirezromo2037
      @jesusramirezromo2037 4 роки тому +6

      There is a fan-movie about that
      Santa murders santa, and becomes the new one

    • @fisheyenomiko
      @fisheyenomiko 3 роки тому +12

      This Christmas, get ready for Ho Ho Homicide!

    • @kevincrady2831
      @kevincrady2831 3 роки тому +3

      Weird Al already sang the theme song.

    • @TheWarrrenator
      @TheWarrrenator 3 роки тому

      Murders naughty teens.

  • @kweightthree
    @kweightthree 5 років тому +479

    Prequel to Friday the 13th is Thursday the 12th. Just saying.

    • @mattm.775
      @mattm.775 5 років тому +39

      They actually made a movie called Saturday the 14th. Wouldn't that technically be a sequel?

    • @sevatarlives185
      @sevatarlives185 5 років тому +34

      Friday the 6th pitch: Anthology film. Several otherwise unconnected people briefly mention that the following Friday will be the thirteenth of the month in different contexts. One says it's unlucky, one says something about astrology, one invites some friends over for a mini-Halloween spooky movie party. Everyone goes and has a nice time. Fin.

    • @aswiftshift5229
      @aswiftshift5229 4 роки тому +5

      Its a character study of a young jason the day before he drowns and it explores the effects of childhood bullying and overbearing parents that are so obsessive it borders abuse

    • @unusualvideos8269
      @unusualvideos8269 3 роки тому

      The trailer for it could be Wednesday the 11th

  • @FreeCatCheese
    @FreeCatCheese 5 років тому +151

    I've always entertained the notion that Jason is a Tulpa created by his mother's rage as she dies at the end of Part 1, which is why he's full grown by Part 2. Of course absolutely no one gave that a moment's thought, but it's a fun notion.

    • @CeeJayThe13th
      @CeeJayThe13th 3 роки тому +9

      I like that idea.
      I stumbled on another theory that he's given his abilities by some mystical power of the lake and is doing its bidding.

    • @CeeJayThe13th
      @CeeJayThe13th 3 роки тому +5

      @Creature Crosby a lot of that makes sense but the Tulpa idea that William brought up would explain it just as well as "ghost" and makes up for the discrepancy of a young Jason at the end of 1 and a grown Jason at the beginning of 2. The Tulpa just wasn't finished "forming" (or whatever) yet when it jumped out of the water.
      I think young Jason is a hallucination brought on by the stress of the events of the first film and adult Jason is where he somehow survived and was being hidden away by his mother because she's coocoo bananas. He doesn't become overtly supernatural really until part 6 anyway.

    • @scatman786
      @scatman786 3 роки тому +8

      I’m personally more a fan of the urban legend/campfire story theory. Jason and the events of the movies are just stories being told and the inconsistencies/quirks are just reinterpretations by different storytellers.

    • @TheWarrrenator
      @TheWarrrenator 3 роки тому

      Plausible. Or an agragore.

  • @luddlowvertakaclydecowley5905
    @luddlowvertakaclydecowley5905 5 років тому +410

    Don't worry everyone, the free market will always ensure that only the highest quality films will be produced.

  • @GorgonautAnimation
    @GorgonautAnimation 5 років тому +269

    I've always liked the explanation given around the campfire (and again at the bar) in Part II that his mom thought he died, and that the stinger was a dream (they say as much in the hospital in Part I), but he actually washed up elsewhere and spent the next 2 decades as a feral child living in the woods surrounding Crystal Lake. I kinda love the idea of him learning to stalk animals to survive, learning how to navigate the woods in seemingly impossible ways, and then, after finally seeing his mom again after all those years (shadowing her from the woods, seemingly), and she starts killing people when they reopen the camp, and so, in his primal grief, he follows her lead and turns to killing people to keep them out of his 'territory/hunting grounds.'

    • @Brawnald
      @Brawnald 5 років тому +29

      THAT sounds like a solid movie.

    • @z-beeblebrox
      @z-beeblebrox 5 років тому +15

      That's kinda sorta how they played it in the remake, right?

    • @GorgonautAnimation
      @GorgonautAnimation 5 років тому +32

      @@z-beeblebrox Yeah, pretty much - it's kind of the only way to reconcile the two iconic story elements of the series ('mom's revenge for drowned kid' and 'hulking adult monster-man').

    • @pedrosaraiva
      @pedrosaraiva 4 роки тому +1

      Ron Anderson x Fdd e ctgf rycorg

    • @d.m.collins1501
      @d.m.collins1501 4 роки тому +18

      Can I hire you to write my resume? I need someone to explain why I was a QA Engineer for 12 years, then unemployed for the entire COVID-19 thing even though I could easily have worked from home, but now I'm the perfect candidate to be editor of a flashy pop culture magazine.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 5 років тому +213

    Don't you get it? Jason is merely an allegory for justifications media makes to fight imperialist wars.

    • @geoffreysorkin5774
      @geoffreysorkin5774 3 роки тому +10

      This is Scaredy Cats. That’s the explanation for the Thought Slime video on this series.

  • @jeremyewing7180
    @jeremyewing7180 5 років тому +288

    I have 0 interest in every seeing any Friday the 13th movies ever again and yet I would legitimately buy a opening day movie ticket for any of your Jason sequel pitches.

    • @makaveli4205
      @makaveli4205 4 роки тому +4

      Joe Bob Briggs disagrees

    • @CeeJayThe13th
      @CeeJayThe13th 3 роки тому +2

      Good news! Several of those ideas already exist.
      The found footage and the snow ones were fan films entitled Never Hike Alone and Never Hike In The Snow respectively.
      The one where Jason tries to train his son to be a murderer is a comedy skit and is available free on UA-cam like the fan films mentioned above.
      The prequel where his dad is a murderer is the plot of a series of comic books.
      Probably a few more I missed.
      Also, check out Behind The Mask: The Rise Of Leslie Vernon and I Think I'm The Killer for some Jason Voorhees like horror comedy.

    • @FrancisR420
      @FrancisR420 Рік тому +1

      @@CeeJayThe13th Mildred didn't pitch found footage or snow theme
      They pitched Jason needing to get laid before the end of summer or becoming Santa Claus

    • @CeeJayThe13th
      @CeeJayThe13th Рік тому

      @@FrancisR420 bro idek what this was about. But I'm excited about Never Hike Alone and Never Hike In The Snow still lol

  • @pushon10
    @pushon10 5 років тому +199

    If you really squint, ScaredyMatt looks a bit like Thought Slime hahaha original joke, go me woo!

    • @Marsyas01
      @Marsyas01 5 років тому +18

      What? No he doesn't! ThoughtSlime looks totally different! I can tell because I have seen many pixels in my time.

    • @joshhorley2116
      @joshhorley2116 5 років тому +15

      @@Marsyas01 you're right, Scardy matt doesn't look anything like thought slime. He does, however, closely resemble.our UA-cam friend MindMuck

    • @Marsyas01
      @Marsyas01 5 років тому +7

      @@joshhorley2116
      I suppose. A little. Mostly around the eyes.

    • @travismcgrath6917
      @travismcgrath6917 4 роки тому +7

      If you squint he's almost in focus

    • @bassman9261995
      @bassman9261995 4 роки тому +5

      Thought Slime has more eyeballs

  • @michaelcoutts9470
    @michaelcoutts9470 5 років тому +68

    I'd like to see you breakdown the hellraiser franchise like this

  • @RadicalReviewer
    @RadicalReviewer 5 років тому +60

    I noticed you didn't bring up his height changes but i find those funny. He goes from being an old lady to being like a 7ft. beast.

  • @sebbychou
    @sebbychou 5 років тому +132

    A Friday the 13th musical using Friday as the main song.

    • @occams_blazer
      @occams_blazer 5 років тому +14

      oh you sadist

    • @QuikVidGuy
      @QuikVidGuy 5 років тому +7

      @@mezzb at one point in the middle of the action, the victims sing "hunted down on Friday," and the Final Girl moment is "Standing up on Friday"

    • @justincoleman3805
      @justincoleman3805 4 роки тому +6

      Starring actual cannibal Shia LeBeouf.

    • @anthonyweber1759
      @anthonyweber1759 4 роки тому +5

      Camp Crystal Lake reopens as a music camp. With Rebecca Black as one of the camp counselors.

    • @LucianCorrvinus
      @LucianCorrvinus 3 роки тому +1

      If I wanted to watch a massacre with bad effects...I'd Netflix Cats....

  • @saltyjustice4444
    @saltyjustice4444 5 років тому +64

    Ah my favourite channel, Blurry Cats, hosted by Blurry Matt!

    • @Backlashed
      @Backlashed 3 роки тому +4

      he's not blurry, he just has a cold.

  • @jubisisters
    @jubisisters 4 роки тому +18

    January 7th: "I have some kind of stomach cold or chest flu"
    .............

  • @thefollowingisatest4579
    @thefollowingisatest4579 5 років тому +15

    Literally every movie you pitch at the end is solid gold and I would buy the VHS.

  • @railguncat7751
    @railguncat7751 5 років тому +14

    You left out the part where Jason is secretly related to the Evil Dead Franchise.
    This was a very good video, thank you.

  • @cBe9999
    @cBe9999 3 роки тому +2

    Other ideas:
    Jason vs Jason Segel
    Jason is going back to Manhattan - he has a car ride with Meg Ryan and they hate each other (for now). They meet again 5 years later and sparks begin to fly...
    Now a media mogul, old Jason dies alone in his huge mansion. A lone servant overhears his final words 'Crystal Lake'. The race is on to find out the truth behind the man the world knows as "Charles Foster Voorhees" - the entire FT13 series is his backstory, leading to his rise to power.

  • @shytendeakatamanoir9740
    @shytendeakatamanoir9740 5 років тому +38

    Well, tomberries are just little dude with knives, and they are really scary.
    So, my point is that they should have Jason as an optional boss battle in the FF7 Remake.

    • @Dragonatrix
      @Dragonatrix 5 років тому +7

      ...Jason is already a party member in FF7

    • @Devilot109
      @Devilot109 5 років тому +1

      @@Dragonatrix Oh my god that's actually basically true.

  • @cousinted
    @cousinted 4 роки тому +9

    Tommy's plan in the fourth movie is obvious and makes perfect sense: He disguised himself as young Jason to trick Jason into thinking either he had time-traveled back to when he was still a boy or that his younger self had time-traveled to the future. Either way, it worked because Jason knew that if he killed his past self it would cause a time paradox that would cause him to fade away like Marty McFly in Back to the Future (Which everyone knows is Jason's favorite movie). See, simple and totally intuitive!

  • @spacecadet9663
    @spacecadet9663 3 роки тому +6

    At 3:05 you mentioned a scene from Friday the 13th part 3 where a prop comic tried to scare someone while wearing a hockey mask, and I wanted to add some context for why the people who wrote the script probably put that scene in there. If I remember correctly back during the eighties in New York City there was a string of vigilante murders in the subway system by a guy who was wearing a hockey mask. They eventually caught the guy but that's kinda why certain characters from eighties pop culture would wear one to be intimidating. It's honestly the same reason why Casey Jones wears one in the old live action Teenage mutant ninja turtles movies from around the same time, they even joke in the first TMNT movie that Raphael might be the Subway Vigilante at one point.

  • @timcirulis5273
    @timcirulis5273 5 років тому +11

    The way to look at the "Friday the 13th" film series is like this. One is a standalone film, then you have three overlapping trilogies.
    1. Live stalker Jason trilogy 2-4
    2. Tommy Jarvis trilogy 4-6
    3. Undead/unstoppable Jason trilogy 6-8
    I would argue nothing after 8 is Friday the 13th canon.

    • @scatman786
      @scatman786 3 роки тому

      9 & Jason vs Freddy are a shared continuity and Jason X is probably semi canon taking place after 9 and JVF since the military killed Jason at the start of 9 and later capture him X.

    • @timcirulis5273
      @timcirulis5273 3 роки тому

      @@scatman786 Don't get me wrong, they are Jason films but they are not Friday the 13th films. After JTM (8) there is no longer an attempt to connect the films. Even 5 left the fate of Jason some what ambiguous, the mayor says he was cremated but the sheriff cast doubt on this making the events of Jason's zombification in 6 plausible, in this universe. JGTH (9) just brings Jason back to Crystal Lake with no explanation visa vie not connection outside of Jason himself to the other films. After 8 they are Jason films but they are no longer Friday the 13th films thus not cannon to Friday. That got longer then I meant it too lol.

    • @scatman786
      @scatman786 3 роки тому

      @@timcirulis5273 I wasn’t saying that they’re canon to the main series but that 9,JVF & arguably X were in a shared continuity.

    • @brandonspain12345
      @brandonspain12345 2 роки тому +2

      Even Adam Marcus said when making JGTH, that they wanted to ignore bits of Part 3 - Part 8 since the last movie underperform at the box office. Confirming the New Line films are in their own timeline.

  • @xdissonance8
    @xdissonance8 5 років тому +41

    I really want to see Santa jason

    • @13gallowslane10
      @13gallowslane10 5 років тому

      Visit our Instagram then lol @13GallowsLane

  • @PhilipReadArt
    @PhilipReadArt 5 років тому +29

    This is legit the best channel covering this kind of content, by a mile!

  • @golgarisoul
    @golgarisoul 5 років тому +10

    7:12 im setting this bookmark so that whenever i get the notification that someone gave this post a thumbs up, i can laugh my ass off to that explanation for the Friday the 13 the tv series. Thanks, slime, for giving me a rare ray of joy in these dark times.

  • @joearnold6881
    @joearnold6881 5 років тому +21

    Jason Voorhees’ Day Off

  • @maxmfpayne
    @maxmfpayne Рік тому

    I'm sick today too. I find whenever I'm sick or feeling shitty, like today, i always come back to watch a bunch of these videos. It's like comfort food to me, hearing you talk about cheesy horror movies i personally probably wouldn't enjoy as much as you do is just nice. Your passion for the genre and especially wet puppets is so genuine, and generally it's just a good vibe. This is the chicken noodle soup of UA-cam content to me.

  • @Tartra511
    @Tartra511 3 роки тому +2

    I totally didn't realize how many Friday the 13th/Jason movies there were. I was halfway thinking that maybe Jason in Space was some type of fever dream I had because it makes no sense.

  • @CormacMor
    @CormacMor 11 місяців тому +3

    Bride of Jason?
    No, my friend.
    Briday the 13th.

  • @chrisbcpack
    @chrisbcpack 5 років тому +12

    the first movie i ever saw of the jason franchise was jason x & i remember being so confused but lowkey loving it for how off the chain and nonsensical it was

  • @kevincrady2831
    @kevincrady2831 5 років тому +25

    So maybe they're all...uh...taking place in parallel universes, so they're not happening in sequence, but side-by-side? I dunno, the only place the movies make sense is in the studio's bank account. :)

    • @scatman786
      @scatman786 3 роки тому +1

      There’s a theory that each of the movies are actually just campfire stories/urban legends being told by different eras and groups of people.

    • @morganalabeille5004
      @morganalabeille5004 3 роки тому

      These movies take place in the same continuity as the James Bond films

    • @morganalabeille5004
      @morganalabeille5004 3 роки тому +1

      “Wow this reminds me of the time I went to space back when I was the same guy”
      - James Bond and also Jason Voorhees

    • @kevincrady2831
      @kevincrady2831 3 роки тому

      @@morganalabeille5004 James Bond! Jason Vorhees! FIGHT!

  • @BlindArcher
    @BlindArcher 5 років тому +48

    They make no sense, most of them are objectively terrible as films, and most of the people making them had obvious contempt for them during production, BUT.... I still love almost all of them.

    • @UnwrittenSpade
      @UnwrittenSpade 3 роки тому +1

      Hell yeah I love them too! Freddy v Jason and Jason x are a blast

    • @brandonspain12345
      @brandonspain12345 2 роки тому +1

      Except Jason Goes to Hell.

  • @rhyderrek6155
    @rhyderrek6155 5 років тому +31

    I would unironically watch Friday the 13th: the Musical.

    • @eterlinblue99
      @eterlinblue99 5 років тому

      Combine both of the first two ideas: A Camp Crystal Lake Jason in Camelot, The Musical
      (Connecticut Yankee in King Arthur's Court meets the Camelot musical, all mushed together- because at this point why the hell not?!)

    • @Matthew_Raymond
      @Matthew_Raymond 5 років тому +6

      🎵Put that machete back where it came from or so help me...🎵

    • @TheMogul23
      @TheMogul23 3 роки тому +2

      As long as the main theme is Alice Cooper's The Man Behind The Mask then I'm 100% there.

  • @niteowl9491
    @niteowl9491 4 роки тому +9

    Bride of Jason: The Musical, on Ice!

  • @davidbollen2182
    @davidbollen2182 5 років тому +2

    I love your opening sentence! The rhyme always makes me chuckle. Hope you get well soon! :)

  • @user-vn7ce5ig1z
    @user-vn7ce5ig1z 4 роки тому +7

    6:28 - You skipped over _why/how_ Jason comes back. Tina misses her abusive father, so she uses her telekinetic powers to try to bring him back from the lake (and ostensibly also resurrect him), but brings Jason out instead.
    7:30 - _F13 The Series_ was still entertaining. (The _Nightmare on Elm St_ show was an anthology show hosted by Freddy.)
    7:48 - I still don't understand how the boat got from a _lake_ to NYC. 😕
    8:00 - The tall chef in the diner that Jason throws was played by Ken Kirzinger who later played Jason in _Freddy vs. Jason._
    11:16 - You need _Nightmare 6_ and _F13 9_ for the supernatural worms that made them both unstoppable killing machines.
    12:53 - I once read an early draft for _F vs. J_ that was actually pretty good. I waited several years until it finally came out, and was massively disappointed. The old treatment I read connected them in the past, included back-story of Jason's parents and something about Freddy doing something to Jason when he was a kid. The epic fight at the mall was interesting though and I really wanted to see them implement that. :-|
    • The _Friday the 13th_ movies are kind of absurd and inconsistent, sure, but they do follow a fairly linear timeline. It's like the _Evil Dead_ movies, in that they keep changing things, but still follow a straight line for the most part.

  • @chrissmith6097
    @chrissmith6097 Рік тому

    I love all your ideas for Jason movies. Now I have to do some soul searching because I might be a legitimately terrible person for wanting to see Jason vs the muppets vs knights of the round table.

  • @dronesaur4328
    @dronesaur4328 4 роки тому +11

    I actually like the later Ft13 movies more. The first several were kinda just standard, middling slasher films. In later sequels, the just embrace the campiness.

  • @Dragonatrix
    @Dragonatrix 5 років тому +9

    okay but jason going back in time to fight the knights of the round table is such a cool idea????????

  • @robinjunior7331
    @robinjunior7331 3 роки тому

    You're subtle sarcasm is awesome, great video bro, 10/10 for info and details

  • @WhatRobodoom
    @WhatRobodoom 5 років тому

    i genuinely unironically love all the pitches you threw at the end here. firday the 13th: the musical sounds like total honest gold

  • @aswiftshift5229
    @aswiftshift5229 Рік тому

    I just rewatched the second film and it's setting isn't at Camp Crystal Lake but at a counsellors training centre in the other side of the lake one of the characters even finds a sign for the camp and says "this is on the same lake were staying at" or something to that affect this is also where Jason's shack is located so it's possible he washed up there twenty years before hand and got lost so just decided to stay, and maybe he stumbled on his mother's murder by accident and that's when he took her head and sweater or maybe the second part is still a continuity error idk

  • @askewman37
    @askewman37 5 років тому +24

    Not gonna lie, I would probably enjoy the hell out of all those ideas at the end.
    On an actual serious note, I’d be interested in a video with your thoughts on Halloween 2018. You seemed to have some opinions waiting to be voiced on that one

  • @ironiconion
    @ironiconion 5 років тому +3

    you didnt mention the ridiculous timeline where part 3 happens immediately after the events of part 2 and part 4 happens immediately after the events of part 3, but jasons killing spree somehow become folkloric legend.
    the way each film seems to be both be made up out of whole cloth while also paying lipservice to strict continuity is actually big reason i love the series. i love that its completely contradictory but doesnt even try to explain it. i love that by part 4 the film makers seem to be making sequel to the idea of friday the 13th in popular culture more than any previous film. i love that part 7 is just carrie vs jason and also that jason's body has tons of marks of continuity, including all the scars hes gotten from his past deaths and major injuries. while my ability to watch the films wanes after part 7, i love how wild the conclusion to part 8 is

  • @stm7810
    @stm7810 5 років тому +8

    The Friday the 13th cinematic multiverse.

  • @mattblissett1966
    @mattblissett1966 3 роки тому

    I have been watching your videos. They are great, warm, engaging and in this one, the phrase 'for some reason' is delivered with the same withering contempt as this series deserves.

  • @spider-manunknown9193
    @spider-manunknown9193 3 роки тому +3

    All the Friday the 13th movies are canon in the end from part 1 to Jason X and even all 6 nightmare movies are canon despite the continuity’s it’s all canon.

  • @chriscze6153
    @chriscze6153 4 роки тому +2

    the image of jason fighting miss piggy for manhattan i live

  • @kingmj87
    @kingmj87 2 роки тому +2

    Camp Crystal Lake (also known as Camp Blood) is located on Crystal Lake, which the Native Americans who once resided in that area knew as "the Blood Lake," a sort of watery Pet Sematery wherein one could resurrect the dead, but only with enough fresh human sacrifices. Pamela Voorhees was murdering counselors in an attempt to resurrect her son, Jason, but in the end, the last sacrifice was herself. The film ends with a mystical vision of the zombie child rising from the lake. In Part 2, Jason has Pamela's head and sweater on an altar because he is now trying to do the same: to resurrect his mother through human sacrifices (there are various animal sacrifices strung up around the cabin, showing that these attempts failed). As is typically the case with human sacrifices, VIRGIN sacrifices are the most powerful, which is why the final girls are usually the most virginal members of the group, and the last thing that Jason needs to finally resurrect his mother. In Part 7, the chick with magic Carrie powers is drawn to Crystal Lake because of its ancient demonic energy, and at the end, the number of sacrifices committed to the lake actually resurrects her own father, who (spoilers) drags Jason down to a watery grave. Also, this is why Roy was murdering random kids after his mentally challenged son died: he was trying to resurrect him in the mystical evil waters of Crystal Lake.
    Literally all of this is headcanon. Sorry. But at least it makes sense. You're welcome.

  • @illi-the-wolf
    @illi-the-wolf 4 роки тому

    This seriously had me cackling with all your descriptions. What a fun video!

  • @ntfilmsllc6277
    @ntfilmsllc6277 5 років тому +29

    If you click on a new video so fast that the page says "no views" when you get there, does that mean you win the lottery?

  • @bronxbl0gr
    @bronxbl0gr 4 роки тому +2

    Why did Cronenberg not direct "Jason X"? Can you imagine?!

  • @linasayshush
    @linasayshush 4 роки тому +1

    I like that you say they "threatened" to make a shitload of Friday the 13th movies

  • @camazettz
    @camazettz 5 років тому +3

    If you look closely in part 2, you can see Jason is swinging his machete backwards

  • @ediapaff8858
    @ediapaff8858 4 роки тому +2

    I know all of these pitches in the end are jokes, BUT they all sound amazing

  • @CoopDVille-rx3hp
    @CoopDVille-rx3hp 3 роки тому

    The first and second films shared several filming locations,which at very least helped them to feel like they happened in the same general area. But after the second film, absolutely no attention was paid to such things. I like to imagine that Crystal Lake is a fictional additional one of the Great Lakes,with more than enough real estate right next to the lake to allow all of the various locales seen in these films to actually exist in the same world. And then I like to imagine the map of this area and what it might look like. How far is it from the halfway house for mentally deranged teenagers in part five to the town of Lake Forest Green in part six? And how far from there to that OTHER town in Jason Goes To Hell? Cuz we are on the infinite shores of an infinite lake,and so I imagine that travelling between some of these places takes quite awhile. Also,I want a poster that is this impossible map.

  • @MiSTSYL
    @MiSTSYL 5 років тому +14

    My favourite two are 5 & 6.
    I like 5 because it's blatantly trying to ground itself and is also mean as fuck. Shame the studio decided to nix the Tommy is the new killer angle because audiences apparently wanted Jason.
    I unabashedly love 6. Yes it makes no sense in the context of previous films and has a ridiculous set up...but it knows it's ridiculous; there's a lot of meta humour in there and it's a great precursor to the likes of New Nightmare and Scream.

    • @VasManHorrorLivesMatter
      @VasManHorrorLivesMatter 5 років тому +7

      Jason Lives for the win👍

    • @thedestroyer2alltrolls411
      @thedestroyer2alltrolls411 2 роки тому

      Part 5 was absolute garbage! Stupid Roy impersonating Jason was the dumbest thing ever. Part 6 and 7 should be your favorites, especially 6.

  • @CandyPawz
    @CandyPawz 5 років тому +3

    I didn't recognize this channel in my recommended so I was curious and was delighted to see it was you^^ Def subscribing :3

  • @zuulmeister8409
    @zuulmeister8409 3 роки тому

    Bride of Jason actually reminds me of a fanfic I read. The Strange Good Girl. A girl murders and dismembers her abusive friends when she moves to Camp Crystal Lake and Jason is now head over heels for her. It's just a lot of fun moments of them killing people together. They work out a whole system.

  • @nateblack8669
    @nateblack8669 5 років тому +5

    I'll always love 2, 3, 4 and 7 but that doesn't mean I don't acknowledge how genuinely terrible they are.

  • @BrowncoatFairy
    @BrowncoatFairy 3 роки тому +1

    "Tommy's not a Jason anymore, he's chill again. and he DIGS UP JASON'S BODY FOR SOME REASON" you know, like chill people do.

  • @themoviebaker
    @themoviebaker 3 роки тому +1

    I thought the auto-focus was intentional because it doesn't have much continuity just like the F13 movies.
    Great video, btw.

  • @Sims_E
    @Sims_E 4 роки тому

    Haha, I love your ideas for the future F13th movies! :)) (And I am afraid some just might be made someday)

  • @piemastera
    @piemastera 3 роки тому +1

    So your idea is basically Too Many Cooks, but pick any random cookie cutter movie and just have Jason just randomly show up and murder the cast and either have the cast act like it's not happening. That or just have every movie just shift to a horror movie, kill Jason, and then go back to the movie like that was a normal thing.

  • @daved2352
    @daved2352 5 років тому

    I unironically want all of your Jason movie pitches to be made.

  • @ozmarichardson-wangenstein9379
    @ozmarichardson-wangenstein9379 4 роки тому

    there is an alternate cut where she wakes up from the last scene and it turns out it was all a dream. the studios wanted a happier ending

  • @TimmyGsStuffAndStuff
    @TimmyGsStuffAndStuff 4 роки тому

    I can help!!! Continuity is actually fair through the first 5 movies, and most people miss this. But, it's implied through the campfire story and bar discussion in part 2 that Jason escaped the drowning and survived in the woods hunting small animals. Then after witnessing his mothers beheading began hunting campers as revenge. That's not the only narrative that was abandoned beginning with Jason Lives either, because after being dismembered by Tommy in The Final Chapter, the sheriff mentions in The New Beginning that Jason was cremated, yet he's a full corpse when Tommy digs him up in the beginning of Jason Lives lol. Great video my dude!!!

  • @emriesq3096
    @emriesq3096 3 роки тому

    You mentioned you were sick with a mysterious cold or something...... checks date. The Rona! Glad you're ok and still making cool videos

  • @ZillMob
    @ZillMob 2 роки тому +2

    Chest cold in January 2020 nothing to worry about

  • @efkastner
    @efkastner 3 роки тому +1

    The prequel should be called, “Thursday, the 12th”

  • @mikemeggison5084
    @mikemeggison5084 2 роки тому +1

    Here's how I head-canon fix Jason. 1-5 actually happened (in universe). The mother, human Jason, and the ambulance driver were real people who did real killings with nothing supernatural. 6-11 are stories around the campfire getting crazier and crazier. The reboot is the boiled down edited true-crime novel of the legends with the crazy supernatural stuff sifted out.

  • @gabrielgray83
    @gabrielgray83 3 роки тому +2

    You should examine the ramifications of the theory that Jason and Evil Dead are in the same universe and whether or not that would fix a lot of these inconsistencies.

  • @freds2052
    @freds2052 Рік тому

    Thank you for laying out clearly the ways in which this canon makes sense and is consistent.

  • @silverfox4107
    @silverfox4107 4 роки тому +1

    Can we get a video like this for the Halloween series?

  • @dormagio
    @dormagio 4 роки тому

    I want to watch every single one of those Friday XIII movies you pitched.

  • @stinkiesttwink
    @stinkiesttwink 5 років тому +4

    friday the 13th: jason learns to cook
    friday the 13th: jason goes to europe
    friday the 13th: jason runs for president
    friday the 13th: jason becomes a rockstar

    • @LucianCorrvinus
      @LucianCorrvinus 3 роки тому

      Friday the 13th: Jason, Behind the Music...or Cribs can't decide...

  • @Idonotsa49
    @Idonotsa49 4 роки тому

    Every one of your sequel ideas would legitimately be amazing

  • @videodromeTVversion
    @videodromeTVversion 5 років тому

    What timing: the Paramount Blu-Ray boxset of the first 8 movies just went OOP like 10 days ago. (Yeah, there was a bigger boxset of all the movies at one point but that went OOP in like a month.)

  • @alanamontero4743
    @alanamontero4743 5 років тому +1

    One of my teenage friends and I used to like watching Friday the 13th movies and pointing out all the wrong things and making fun of them. Good times.

  • @CzechAvailabilitie
    @CzechAvailabilitie 5 років тому

    Don't forget that due to the various time jumps in between films by the time Jason "takes Manhattan" it's around 2001 or so.

  • @seiretzym
    @seiretzym 4 роки тому

    Friday the 13th is my preference over Nightmare, but I still enjoy your videos so liking this lol

  • @ShutItKyle
    @ShutItKyle 5 років тому

    There was supposed to be a sequel to Jason vs Freddy with Ash from Evil Dead but they couldnt do it because licensing or w/e so they made it into a comic.

  • @morganalabeille5004
    @morganalabeille5004 4 роки тому +1

    My image of Jason is entirely shaped by Worthikids' "Jason and Friends." I just see him as a responsible dad who speaks in sign language and takes his kids on roadtrips and refuses to buy alcohol for his son Freddy Kruger but will buy a muffin for his daughter Samara from The Ring.

    • @morganalabeille5004
      @morganalabeille5004 2 роки тому

      Samara is his daughter because he’s married to Sadako, who adopted her.

  • @karl_alan
    @karl_alan 3 місяці тому

    They kept the continuity of that crack in the mask from the axe in pt 3, so there's that?

  • @calessel3139
    @calessel3139 3 роки тому +3

    You have to remember that Friday The 13th started as a cheap knock off of the movie Halloween. When the film ended up being a hit, the producers simply pumped out sequels on a nearly annual basis in the 1980s. Early sequels were written hastily having little thought about consistently or plot, later sequels were simply created to cash in on the franchise, many based on a "what if" concepts. So this isnt like the Star Wars, Alien or even Hellraiser series that are supposed to have some consistent cannon.

    • @thedestroyer2alltrolls411
      @thedestroyer2alltrolls411 2 роки тому

      Even Star Wars has a lot of logical continuity errors, but nowhere near as bad as this atrocious franchise.

  • @wyndgrove9452
    @wyndgrove9452 4 роки тому +1

    Boy, Jason really is a multiverse knife guy.

  • @BP-vc4em
    @BP-vc4em 5 років тому +1

    Omg, that doctor who episode with the gas mask child (“the empty child”) is based on jason X.

  • @42071
    @42071 3 роки тому +1

    Jan 7th, 2020. starts with "I'm sick" with some mystery disease. hmmmmm

  • @Initiallyleo
    @Initiallyleo 5 місяців тому

    Being a real estate agent selling properties near Camp Crystal Lake must be EXHAUSTING

  • @Matt-mq6ws
    @Matt-mq6ws 5 років тому +3

    Ok, but hear me out: Jason was in Mortal Kombat X, Kratos was in Mortal Kombat 9 and Soul Calibur 6. Darth Vader and Yoda are in Soul Calibur 4 and Luke, C-3P0, and R2-D2 were all on the Muppet Show, so Jason vs the Muppets is a canonical possiblity.

  • @dl-zf9dj
    @dl-zf9dj 3 роки тому

    i would legit watch all of your fri the 13th pitches

  • @theonlykoh4631
    @theonlykoh4631 Рік тому

    I find myself coming back to watch this video like 3x a month.

  • @liamshanley4920
    @liamshanley4920 5 років тому +15

    4:10 Hannibal Buress: Why are you ME? I’m ME!

  • @maxmfpayne
    @maxmfpayne 3 роки тому

    For the record, I would absolutely watch every single one of your suggestions. Gold, pure fucking gold. Honestly, if I ever for whatever reason one day become a film maker, can I please have permission to use all of your ideas in a reboot series? I would have so much fun making this absolute garbage.

  • @johnnydsnarkangel
    @johnnydsnarkangel 5 років тому +1

    Every single one of those alternative pitches would be better than just another Jason movie.

  • @jacob_ian_decoursey_the_author
    @jacob_ian_decoursey_the_author 5 років тому

    All of those movie pitches at the end were brilliant and I want all of them to happen especially the musical.

  • @lord_lilith
    @lord_lilith 5 років тому +9

    Thank you for giving me the spark notes for a movie franchise I have managed to avoid seeing all of my life and will continue to avoid seeing. I am willing to reconsider changing this mindset in return for free tickets to Freddy vs. Jason vs. Tomie: Going Hawaiian in IMAX.

  • @pedantsunited5368
    @pedantsunited5368 3 роки тому +1

    god I'm so glad someone else thought part 1 was boring. I thought I just "didn't get it"

  • @miketate3445
    @miketate3445 4 роки тому

    I need to see all of your hypothetical Friday sequels. Now.