Pro Pokemon TCG Player Rates Hearthstone Cards

Поділитися
Вставка
  • Опубліковано 1 жов 2023
  • Check out ‪@AzulGG‬
    You should watch me live on Twitch:
    / rarran
    ▶Discord: / discord
    ▶Twitter: / rarranhs
    ▶TikTok: / rarranhs
    Edited By: / mf_daveed
    Art By: / sozcboi
    #Hearthstone #Rarran #runeterra
  • Ігри

КОМЕНТАРІ • 226

  • @tobal11385
    @tobal11385 8 місяців тому +472

    The level of analysis that he provides to his answers is wonderful. Really thinking at another level

    • @coolyeh1017
      @coolyeh1017 8 місяців тому +18

      There is a reason why Azul is considered one of the best players in the Pokemon TCG. It is great he has content that breakdown games on stream and his thought process.

    • @sunnysangha2097
      @sunnysangha2097 8 місяців тому +1

      yeah this bruv can think for reals

    • @ThundaFuzz
      @ThundaFuzz 8 місяців тому +2

      I've gotten to the point where when new cards are announced for HS and they interact someway with other cards, I'm always now like "well it depends on how good the other cards in conjunction with this one will be".

    • @cs16Tactics
      @cs16Tactics 8 місяців тому +1

      Ye it was nice to hear his analysis! Seemed like calm and analytic dude

  • @NoMoreQuestions
    @NoMoreQuestions 8 місяців тому +171

    Bring this guy back for more, it’s really cool seeing his high level analysis.

    • @aaaqui__9761
      @aaaqui__9761 8 місяців тому +4

      you should check his channel out. crazy high level of playing the ptcg and very informative in terms of sequencing and resource management.

  • @LucasRoth42
    @LucasRoth42 8 місяців тому +68

    Rarran: first pro player from a different game that I talk to
    PVDDR: excuse me what

  • @Rarran
    @Rarran  8 місяців тому +81

    Yeah I am not sure what happened with Tony, sorry for the confusion. Gonna cut it from the video.
    Also this video was recorded around the release of the mini set, where the jailer wasnt super good

    • @khdo12346
      @khdo12346 8 місяців тому +23

      well you don't have to cut it, it was the most fun part of the video with how the guest reacted to it

    • @ColBanana
      @ColBanana 8 місяців тому +3

      Tony still living rent free in your head?

    • @freshjori
      @freshjori 8 місяців тому

      Just add the proper card image. Shouldn't be too much work.

    • @N12015
      @N12015 8 місяців тому +2

      Also, isn't Jailer seeing tons of play lately on Druid due to degenerate Tony Combos giving the opponent the empty deck? Talking about awkward timing, although the thing with Tony is that he has been broken for almost month at this point... AGAIN. I really hate Tony as much as the Mischevious Imp.

    • @adi9075
      @adi9075 8 місяців тому

      i thought the same
      @@N12015

  • @Granolax
    @Granolax 8 місяців тому +286

    When you think about it, Brass elemental is better than Restless Mummy, which was a very good card in control war at the time. Crazy powercreep

    • @paperknigth2263
      @paperknigth2263 8 місяців тому +76

      The thing is that Restless Mummy was a Warrior card. Shaman always had better options to clear the board for around the same Mana Cost if they really want to do that.

    • @lesiegelad
      @lesiegelad 8 місяців тому +16

      I wish we could get more keyword vomit cards in the game, but actually make some of them decent. Such a fun type of card. It's a bummer it always sucks.

    • @Opno
      @Opno 8 місяців тому +8

      I think it just has more to do with class identity. Warrior, especially at the time, was extremely control oriented, so they were fine having 3 damage removal X 2 and not sticking anything. Shaman doesn't really want to do that

    • @drewpeacock9087
      @drewpeacock9087 8 місяців тому +6

      @@Opnonah lol nobody is playing restless mummy nowadays, not priest nor warlock nor warrior. The game has been turbo powercrept.

    • @Opno
      @Opno 8 місяців тому +11

      @@drewpeacock9087 well it's not in standard anymore and wild has always had a completely different power curves, of course it doesn't seem play now

  • @PeterZaitcev
    @PeterZaitcev 8 місяців тому +74

    You should have included Odyn, Prime Designate right after Hodir, Father of Giants. Both are 8/8 for 8 with Battlecry affecting your next turns.

  • @adamn7777
    @adamn7777 8 місяців тому +38

    Runthak absolutely saw play back when rush warrior was a thing in barrens. It was a hand buff warrior and was surprisingly good

    • @redsnipingshot
      @redsnipingshot 8 місяців тому +8

      I was wondering if I had a fever dream or something because I absolutely remembered Runthak into Samuro being a legit board clear for a while.

    • @SuctionCat
      @SuctionCat 8 місяців тому +3

      Yeah it was played in handbuff Pally in Stormwind too.

    • @amaranthus4206
      @amaranthus4206 8 місяців тому +3

      I remember an earlier video where Rarran said something similar about Rokara (the minion version) which used to be good in that exact same deck. Guess Rarran completely blocked that deck out of his memory. 😂

  • @andreskg8479
    @andreskg8479 8 місяців тому +202

    I see Rarran has found a formidable foe in the "World's Fastest Talker" competition.

    • @Otzkar
      @Otzkar 8 місяців тому +6

      have you heard of ben shapiro?

    • @ThePuppy009
      @ThePuppy009 8 місяців тому +35

      ​@@Otzkarunfortunately yes

    • @20quidd
      @20quidd 8 місяців тому +8

      ​@@Otzkarwe r talking ab speaking not yapping 😂

    • @andreskg8479
      @andreskg8479 8 місяців тому +2

      @@Otzkar They make a helluva Top 3!

    • @Otzkar
      @Otzkar 8 місяців тому +4

      @@ThePuppy009 my condolences

  • @coreycubed
    @coreycubed 8 місяців тому +11

    22:05 Pyro Ball is a signature move in Pokémon, please forgive our boy Azul for the mixup

  • @Vaudrin
    @Vaudrin 8 місяців тому +45

    Ancient of Lore will always have a special place in my heart even if it's unplayable today, during classic that card clutched me so many games I should have otherwise lost

    • @ce8539
      @ce8539 8 місяців тому +6

      Facts, he's was a true bro

  • @Mrlonefighter
    @Mrlonefighter 8 місяців тому +44

    Gotta be one of the more interesting guests for this series! Really high level analysis, pretty much spot on for most of the cards, impressive!

  • @joshuaosgood6494
    @joshuaosgood6494 8 місяців тому +12

    Never knew Tony was a keyboard :> . Awesome video as always

  • @mikerenfrew9974
    @mikerenfrew9974 8 місяців тому +15

    Overlord Runthak saw play in coaster rush warrior! It was such a strong deck when I was playing it.

    • @WavemasterAshi
      @WavemasterAshi 8 місяців тому

      I *LOVED* playing Rush Warrior back then! Playmaker, E.T.C. God of Metal...

    • @mikerenfrew9974
      @mikerenfrew9974 8 місяців тому

      @@WavemasterAshi yeah it was really legit! No one was playing it and was an easy climb

  • @Ocanza
    @Ocanza 8 місяців тому +8

    Having watched a metric buttload of both Azuls and your content, I didn't know this was the collab I needed. Thanks Rarran ❤

  • @zigster1298
    @zigster1298 8 місяців тому +2

    Dayyyyyum, love to see this. Love that you bring content creators together from across the card game sphere. A Worlds Semi-finalist rating Hearthstone cards will be interesting

  • @timepopsicle3495
    @timepopsicle3495 8 місяців тому +6

    love seeing two of my favorite creators collaborating!!! please review pokémon cards

  • @bigfish9105
    @bigfish9105 8 місяців тому +3

    I haven't played hearthstone for years but your videos are really entertaining. I remember how to play hearthstone really vividly so I get everything that's going on, besides some new card context. seems like there's been a significant amount of power creep which isn't really unexpected. I'd love to see some more magic the gathering collaboration videos but I think you making content you like to make is more important. keep it up :)

  • @gnomeking1225
    @gnomeking1225 8 місяців тому +2

    need more of these kinds of videos find them funny and very amusing having played most the card games myself

  • @Jolron14
    @Jolron14 8 місяців тому +4

    Hey I didn't expect to see Azul here! That guy is great, crazy good player. Awesome video Rarran!

  • @PRoDMG395
    @PRoDMG395 8 місяців тому

    Best video of that kind on the channel. Definitly should make more with that awesome dude. Great analysis

  • @Galdeater
    @Galdeater 8 місяців тому +2

    I haven't played since Karazhan, but your videos have got me back into hearthstone. Keep up the good work!

  • @doodledeedah
    @doodledeedah 8 місяців тому +13

    This guy knows his shit for not playing modern HS get him on again!!

  • @0matic
    @0matic 8 місяців тому +4

    Tony Jailer druid literally appeared out of nowhere last thursday and started destroying standard lmao

  • @EJDmesman
    @EJDmesman 8 місяців тому

    love the video, and love too see an Azul collab. would love to see more videos wityh azul or some pokemon videos

  • @damionlynette6512
    @damionlynette6512 8 місяців тому +1

    I love these videos, so interesting to hear outside analysis

  • @BDPnix
    @BDPnix 8 місяців тому

    That was very interesting to have a high level analysis. I loved the fact that he voiced his thought process. I'd love to see him again.

  • @coolbasegaming9162
    @coolbasegaming9162 8 місяців тому +1

    FINALLYYYY IVE BEEN WAITING FOR THIS FOR SO LONG

  • @Chocolatepain
    @Chocolatepain 8 місяців тому +1

    I've seen shadow suffusion played! Great video as always rarran.

  • @fritothedemon6647
    @fritothedemon6647 8 місяців тому

    This guy is GOOD. So much fun to watch a pro analyze these so well

  • @MEngelberts
    @MEngelberts 8 місяців тому

    Loved this episode! Hope we get to see Azul back on the channel

  • @DarkMarkGaming94
    @DarkMarkGaming94 8 місяців тому

    Great to see Azul here! If you plan to do another video like this with a Pokemon TCG content creator, I would LOVE to see Andrew from Tricky Gym on the show!

  • @mrbones123
    @mrbones123 8 місяців тому +1

    Has me dying when talking about ice block. "They realized quickly after a couple of years"

  • @BortSamsung
    @BortSamsung 8 місяців тому

    Love these videos, I will never get bored of seeing people from other games try to rate Hearthstone cards. You struck gold with this idea imo

  • @ArasmusSOU
    @ArasmusSOU 8 місяців тому +1

    Great video. I love the guest and his analysis. One thing though…jailer is warping the meta at top legend right now. I’m surprised this is not mentioned

    • @FafliXx
      @FafliXx 8 місяців тому

      Jailer has been a thing for a while tbh. Tony Druid has been around since both released, and Order in the Court Paladin with Jailer was a top meta deck for a while. The whole point was to draw the Jailer with Order. Nowadays with Pure Pala they don't anymore, but people really forgot that quickly?

  • @possibear
    @possibear 8 місяців тому +13

    15 health 15 cards is too small even for aggro. it breaks the threshold of too few cards being good and it becomes really bad and 15 health is just throwing in current HS

    • @satibel
      @satibel 8 місяців тому +1

      How often do you get to 15 cards left in aggro? Not that much.
      It's very polarizing, but you can definitely rush down your opponent.
      It probably isn't that good in current aggro decks, but this basically guarantees getting specific cards in hand, so if you can have a board with like 3 3/3 on turn 1 or 2, you probably win quite often
      If there's something like quests that are aggro, you can basically guarantee them proccing early

    • @byeguyssry
      @byeguyssry 8 місяців тому

      But you can extremely reliably create "mini-combos".
      You're gonna aggro your opponent down before they can reasonably deal 15 to you, unless they're also an aggro deck. In which case you're gonna lose to aggro decks but win against everything else.

    • @satibel
      @satibel 8 місяців тому

      @@byeguyssry yeah decks similar to "midrange"/dragon hunter and math warrior would probably be dominant in a meta like that.

  • @georgholubetz7291
    @georgholubetz7291 8 місяців тому +2

    Kibler had a neat deathrattle shaman deck with shadow suffusion

  • @gem3763
    @gem3763 8 місяців тому +1

    I am stunned by how on point the analysis of The Jailer was, especially with the Druid deck versus control (Blood DK)

    • @FafliXx
      @FafliXx 8 місяців тому

      Right now yeah, but when it came out it literally defined like 3 different decks.
      Order Paladin for example was a top meta deck for a while specifically because of Jailer.

  • @edrodriguez4482
    @edrodriguez4482 2 місяці тому

    Crazy analysis gdamn

  • @hunterpierce7350
    @hunterpierce7350 6 місяців тому

    I need more videos like this

  • @TrimutiusToo
    @TrimutiusToo 8 місяців тому +2

    Runthak did see play before stormwind

  • @sohanalleshwaram4340
    @sohanalleshwaram4340 8 місяців тому +1

    21:43 He literally just described control jailer paladin lol. Gameplan is play order in the court --> wait till 10 --> play jailer. The deck was actually quite good during Nathria, probably off the back of Cariel though.

  • @ElasticLove12
    @ElasticLove12 8 місяців тому

    Love Azull this was great

  • @herk3812
    @herk3812 8 місяців тому +3

    There is a hodir father of giants deck in standard that I have lost to a couple of times in diamond. It’s a burst/mid range otk style deck to where you play hodir then the next turn play the hell hound card with two always a bigger jormungar. If you have three minions on the board you just lose.

  • @stephanblake6
    @stephanblake6 8 місяців тому

    Yoooo Azul is one of my favorite creators, seeing him here is incredible!

  • @EZ-eu1cv
    @EZ-eu1cv 8 місяців тому +5

    Here before raran edits this so teh cards are not on azuls face

  • @repulsivefish
    @repulsivefish 8 місяців тому

    looove azul!
    one of the best deck creators and pilots in ptcg

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 5 місяців тому

    One of the best episodes in this series. The card choices were great! Made for great analysis.
    I wouldn’t find it ridiculous if a few months into a new meta game we realised “oh yeah, that player Rarran interviewed who hasn’t played standard hearthstone in six years was absolutely right about this card”.
    It’s easy to become biased against cards that see no play and start adding up supposed reasons they never saw play when they were released. Very often the reason is not lack of support for them but other options for the class and general meta. It wouldn’t be the first time that after a rotation or a nerf a deck that seemingly consists only cards that are “low impact”, “too clunky” or “too easy to remove” just comes out of nowhere and becomes high tier deck. It’s easy to equate an unplayable card as a weak card, but in reality there are plenty of strong unplayable cards, waiting for opportunity to shine.

  • @romain_lemarchand
    @romain_lemarchand 8 місяців тому

    Really liked this episode, Azul is pretty f-ing smart

  • @Ninterd2
    @Ninterd2 8 місяців тому

    OHHHH this is going to be exciting!!

  • @cruseder2336
    @cruseder2336 8 місяців тому +1

    Awsome job!

  • @michaelryan1767
    @michaelryan1767 8 місяців тому

    Runthak was pretty good when it was in Standard as a Barrens card before it was added to the core set. It was a key part of handbuff Paladin.

  • @sfcpudding
    @sfcpudding 6 місяців тому

    "you're the first pro player I've talked to"
    PVDDR: "Am I a joke to you?"

  • @nimblesheepvenomous3811
    @nimblesheepvenomous3811 8 місяців тому

    I notice your giving your guests the un-nerfed versions of cards now. I appreciate it, it makes the analysis much funner

    • @nimblesheepvenomous3811
      @nimblesheepvenomous3811 8 місяців тому +1

      well you showed him unnerfed renathal, but then nerfed secret passage. Its ok, secret passage is still broken so it works out

  • @Jedicake
    @Jedicake 8 місяців тому +1

    I've never played Pokémon TCG but I've always heard that game is surprisingly more complex and thought-provoking than I give it credit for

  • @TheWormooo
    @TheWormooo 8 місяців тому +1

    ok so hes pro Pokemon TCG player no wonder. The way he analyse card is so good.

  • @greggp4840
    @greggp4840 8 місяців тому

    I played control paladin to legend last season (not pure). I like astral serpent, but the biggest problem with it isn't that I want to be doing something else on 4 - it's that if I'm throwing down Tyr to try to ressurect a Kangor or Annoyotroupe and hit this instead, I've probably just lost. Ironically it would be better as a 2-3 than as a 3-3 just because of that conflict.

  • @anthonybeutel9429
    @anthonybeutel9429 8 місяців тому +3

    LETS GOOOOO AZULLLLLLLLLLLLL

  • @Crause88fin
    @Crause88fin 8 місяців тому

    Yo, please you have to do one of these with Metropole Grid and Netrunner! Bringing games and communities together with these is such a great thing.

  • @Lightn0x
    @Lightn0x 8 місяців тому

    Overlord Runthak was played in rush warrior like 2 years ago, and that deck was tier 1 back then and it had to get nerfed.

  • @fuccini3181
    @fuccini3181 8 місяців тому +1

    runthak absolutely saw play in rokara rush warrior

  • @takeazelfie6584
    @takeazelfie6584 8 місяців тому +3

    azul jump scare

  • @barryschalkwijk9388
    @barryschalkwijk9388 8 місяців тому

    i played brass elemental to good effect. Great for aggro matchups.

  • @Very_Bord
    @Very_Bord 7 місяців тому

    In regards to Shard of the Naaru, from a MTG perspective, that card is insane. It's a cantrip/cycle with an incredibly good ability if you choose not to.

  • @pursuantspy1557
    @pursuantspy1557 8 місяців тому

    Runthak has been a meta card ~2 years back in a couple different warrior decks (i think enrage and control from couple years back) so its seen some play in standard

  • @tannermattingly4462
    @tannermattingly4462 8 місяців тому

    Just to note, I have seen a few rare Paladins running Astral Spirit in Wild. I've seen it in both a midrange Death and Taxes style Even Paladin, and in a really cool Dragon Paladin list that was probably just looking for any playable dragon. Both times it was played as a 4 mana 3/3 with battlecry draw 2.

    • @sqentontheslime1967
      @sqentontheslime1967 8 місяців тому

      How many of them lived long enough to attack or draw a second time in the first place?

  • @chrisreece4474
    @chrisreece4474 8 місяців тому +1

    What i want to know is are we going to get a rarran series of him rating pokemon cards just like he does with yugioh and runeterra

  • @amethonys2798
    @amethonys2798 8 місяців тому +1

    Honestly the "reverse Renethal" effect wouldn't even be THAT bad in say aggro vs control. The big issue is Aggro mirrors will be even more coin flippy and blowout than they already are since the game is probably guaranteed over on turn 4 if someone can establish a remotely okay board since they only have to push 15 damage.

  • @trobtx3538
    @trobtx3538 8 місяців тому

    for a card like 8:20 how would spell damage interact with it. Like do you need the spell damage active when you cast it? or when the deathrattle procs? or does it just not work?

    • @youtubehandle102
      @youtubehandle102 8 місяців тому +1

      need spell damage on board when the dr goes off

  • @fredericpoupart2552
    @fredericpoupart2552 8 місяців тому

    To be fair about Renathal, it was only good in a handful of decks (prestor druid, quest hunter, quest priest) when it released before Castle Nathria as there weren't enough generally good cards to make it work in decks that didn't specifically gain from the extra deck size in addition to the health.
    Also I'm not sure if it's correct to say that Volume Up has been that impactful for mage; it's pretty decent but it hasn't been an autoinclude (there were multiple iterations of rainbow mage without it for example) as it can be a bit awkward to use sometimes.

    • @amethonys2798
      @amethonys2798 8 місяців тому

      The renethal argument is the same for MOST decks only working on 4 expansions of card pool though. Historically throughout the years aggro as an example is usually far better in expansion 1 when compared to expansion 3 because zoo tempo decks playing good stats for cost can win games in limited formats where control decks either don't have enough removal options or just don't have a way to win the game at all (see Control Warrior pre-Odyn).
      Obviously there are outliers like Blizzard printing practically custom cards for aggro in MotLK, but that isn't always the case.

  • @Sonicmaster4
    @Sonicmaster4 8 місяців тому +5

    Overlord Runthak is honestly the power level that I'd really like most of Hearthstone to be at

    • @H0C0X
      @H0C0X 8 місяців тому +2

      Runthak saw quite a fair amount of play in the Barrens in both warrior and paladin. I think the Barrens meta was by far the most boring meta I've ever played in.

    • @hurtsaabayaraa2277
      @hurtsaabayaraa2277 8 місяців тому

      ​@@H0C0X Not overpowered = Not that fun.
      Rastakan and Barrens were expansions where they tried replacing power creep for complete syngerize between 30 cards. Did not work.

  • @electricVGC
    @electricVGC 8 місяців тому +1

    This was a lot of fun! Maybe we can see the options reversed?

  • @xyzen9673
    @xyzen9673 8 місяців тому +22

    Big sad that rarrans tony got banned in wild.

  • @DrakonPhD
    @DrakonPhD 8 місяців тому

    Runthak was good a couple years ago in pirate/rush warrior.

  • @erikbladh7464
    @erikbladh7464 8 місяців тому

    Rarran featuring Azul? Sweet!
    *Sets video speed to 0.75*

  • @jomo2x
    @jomo2x 2 місяці тому

    Very quickly after couple of years :D :D

  • @alek4ever646
    @alek4ever646 8 місяців тому

    Hidden passage is still used in every single rogue deck in wild from my experience.

  • @FafliXx
    @FafliXx 8 місяців тому

    Runthak was absolutely played a lot back when it came out.
    It got power-crept out of the meta, but tbh Paladin might actually still play it if it didn't have to go Pure.

  • @cocoaplier_2237
    @cocoaplier_2237 8 місяців тому

    They do have a 15 health/card mode but it's only on the first round its called duels low key my favorite mode

  • @Kingi469
    @Kingi469 8 місяців тому

    Azull is the goat... Rly hope for some more content with Azul, maybe this time in reversed roles, when Azul would show Rarran cards from the past meta

  • @JoeSaidWut
    @JoeSaidWut 8 місяців тому

    I like when Rarran said they nerfed Ice Block very quickly... after a couple years lmao

  • @Klaital1
    @Klaital1 8 місяців тому +1

    Rarran just forgot to mention that Jailer is key part in the best deck in standard at the moment...

  • @Ariovisti
    @Ariovisti 8 місяців тому

    I love how AzulGG says "mingions", is that a dialect thing? Asking as a non-native speaker.

  • @lukascowan6357
    @lukascowan6357 8 місяців тому

    "your the first pro play" rip PVDDR, bro just got completely forgotten by Rarran

  • @paraphilicanalysis1737
    @paraphilicanalysis1737 7 місяців тому

    12:30 as a Magic player, this is the one that looked overpowered to me

  • @saphironkindris
    @saphironkindris 8 місяців тому +5

    This video kinda makes me want to try making shadow suffusion work. It can't be THAT bad of a card, right? Shamans can get big boards pretty easily, and even if you only have 3 minions out which can happen easily in a single turn later in the game, that's a 3 mana deal 9? I mean, it might not be a meta-breaker, but It can't be BAD... Hmmmm

    • @sqentontheslime1967
      @sqentontheslime1967 8 місяців тому

      Very true!
      Even if It’s berated for being bad, seeing cards in vids like these does give an appeal to trying them out

    • @saphironkindris
      @saphironkindris 8 місяців тому

      I tried it in duels and can say: It's aight. You can definitely put better cards in your deck, but I wouldn't turn my nose up at it coming up in one of the buckets.

  • @tbcfrankee
    @tbcfrankee 8 місяців тому

    "They realized very quickly after a couple of years"

  • @wandererfromblindeternitie9748
    @wandererfromblindeternitie9748 8 місяців тому

    now i want an pokemon player rating mtg ~-~

  • @natben6099
    @natben6099 2 місяці тому

    renathal has been unnerfed

  • @thunderstruck560
    @thunderstruck560 8 місяців тому

    While i did expect a pokemon player at some point, i Never expected it to be AzulGG. Maybe a Andrew Mahome type. BUT THE JAILER IS A BUSTED CARD WITH TONEY

  • @area8295
    @area8295 8 місяців тому

    Hearing that Runthak would be good with windfury gave me Duels ptsd lol

  • @kaigelling7157
    @kaigelling7157 8 місяців тому +1

    "They realized quickly ice block wasn't good in standard after a couple of years" -rarran 2023 lmaooo

  • @Paool
    @Paool 8 місяців тому

    I made a Jotun deck with basically zero minions in it and it's a ton of fun

  • @vli9375
    @vli9375 8 місяців тому

    Why would they print brass elemental when command of neptulon was already out?

  • @ssspikesss
    @ssspikesss 8 місяців тому +1

    meanwhile overlord runthak was played in tier 1 deck during forge in barrens 💀 this was when standart had quite a low powerlevel but still...

    • @amethonys2798
      @amethonys2798 8 місяців тому

      1st expansion power level is always in the toilet. I mean one of the best decks was priest which literally didn't have a win condition in the deck besides fatigue and hitting the galakrond button hoping for something not completely useless.

  • @spacedoubt15
    @spacedoubt15 8 місяців тому

    I love how Rarran has never accurately explained what Immune does in any of these videos.

  • @RavenSteam
    @RavenSteam 8 місяців тому +2

    When was this recorded?

    • @Rarran
      @Rarran  8 місяців тому +3

      uhhh 3 weeks ago i think

  • @dollenrm
    @dollenrm 8 місяців тому

    Did rarran film this before tony druid started warping all of standard after the huge nerf rounds? Cuz he talks about the jailer without mentioning hes 50% of the best meta decks combo rn lol

  • @Dougmond
    @Dougmond 8 місяців тому

    Isn’t secret passages effect not technically “drawing” it’s more adding or giving you 4 cards? I could be totally misremembering though.

  • @byeguyssry
    @byeguyssry 8 місяців тому

    Astral Serpent can be thought of as being worse than a 4 Mana Draw 2 cards, deal 3 to a random enemy.

  • @tolperi48
    @tolperi48 8 місяців тому

    That Tony is COSMIC!