Why flat earthers scare me

Поділитися
Вставка
  • Опубліковано 24 лис 2024

КОМЕНТАРІ • 27 тис.

  • @lipsterman1
    @lipsterman1 6 місяців тому +5490

    Social media has taught me two things. First, there are some incredibly brilliant people in the world. Second, they are vastly outnumbered.

    • @GeorgeSmiley77
      @GeorgeSmiley77 6 місяців тому +56

      Okay, but I learned that in school.

    • @duran9664
      @duran9664 6 місяців тому

      🚩FACT🚩
      Flat earthers r TOTALY right when it comes to the fact that many of space videos & photos r CGs, manipulated or fake; including the ones that get released by NASA🤏

    • @voidagent
      @voidagent 6 місяців тому +32

      LOL (Lack of Logic)!

    • @tempname8263
      @tempname8263 6 місяців тому

      @@craigdavidson2977 Internet and social media shown that they're much more likely to write word "WAR" 50 thousand times in a row and spend all of their bananas funding two big monkeys, that will go on to beat up half of monkey's population each

    • @andyhu9542
      @andyhu9542 6 місяців тому +5

      Hold that thought for a while. This is as dangerous if not even more than flat-earth theory. This comment is very libertarian and would lead to pretty extreme ideas if accepted blindly.

  • @Martin_Siegel
    @Martin_Siegel 6 місяців тому +2162

    Isaac Asimov said: "Anti-intellectualism has been a constant thread winding its way through our political and cultural life, nurtured by the false notion that democracy means that 'my ignorance is just as good as your knowledge."

    • @johndonson1603
      @johndonson1603 6 місяців тому

      As much as I know flat earth theory is completely ridiculous, I disagree with that statement, people have the right to hold views that are clearly wrong , it’s their right as human beings , otherwise we end up with free thought and free speech being censored and controlled by those who believe they know better .

    • @puddintame7794
      @puddintame7794 6 місяців тому +51

      God save us form the arrogance of the experts.

    • @iloveitall
      @iloveitall 6 місяців тому +11

      Brilliant.

    • @TheSulross
      @TheSulross 6 місяців тому

      that precisely defines the contemporary Woke mind virus

    • @Vaeldarg
      @Vaeldarg 6 місяців тому +268

      @@puddintame7794 Actual experts have earned the right to be arrogant. Amateurs arrogantly claiming to know more than the experts have not.

  • @alandenton1024
    @alandenton1024 6 місяців тому +1782

    Wikipedia says "The Flat Earth Society has members from all over the globe" Now that is what i call humour.

  • @OfentseMwaseFilms
    @OfentseMwaseFilms 3 місяці тому +87

    I also used to believe the Earth is flat, then I turned 5!

    • @ronpapi9539
      @ronpapi9539 3 місяці тому +1

      @@OfentseMwaseFilms Get back to me when you turn six.LMAO

    • @ronpapi9539
      @ronpapi9539 3 місяці тому +5

      @@OfentseMwaseFilms When you turn 6 ,rethink your answer.Its Flat and you were right at 4yrs old.

    • @myfrequencies1912
      @myfrequencies1912 3 місяці тому +4

      That's absolutely not how it works! lol
      You learned as a child that Earth was a globe, the same way you learned that a fat bearded magical man delivers presents into every home on Earth on Christmas Eve night.
      One of these beliefs you were allowed to doubt at a certain age, & to release.

    • @ronpapi9539
      @ronpapi9539 3 місяці тому +2

      @@myfrequencies1912 Thanks for confirming FE. WET Spinning Ball Earth is Lunacy .

    • @jeremywallis1960
      @jeremywallis1960 3 місяці тому +1

      And were propagandized... lol... you are so proud of your memorization of lies?

  • @Mozart4000
    @Mozart4000 6 місяців тому +1351

    I watch a lot of flat earth stuff on YT. What I've learned is that flat earthers don't want to learn anything. They just want their opinion confirmed. Anything that deviates from that is rejected.

    • @iamTheSnark
      @iamTheSnark 6 місяців тому +88

      Many are able to escape. STST (Seek Truth Speak Truth) is a notable example. Recently, Rachie 00000 escaped, and she is now a debunker. And not even a bad one. FTFE (FIght the Flat Earth) has his own story of many people who saw his videos, and after a while sent Thank You mail to FTFE, helping them escape the nonsense.
      There must be more.

    • @Kim_YoJong
      @Kim_YoJong 6 місяців тому +13

      That's everyone lol

    • @VonJay
      @VonJay 6 місяців тому +69

      I remember bumping into an old friend of mine from middle school who was actually in my science class. Really cool guy as we got along really well. We went to Highschool together but didn’t hang out much maybe because we never had any classes together. Years later I bump into him and for some reason we talk about the earth being flat. And we argue for hours and hours and it’s crazy to me think that he’d take such a position. He even used “math” and “science” to try to prove his point. I asked him about the astronaut photos and he said fish eye lens to which I said that’s not how a fish eye lens works. It got to the point where I just said “everything you’re saying is irreproducible in the real world. Nothing you’re saying can lead to any type of invention or (like Sabine said) real world prediction. It can only satisfy your paranoia.”

    • @ptrinch
      @ptrinch 6 місяців тому +81

      Flat earthers are more interested in the argument than the science. If you ignore them, they won't get what they are looking for and will eventually go away. Alternatively, in the immortal words of the half dozen people attributed to this quote.... "Never argue with stupid people, they will drag you down to their level and then beat you with experience."

    • @QuantumPhyZ
      @QuantumPhyZ 6 місяців тому

      It's schizophrenia. Or another mental illness.

  • @dianafarmer5445
    @dianafarmer5445 6 місяців тому +561

    As an Aussie I'm worried about them too. They said Australia dosen't exist, so I'm worried about where I've been for the last 65 years.

    • @stevenvarner9806
      @stevenvarner9806 6 місяців тому +32

      Your country also resembles a hot dog in their flat earth models.

    • @dianafarmer5445
      @dianafarmer5445 6 місяців тому +8

      @@stevenvarner9806 How lovely😅

    • @jagobabarron5501
      @jagobabarron5501 6 місяців тому +27

      Your country is nothing but a huge tv studio in area 51.

    • @Roybotski
      @Roybotski 6 місяців тому

      ​@@jagobabarron5501 uh what

    • @TeaParty1776
      @TeaParty1776 6 місяців тому +9

      inside a kangaroo

  • @Vohtwomax
    @Vohtwomax 6 місяців тому +511

    I recently had a....debate with a flat earther. We were proceeding with the discussion up until he told me, AND I QUOTE, “not to use science and logic” when trying to persuade him.
    So ended THAT conversation.

    • @godfreyofbouillon966
      @godfreyofbouillon966 6 місяців тому

      Well that was your first mistake. Someone honestly believing in flat earth has IQ of a chimp at best and no reasonable debate is possible.

    • @MyrKnof
      @MyrKnof 6 місяців тому +29

      Its because he wont understand it, so he asks you to not talk gibberish. You cant start at that point, because he is too dumb, you need to start at improving his fundamental knowledge of before talking "advanced" stuff like.. simplified gravity.

    • @k_tell
      @k_tell 6 місяців тому +7

      He may have fallen for the charlatan Samuel Rowbotham's so called "Zetetic Method". Interesting question to ask someone who actually believes in the Zetetic Method is "What is the Zetetic Method?".

    • @DragonOfTheMortalKombat
      @DragonOfTheMortalKombat 6 місяців тому +17

      So what were you supposed to use ? Feelings ? Lol
      You can tell earth ain't by using very common knowledge

    • @ryzikx
      @ryzikx 6 місяців тому

      there are non-scientific arguments to convince someone out of flat earth

  • @vladimiraltuve
    @vladimiraltuve Місяць тому +10

    Some flat earther wrote in a forum "Chile does not exist. It's a fictional country and all those people are just payed actors". Then, one of those actors wrote this answer: "So, please let me switch my role from poor to rich, at least for next season"

  • @mintonmiller
    @mintonmiller 6 місяців тому +512

    Maybe we can get them to compromise. First get them to settle on the idea on Earth being a cube. Then we can gradually round off the edges over time.

    • @raminagrobis6112
      @raminagrobis6112 6 місяців тому +15

      😂😂

    • @johnhough7738
      @johnhough7738 6 місяців тому +9

      Genius! I love it ...

    • @paulkolodner2445
      @paulkolodner2445 6 місяців тому +10

      I think you're on to something here.

    • @mar_twa_wod_aa
      @mar_twa_wod_aa 6 місяців тому +5

      This or add polygons 😂

    • @johnjeffreys6440
      @johnjeffreys6440 6 місяців тому +5

      Ask a flat-earther to call the earth a disc instead of flat. Most won't because the earth is flat from the surface, but not from space.

  • @johnmaynard869
    @johnmaynard869 6 місяців тому +486

    “Those who can make you believe absurdities, can make you commit atrocities.”
    Voltaire

    • @johnmaynard869
      @johnmaynard869 6 місяців тому +1

      @GoldIsSilent0 Games without frontiers.

    • @AngryGroceries
      @AngryGroceries 6 місяців тому +6

      funny thing about that... on some level, everything is absurd

    • @johnmaynard869
      @johnmaynard869 6 місяців тому +11

      @@AngryGroceries that’s absurd. 😜

    • @travcollier
      @travcollier 6 місяців тому +5

      @@AngryGroceries The original quote is longer, more nuanced, and in French.

    • @justincase4812
      @justincase4812 6 місяців тому +1

      The US government apparatus, most governments likely.

  • @caravanlifenz
    @caravanlifenz 6 місяців тому +271

    As a New Zealander, I'm concerned by how dangerously close they've placed us next to the edge of the world where the water drops off 💧😭

    • @johnkean6852
      @johnkean6852 6 місяців тому +9

      The flat earth society model is unrepresentative of current flat earth beliefs. Do more research before you spout ignorance.

    • @russell2952
      @russell2952 6 місяців тому +23

      No worries. Flat earthers don't have a model. They usually take a polar projection and call that their map, but it obviously doesn't fit any real world observations. As Sabine said, they can't so much as explain a sunrise.

    • @jacksonknock1833
      @jacksonknock1833 6 місяців тому +17

      @@russell2952 For real. It always goes like this:
      - "You still don't have a map"
      - "Lmao, have you heard of Gleason's? Do your research!"
      - "None of the distances there seem to correlate with actual real life distances, what's up with that?"
      And then it's either "It's just a representation, not an actual map" or they just ignore you and pretend the conversation never happened.
      Same with model. Never seen a flerf take any conversation to its logical conclusion - they always run away.

    • @cullen3624
      @cullen3624 6 місяців тому +7

      I have a large wall map of the world and new Zealand isn't even it.😂

    • @ZlatnoPeroTV
      @ZlatnoPeroTV 6 місяців тому +5

      Wait, aren't they denying the existence of Australia?

  • @Fraser142
    @Fraser142 4 місяці тому +8

    False information is so dangerous and scary i actually have a friend that believes the earth is flat and i try to show him videos constantly to prove its not
    and he refuses to trust what im showing him thinking that the information has holes in it.Seeing first hand experience its so baffling to witness in person.

    • @ronpapi9539
      @ronpapi9539 4 місяці тому +1

      @@Fraser142 CGI is all you have.Sad!

    • @daddy4934
      @daddy4934 4 місяці тому +4

      ​@@ronpapi9539Provide evidence for that claim.
      Oh wait, you have none.
      Sad story.
      Now where is the accurate FE map, still nothing ?
      I thought so.

    • @insersed6525
      @insersed6525 3 місяці тому

      Your friend has visible observations as evidence of Flat Earth. All you have are images from a company directly controlled by the US government. And we all know how trustworthy the government is.

  • @seanemery6019
    @seanemery6019 6 місяців тому +462

    I met an actual flat earther in 2018 at, of all places, the Grand Canyon. He didn’t even believe in gravity. It was a completely bizarre experience. I was left completely stupefied by the crazy, to be honest.

    • @subject8332
      @subject8332 6 місяців тому +17

      You have been Gish Galloped, my friend!

    • @SabineHossenfelder
      @SabineHossenfelder  6 місяців тому +261

      I once met a creationist who believed the earth is less than 10000 years old. At first I thought he was joking. Similarly bizarre experience!

    • @drgetwrekt869
      @drgetwrekt869 6 місяців тому +32

      and he was floating at the top of the canyon.

    • @ploppyploppy
      @ploppyploppy 6 місяців тому

      Let me guess - they used the word 'theory' completely in opposite to its actual meaning? If I hear 'gravity is only a theory' suggesting it doesn't exist I just stop all communication and move away. These people have *nothing* to add to the world.

    • @SoloRenegade
      @SoloRenegade 6 місяців тому +70

      did you ask him to try jumping across the canyon?

  • @theronwolf3296
    @theronwolf3296 6 місяців тому +342

    I got verbally attacked and blocked after asking a FE how it could be midnight in Tokyo and mid day in NY at the same time.

    • @GusOfTheDorks
      @GusOfTheDorks 6 місяців тому

      I asked someone who believed in the round earth about how we know a vaccine is safe and effective if it hasnt been given the time for proper clinical trials.
      They started yelling at me that I was trying to kill people. I left after they started telling me I should be put against a wall and shot with a gun.

    • @rodmehta5356
      @rodmehta5356 6 місяців тому +32

      Time is fake 😂

    • @rickinielsen1
      @rickinielsen1 6 місяців тому +1

      Tokyo is obviously fake! Japanese people are all in on it!

    • @GusOfTheDorks
      @GusOfTheDorks 6 місяців тому +2

      Oh fun, looks like they deleted my comment.

    • @bjornfeuerbacher5514
      @bjornfeuerbacher5514 6 місяців тому +33

      @@shortgamingmovies2685 How could the sunshine be "local"? If the sun if above NY, why can't its light reach Tokyo?

  • @janthony721
    @janthony721 6 місяців тому +615

    Flat Earthers have nothing to fear but Sphere itself.

    • @roberteatwell6827
      @roberteatwell6827 6 місяців тому +18

      Brilliant pun. Love it. Deserves more recognition.

    • @TheBreenGene
      @TheBreenGene 6 місяців тому +11

      Underrated comment for sure

    • @paulg444
      @paulg444 6 місяців тому +8

      That one is for the ages !!

    • @vibaj16
      @vibaj16 6 місяців тому +2

      @@roberteatwell6827 i mean, it's a _very_ common joke

    • @paulward4268
      @paulward4268 6 місяців тому +3

      janthony721. Magnificent.

  • @richardkalin8184
    @richardkalin8184 5 місяців тому +29

    There's more here than a simple belief. There's a sense of camaraderie, a sense of us versus the world. So many have so much invested in this that they just can't (won't) go back.

    • @ronpapi9539
      @ronpapi9539 5 місяців тому +2

      Once you go Flat you can't go back.

    • @davidmescher2526
      @davidmescher2526 5 місяців тому +1

      ​@@ronpapi9539Not always. In your case, troll, it's because you can't regrow the brain cells you've killed.
      Smarter people can realize that flat Earth isn't consistent with itself, or observable reality.

    • @hadesunderworld4203
      @hadesunderworld4203 5 місяців тому

      Sad really

    • @hadesunderworld4203
      @hadesunderworld4203 5 місяців тому

      They spend their lives chasing a result that is impossible , as if it matters anyways … and it’s insulting to every scientist , physicist , astrologist … that has ever lived ….
      Man ancestors knew this from looking at stars …
      But flerfs don’t get it ….. so Nuh uh … its not true , its pathetic lmfao 😂

    • @ronpapi9539
      @ronpapi9539 5 місяців тому

      @@hadesunderworld4203 So why is it OK to insult our Creator?

  • @RichardNeill01
    @RichardNeill01 6 місяців тому +245

    I always assumed that the flat-earth movement was a very extended joke, where one of the rules was "you aren't supposed to admit it".

    • @acu01136
      @acu01136 6 місяців тому +26

      I am pretty certain that this is the case.

    • @herbertshallcross9775
      @herbertshallcross9775 6 місяців тому +13

      "First Rule of Fight Club" kind of thing.

    • @brianfox771
      @brianfox771 6 місяців тому +70

      I think it started off this way, but then it became a situation where you should never underestimate the human capacity for stupidity.

    • @noumenon6923
      @noumenon6923 6 місяців тому +12

      That's what I've always thought as well,... just a really committed dry humour.

    • @815TypeSirius
      @815TypeSirius 6 місяців тому +12

      First rule of humans: all jokes become real.

  • @passais
    @passais 6 місяців тому +148

    I think part of the attraction is also being part of a select club and feeling smarter than the "sheeple" because you "figured something out" that others haven't.

    • @betaorionis2164
      @betaorionis2164 6 місяців тому

      I think this is the main reason to be a flatearther. It's like a drug which (like all drugs) gives you a pleasurable sensation (to be smarter than the rest), but detaches you from the reality (that the Earth is not flat).
      Also, most flatearthers seem to have had very poor school records and it may have made them resentful against knowledge.

    • @LoneHorizons
      @LoneHorizons 6 місяців тому

      That’s it exactly. Who wants to be successful and accepted in society if society is all based on a lie? So they become a flerfer and feel superior.

    • @robvanderwell5695
      @robvanderwell5695 6 місяців тому +8

      In the same fashion the masses feel superior because they belong to the 'true knowledge incrowd'.

    • @passais
      @passais 6 місяців тому +5

      @@robvanderwell5695 no actually, I was convinced when I made my trip to IO.

    • @Enaiarr
      @Enaiarr 6 місяців тому

      @@robvanderwell5695 But they don't though, do they. For the vast, vast, vast majority of people who know the earth is a globe or that 5G isn't mind control or that lizard people don't exist, it's not a big deal. They don't all gather on online forums to discuss the latest in globe-earth evidence - it's a total non-issue that barely ever gets thought about or brought up.
      The problem that causes flat earthers is the same problem that causes incels and pulls some people into religious cults: it's people with not a whole lot else going on in their life for whom "the earth is secretly flat" fills that void and forms the keystone of their identity.
      Normal well adjusted folk can weather individual beliefs or traits being scrutinised because it's only a small part of their overall personality. For flat earthers it's all they've got, so they take it much harder and are more likely to double-down and get defensive to protect such a core part of their life. It's why flat earthers need to in many cases be deprogrammed like incels and cult members by supporting them to build confidence in other areas of their life so they can safely tackle the lies they were fed from within the flat earth community.

  • @mikotagayuna8494
    @mikotagayuna8494 6 місяців тому +154

    Flat earth prophets know exactly what they are doing. It's not important whether or not they actually believe what they're preaching but it is very important for them that people continue buying their books, going to their conferences and subscribing to their platforms. When confronted, they will double down and claim conspiracy because attacking their beliefs threatens their livelihood, and thus, their perceived right to live comfortably.

    • @mobilephil244
      @mobilephil244 6 місяців тому +18

      It goes way deeper than just their living. Psychologically, conspiracy theories come from the same place as religious fanaticism

    • @devthis5135
      @devthis5135 6 місяців тому +3

      It's so true, and at the same time, so sad...

    • @thstroyur
      @thstroyur 6 місяців тому +2

      "it is very important for them that people continue buying their books, going to their conferences and subscribing to their platforms" Meaning that, in order to be a Flat-Earther, one is obliged to do all those things?

    • @rclaws3230
      @rclaws3230 6 місяців тому

      The commies want their perceived right to live comfortably upheld by everyone else's tax dollars; at least these fools are making people laugh while peddling their nonsense.

    • @arycogito
      @arycogito 6 місяців тому +5

      ​@@thstroyur the more you preach an idea, the more you increase the likelihood of finding someone who accepts it. Not all flat earthers will support the preachers but even if 5% of the supporters do the bare minimum of visiting their dumb seminars, or buying their books for whatever reason, (it most likely stems from a need to socialize and actually interact with someone on their level as most of society is clearly way too intellectually superior compared to them) will make them a fortune

  • @Angarsk100
    @Angarsk100 5 місяців тому +86

    There's 2 kinds of Flatearthers: 1- The ones with a larger shoe size than IQ, and 2- The ones who know it's all nonsense, but make a lot of money out of it.

    • @Matuse
      @Matuse 5 місяців тому +1

      None of them make a lot of money out of it. There's very little money to be had from the people who fall for the flat earth hoax - your intelligence needs to be so low that even minimum wage jobs are a serious challenge, and people like that rarely have much in the way of disposable income. Plus, there aren't very many of them and UA-cam ad revenue is VERY low.

    • @marksprague1280
      @marksprague1280 5 місяців тому +2

      The Flat Earth and the Lunar Landing Denial Cults are each composed of 95% idiots and 5% con men.

    • @KateyWatson
      @KateyWatson 5 місяців тому +5

      My sister has become a conspiracy follower. My son tried to reason with her saying "an eighteen year old wrote that and he thinks it's hilarious that you believe it".
      Older people often trust what they read online, we're used to journalistic integrity.
      We don't always appreciate the way younger people who've grown up with social media treat it.

    • @ronpapi9539
      @ronpapi9539 5 місяців тому

      @@KateyWatson Thanks for confirming FE.

    • @Mrorlgloth
      @Mrorlgloth 5 місяців тому +1

      Which one that because religion said so ?

  • @exokitten
    @exokitten 6 місяців тому +79

    I tried my best to debate a flat earther while remaining respectful. I was unsuccessful at swaying him, but here are my best, easy to digest arguments that anyone facing the same type of situation can use:
    • Ships and airlines use globe coordinates to navigate. Ask a pilot or a captain and they will confirm.
    • If the Earth were flat you would be able to see all mountain ranges with a telescope.
    • Light cannot shine down in an isolated location without being visible to all those on the same plane beneath it. The flat earth map does not align with how light functions.
    • If we were all on a flat surface we would all see the same constellations.

    • @brucetucker4847
      @brucetucker4847 6 місяців тому +7

      The Sun has a lampshade. A lampshade that changes shape with the seasons. Didn't you know?
      (RIP Sci Strike, you are missed but never forgotten)

    • @mcv2178
      @mcv2178 6 місяців тому +2

      I like your mountain range example.

    • @BOO-ii3ni
      @BOO-ii3ni 6 місяців тому

      You are dumber than him for trying to debate about physics with someone that never tried to learn physics.

    • @goodfortunetoyou
      @goodfortunetoyou 6 місяців тому

      Looks somewhat fun.
      1. Using spherical coordinates does not in and of itself imply the earth is a sphere. Indeed, I believe that they can be mapped into the euclidean coordinate system.
      2. There can be fog, and objects obstructing your view. Additionally, there could be an effective render distance.
      3. If light is emitted as if from a flashlight, the light illuminates a cone between the source and the plane. Now, you might argue that the sun is a sphere, and is a point source. However, all we can observe is the 2D dome of the sky, where it presents as a disk.
      4. The world loads in semi-continuous chunks, where each star can be seen a a puncture of the sky-dome (let's call it the firmament or something) and is only visible from chunks illuminated by the star's light cone.

    • @livestock9722
      @livestock9722 6 місяців тому +6

      1 minute of latitude/longitude equals 1 nautical mile (slightly off in Northerly/Southerly airspace due to... well duh?). Pretty handy on aeronautical maps when trying to find coordinates. This would absolutely not work in a flat earth universe.

  • @Scinquisitor
    @Scinquisitor 6 місяців тому +160

    I really recommend the documentary called "behind the curve" about flat-earthers. The funniest moment is when a flat-earth blogger rants about her collegues, who claim she is part of a conspiracy to discredit the flat-earth movement. She talks about how it's unfair when people claim that you are part of conspiracy when you are not, and when they make things up about you. Then for a moment she considers "what if all those scientists I accuse of conspiracy feel the same way"... just then to add "but those guys are in fact conspirators!"

    • @User-yy6xt
      @User-yy6xt 6 місяців тому +3

      It’s made by people who’s goal is to make you think it’s too stoppid to look at and you fell for it.

    • @johnqpublic7608
      @johnqpublic7608 6 місяців тому +14

      @@User-yy6xt
      because it's stupid.

    • @mynamemylastname7179
      @mynamemylastname7179 6 місяців тому +6

      You should watch "the martian" documetry when Nasa sent matt damon to grow potatoes on mars back in 2015. Much better then that Apollo 11 💩 from 1969 😂😂😂😂😂😂😂😂😂😂

    • @User-yy6xt
      @User-yy6xt 6 місяців тому

      @@johnqpublic7608 Yeah it was. It was totally stupid. It had not one thing that was true about the flat earth or flat earthers in there. It was made up garbage designed to keep you all ignorant to what people who see the flat earth see and where they look to see it. They won’t v show you what we see because then you would see it too.

    • @Matuse
      @Matuse 6 місяців тому +3

      @@User-yy6xt By all means, dazzle us with how smart you are. Prove anything about flat earth.

  • @Muritaipet
    @Muritaipet 6 місяців тому +219

    Bob the Science Guy summarised it - "There are two types of Flat Earthers. The ones who believe, and the ones selling them T-shirts"

    • @MyName-tb9oz
      @MyName-tb9oz 6 місяців тому +4

      No, there are also the trolls doing it for the, "lols."
      Years ago when I was on Fecesbook there was a girl on my friends list who I later discovered was a flat-earther. I saw people commenting on her page and I swear some of them were just egging her on to be nasty. I really felt bad for her. It was quite sad and cruel.

    • @richardalvarez2390
      @richardalvarez2390 6 місяців тому +1

      There are also those that were always attacking flat earthers with our NASA facts and as we saw through the many lies, we became flat earthers.

    • @AnirudhTammireddy
      @AnirudhTammireddy 6 місяців тому +1

      @@MyName-tb9oz I'm confused who are the 3rd type of flat earthers? the girl in your story? But she wasn't a troll in your story?

    • @Muritaipet
      @Muritaipet 6 місяців тому +4

      @@MyName-tb9oz LOL @ "fecesbook."
      I agree there's likely a lot of trolls, pretending to be flat earthers.

    • @Muritaipet
      @Muritaipet 6 місяців тому +15

      @@richardalvarez2390 Oh absolutely. I live in New Zealand, and we all have to pretend about Antarctica, and take turns guarding the ice wall.

  • @nagaraworkshop
    @nagaraworkshop 5 місяців тому +17

    It makes me incredibly sad to think that a substantial number of people think that science is just 'made up' or 'bought into'; as if everything is 'a matter of opinion'. Conversations with those people are immensely frustrating bordering on the impossible. When rationality goes, so does safety, as history shows us time and again.

    • @frantaspacek
      @frantaspacek 5 місяців тому +2

      @joenahhas4377 thank you for providing a great example of someone who can't be reasoned with

    • @crazymage9636
      @crazymage9636 5 місяців тому +2

      Just recently everybody on earth was told to trust the science, allot of people injured and got sick anyway for putting their faith in scientists, doctors, govnment pharmacists. I can understand why people think the earth is flat and I don't blame them at all. Somewhere along the line we let them down and now we laugh at them and blame them for being stupid.

    • @frantaspacek
      @frantaspacek 5 місяців тому +5

      ​@@crazymage9636 When did that happen? Did you mean the time where the doctors and researchers did their absolute best to save millions of lives but people still ignored their recommendations because they thought they knew better?
      The only reason why some things didn't make sense is because you only listen to celebrities and politicians, not the actual experts.

    • @crazymage9636
      @crazymage9636 5 місяців тому

      @@frantaspacek celebrities and politicians? Millions saved? Scientists and researchers trying their best? Do you get all your information from your television? Or do you go looking for the answers you want on Google?
      Lol, millions saved! That's honestly too good! 😆 Scientists trying their best! Yeah I wouldn't have minded being at the top of that global pyramid scheme. Get them scared enough and they will turn on their families lol.
      Keep on following the news 👍

    • @frantaspacek
      @frantaspacek 5 місяців тому

      @@crazymage9636 Did your last message contain any actual arguments? I can't see any, maybe you should try again.

  • @magilviamax8346
    @magilviamax8346 6 місяців тому +1016

    I was under the impression that flat earthers were just a bunch of people in search of attention, cause none should be that incompetent. But if Sabine feels the need to talk about it, it really must be worrisome. My faith in humanity is dwindling.

    • @SabineHossenfelder
      @SabineHossenfelder  6 місяців тому +205

      I guess you are right that search for attention is part of it for the people who you see on social media. But there's a larger group of quiet people behind them, the ones who share, lurk, and like. It's also really hard to make headlines with flat earth theories. I think that the attention-seekers are more of the sort who come up with a proof of the Riemann hypothesis or a theory of everything etc, something that plausibly would be front page news.

    • @marcinnawrocki1437
      @marcinnawrocki1437 6 місяців тому +22

      Nah arguing about silly stuff on FE forums is amusment.

    • @sababaratashvili8629
      @sababaratashvili8629 6 місяців тому +39

      @@SabineHossenfelder You underestimate amount of attention seekers. It is combination of attention seekers, stupid people and people who just do it for fun.
      I worry much more about politics and activism in science, which only feeds such "sceptics".

    • @pablov.viteri9345
      @pablov.viteri9345 6 місяців тому +20

      @@SabineHossenfelder Follow the money who founded

    • @donm5354
      @donm5354 6 місяців тому +14

      Sometimes I go on Flat Earth Society forums just to mess with heads of people literally angry that people CLAIM the Earth is FLAT.

  • @timothytumusiime2903
    @timothytumusiime2903 6 місяців тому +256

    The asteroid literally flipping the dinosaurs of into space is just bloody funny 🤣🤣

    • @admiralspandy
      @admiralspandy 6 місяців тому +7

      Yeah, that was hilarious!

    • @JackKnight762
      @JackKnight762 6 місяців тому +1

      not if you're Jim Morrison

    • @dominiccharvet546
      @dominiccharvet546 5 місяців тому

      ua-cam.com/video/WqBNeCl1J4k/v-deo.html

    • @borninvincible
      @borninvincible 5 місяців тому +3

      That one killed me 😂

    • @dominiccharvet546
      @dominiccharvet546 5 місяців тому

      @@borninvincible King James Bible
      The heaven, even the heavens, are the LORD'S: but the earth hath he given to the children of men.

  • @bitphr3ak
    @bitphr3ak 6 місяців тому +272

    The first rule of The Dunning-Kruger Club:
    You don't know you're in The Dunning-Kruger Club!

    • @Azariy0
      @Azariy0 6 місяців тому +9

      At this point anyone trying to find the truth should assume by default they're in the club, even if all evidence points to otherwise.

    • @bitphr3ak
      @bitphr3ak 6 місяців тому +2

      @Hudoi-1 humm, you might want to read up on the Dunning-Kruger effect...because it's not as helpful as you might think, as a truth finding flex.

    • @t16205
      @t16205 6 місяців тому +2

      @@Azariy0 LOL

    • @Rdlprmpf12
      @Rdlprmpf12 6 місяців тому +4

      If you don't know whether you're in The Dunning-Kruger Club, you're not in The Dunning-Kruger Club.

    • @mormatus
      @mormatus 6 місяців тому

      This is hilarious 🤣

  • @Wesley-eu7rn
    @Wesley-eu7rn 3 місяці тому +5

    We had a school teacher who poured water over a ball representing the earth just like this example to explain why water flows downhill. No I'm not joking.

  • @NastarNordmire
    @NastarNordmire 6 місяців тому +161

    One thing that I've seen flat earthers do is find every reason to ignore the findings of their own experiments when they prove that the earth is a globe.

    • @NathanDyer-w1l
      @NathanDyer-w1l 6 місяців тому +30

      “You know, the very powerful and the very stupid have one thing in common. They don’t alter their views to fit the facts. They alter the facts to fit their views.” - The Face of Evil: Part Four (1977)

    • @shadowshatto
      @shadowshatto 6 місяців тому

      I feel like flat earthers are fearful, I think they are scared of the universe and what it means and just how vast and unknowable it can be. My mom is an antivaxxer and yet she was a nurse and a pretty smart lady, but when you let your fear run away you become irrational and I think scientists laughing off and not taking it seriously will only lead to More of this that will be harder to weed out and fix

    • @bob_the_bomb4508
      @bob_the_bomb4508 6 місяців тому +8

      “Interesting…”

    • @davidhollenshead4892
      @davidhollenshead4892 6 місяців тому

      One killed himself with one of his own experiments, if he was actually being honest about being a flat earther...

    • @ronpapi9539
      @ronpapi9539 6 місяців тому

      @@NathanDyer-w1l is. Donald Trump!

  • @demidron.
    @demidron. 6 місяців тому +221

    Every time I asked them why I, in the southern hemisphere, see the stars revolve clockwise around a point in the sky directly south of me, whereas they, in the northern hemisphere, see them revolve anticlockwise around a point in the sky directly north of them, they disappear.

    • @hodgeyhodge8414
      @hodgeyhodge8414 6 місяців тому +10

      Have you actually stared at the sky long enough to independently verify that that's what they do? The sky moves very slowly. I have watched the moon crawl across the sky, but never the sun or the stars. In any case, I think you'd be hard-pressed to find a flat-earther who has travelled to both hemispheres of the earth...

    • @dynamicflashy
      @dynamicflashy 6 місяців тому +85

      @@hodgeyhodge8414 Turn on a camera to record the sky, and then watch it back sped up.

    • @noway905
      @noway905 6 місяців тому +24

      I live in the northern hemisphere and have watched the stars at night for over 60 years and can attest that they rotate clockwise around a fixed point called the north star. The big dipper proves the stars do not "disappear."

    • @w01dnick
      @w01dnick 6 місяців тому +26

      ​​@@hodgeyhodge8414it's not that slow, actually Moon, Sun and stars rotate at almost the same speed, because it's mostly Earth rotation. As for seeing that, you don't even need a telescope. Just remember where stars are at midnight and check hour later. They'll move for about 15°, or 30 Moon's diameter, that is pretty noticeable. With telescope that rotation is a PITA, because you have constantly adjust direction to see planets, stars.
      P.S. 30 diameters - that is near sky equator, closer to the Polar star lesser is difference, but it's still noticeable a lot.

    • @Polit_Burro
      @Polit_Burro 6 місяців тому +5

      There is no "southern hemisphere".

  • @mikekilpatrick5686
    @mikekilpatrick5686 6 місяців тому +115

    Like the saying goes, arguing with a flat earther is like playing chess with a pigeon. it knocks the pieces over, craps on the board, and flies back to its flock to claim victory

    • @scotttaylor9133
      @scotttaylor9133 6 місяців тому

      Ahh, the unwashed masses, they are so disgusting, aren't they?

    • @teacherella1338
      @teacherella1338 6 місяців тому +8

      Sounds like playing chess with Trump 😂

    • @User-yy6xt
      @User-yy6xt 6 місяців тому

      We don’t argue with people like you.

    • @ThatBonsaipanda
      @ThatBonsaipanda 6 місяців тому +4

      One variation that I like goes ".. and strut around like they won the game."

    • @User-yy6xt
      @User-yy6xt 6 місяців тому

      @@ThatBonsaipanda you people are worthless

  • @JeremyHickson
    @JeremyHickson Місяць тому +1

    Asked a flat earther if they believed in magnifying glasses. They said yes. I said come over tonight and I will show you with my telescope that planets are spherical. Silence from them.

  • @MrDominex
    @MrDominex 6 місяців тому +336

    Flat Earthers don't really care what shape the Earth is, they just want to play a game of one-upmanship by adopting an absurd opinion and then defending it against all reason like a passive-aggressive jackass.

    • @rivershen8199
      @rivershen8199 6 місяців тому +20

      Flat Earthers are the type of people who won debating competitions in school no matter how ridiculous the position they had to defend.

    • @miloszforman6270
      @miloszforman6270 6 місяців тому +3

      @MrDominex
      Most probably you're right, but what on Earth drives Hossenfelder to seriously engage with such hoaxes?

    • @uNiels_Heart
      @uNiels_Heart 6 місяців тому

      @@miloszforman6270 Because flat earthers have an impact on society, especially if their number is on the rise

    • @TesterAnimal1
      @TesterAnimal1 6 місяців тому +9

      Some. Not all.
      Many vehemently believe it.

    • @mikeguilmette776
      @mikeguilmette776 6 місяців тому

      @@miloszforman6270 Right now, many schools are teaching that boys can be girls, so it's not much of a stretch to think that flat earth "science" could end up in the curriculum soon . . .

  • @nikl.astrophoto
    @nikl.astrophoto 6 місяців тому +58

    As someone into astrophotography, even we get accused of lying for simply posting images of our hobby. I've been called a CIA asset by some guys on TikTok. Flat earth is like a collective paranoid schizophrenia.

    • @johnkean6852
      @johnkean6852 6 місяців тому

      ASTROPHOTOGRAPHY:
      Connecting to Nasa CGI images of space and convincing yourself they're REAL. Keep taking the pills.

    • @whichgodofthousandsmeansno5306
      @whichgodofthousandsmeansno5306 6 місяців тому

      I am in the satellite radio technologies industry. According to flat earthers I am in on the vast conspiracy to hide the shape literally 99.9999% of people don't care about, or I am also a sheeple being fooled.

    • @whichgodofthousandsmeansno5306
      @whichgodofthousandsmeansno5306 6 місяців тому +1

    • @lobban2
      @lobban2 6 місяців тому +8

      What I want to know is why they believe what they believe. What is the point of lying about the shape of the earth?

    • @mkx9095
      @mkx9095 6 місяців тому

      ua-cam.com/video/qEaHjPF47_E/v-deo.htmlsi=CkC3Hh1CvfdJm9z1

  • @nosferatu5500
    @nosferatu5500 6 місяців тому +137

    i think logic classes should be mandatory in school. Its fundamental for all subjects, mathematical formalism and later in life.

    • @drgetwrekt869
      @drgetwrekt869 6 місяців тому +5

      school and all is mandatory since 200 years or so (even more). its not about schools. the problem is society as a whole.

    • @SoloRenegade
      @SoloRenegade 6 місяців тому +10

      Philosophy classes. The basis of all science and the rules of debate are taught in Philosophy. There is a reason PhD is the most widely know Doctoral degree (PhD = Doctorate of Philosophy).

    • @edene.4870
      @edene.4870 6 місяців тому

      It *is* mandatory. Logic and critical thinking are an essential part of classes like maths, physics, chemistry, history, and most importantly literature analysis. And these classes are all pretty much core classes in most civilised countries.
      If you take a look, most flat earthers are either US Americans or people who are from another country but have had little education and a lot of exposure to US centric media and social media.
      And an even closer look will reveal that these US Americans are from states where education has been whittled down and outright butchered.
      This is not a coincidence.

    • @juimymary9951
      @juimymary9951 6 місяців тому

      Absolutely

    • @joansparky4439
      @joansparky4439 6 місяців тому

      not even basic economics is based on logic.. which is why flat earthers have become a phenomenon in the first place.

  • @vivektulja4516
    @vivektulja4516 5 місяців тому +11

    I am a spacecraft dynamics and control engineer. I spent many decades working on NASA and US DoD programs. I recently came across a suggestion that flat-earthers should be sent to space to see for themselves that the earth is round. Since then, I have promptly converted to flat-eartherism in the hope that I will get a free ticket to space. 😀😀😀

    • @ultrafun2227
      @ultrafun2227 5 місяців тому

      All flat-earthers just gonna say it's CGI or something. And even if one believes, all others are gonna say people brainwashed the person

  • @terrancat
    @terrancat 6 місяців тому +123

    The one flat earther I talked to believed every planet was spherical EXCEPT Earth. I was done. I can't even.

    • @saldownik
      @saldownik 6 місяців тому +3

      It seems like the lady has jus started to discover the truth.

    • @ThomasKundera
      @ThomasKundera 6 місяців тому +11

      @@saldownik : That flerfs are dumb?

    • @spiderprime
      @spiderprime 6 місяців тому +8

      Some don't even believe there is space and other planets and that we're the only thing to exist.

    • @ronpapi9539
      @ronpapi9539 6 місяців тому +1

      @@spiderprime That's me.

    • @GiveMeSpaceTravel-bg8td
      @GiveMeSpaceTravel-bg8td 6 місяців тому +2

      Yes there seems to be one flat earth theory per flat earther. At least all us globeheads accept more or less the same rubbish.

  • @SomeMorganSomewhere
    @SomeMorganSomewhere 6 місяців тому +79

    The irony is that I've some vague recollection that Flat Earth Society was originally created by people who weren't ACTUALLY flat-earthers, it was more like the Society for Creative Anachronism, little did they know they'd get overtaken by the actual flat-earthers...

    • @worsethanhitlerpt.2539
      @worsethanhitlerpt.2539 6 місяців тому

      People who just like to argue for no reason like teenagers and Woke college students

    • @jal051
      @jal051 6 місяців тому +4

      Yeah. The first video Sabine made was about that. She, in fact, defended the cynical aspect of the original flat Earth movement.

    • @Justwantahover
      @Justwantahover 6 місяців тому

      There are a fair few poes, who just pose as flerths, for money and "fame". If any flerth who shows any hint of intelligence, most probably aren't flat earthers. And the dummies (who are genuine flerths) just follow. The poes might write a book called "Flat Earth for Dunmies". 😅

    • @User-yy6xt
      @User-yy6xt 6 місяців тому

      Other way around DA

    • @johnkean6852
      @johnkean6852 6 місяців тому +2

      The flat earth society is unrepresentative of modern flat earth theory

  • @rocketscience4516
    @rocketscience4516 6 місяців тому +204

    Funny how they trust in science when they go out to buy a mobile phone, or pay for internet access. Or buy a TV. Or... (list goes on and on).

    • @Thomas-gk42
      @Thomas-gk42 6 місяців тому +10

      Absolutely right!

    • @daniellove162
      @daniellove162 6 місяців тому +12

      Sometimes people will cry “TRUST IN SCIENCE” in lieu of saying “DON’T QUESTION OUR NARRATIVE”. Scientists throughout history have questioned currently held science to refine science.
      Also, for years people thought Newtonian physics was the final destination and the some dared to do science and discovered it was merely the surface.

    • @juimymary9951
      @juimymary9951 6 місяців тому

      I think it's mostly that they ignore that all branches of science are interconnected to some extent
      To them the shape of the planet and the function of an electronic device aren't related and therefore to them there is not even the cognitive dissonance.

    • @Bill_Bo
      @Bill_Bo 6 місяців тому

      What they do is separate science from technology and pretend they have nothing to do with each other in order to avoid the inevitable cognitive dissonance.

    • @drgetwrekt869
      @drgetwrekt869 6 місяців тому +11

      its because they dont understand how these things work (well like 99.99% of people actually).

  • @celiacresswell6909
    @celiacresswell6909 Місяць тому

    Observing a phenomenon like flat earth theory and thinking about what’s really going on shows a properly curious mind. Love it

    • @Glasschin2.0
      @Glasschin2.0 Місяць тому +1

      Flat earth isn’t a theory , they don’t have a working modern.

  • @whichgodofthousandsmeansno5306
    @whichgodofthousandsmeansno5306 6 місяців тому +126

    There is a VERY wide line between healthy skepticism and reality denial. Flat earthers don't see any line at all.

    • @ronpapi9539
      @ronpapi9539 6 місяців тому +6

      Only Flat Lines!ha ha

    • @eindbaaz3815
      @eindbaaz3815 6 місяців тому

      @@ronpapi9539 I wish they flatlined

    • @PartlyXenon
      @PartlyXenon 6 місяців тому

      They see a 3D line!

    • @alkaholic4848
      @alkaholic4848 6 місяців тому

      They see the line, but don't believe it's really a line. It's nasa pretending there is a line.

    • @ronpapi9539
      @ronpapi9539 6 місяців тому

      @@PartlyXenon No Curved line noted as usual.

  • @baarni
    @baarni 6 місяців тому +232

    The big misconception is that flat earthers are honestly trying to figure out whether the earth is flat or not. They are not and will dismiss any evidence that shows anything that contradicts their beliefs…

    • @yad-thaddag
      @yad-thaddag 6 місяців тому +33

      Not very different from creationists.

    • @2bfrank657
      @2bfrank657 6 місяців тому +14

      This. She pointed out the lack of scientific education, but flat earthers can be explained even more simply than that - confirmation bias.

    • @Raphael4722
      @Raphael4722 6 місяців тому

      Honestly who cares? By the law of large numbers, you are never going get 100% people to accept something. It's not a lack of education, it's a matter of parts of science being counterintuitive and many people have a limit on how much they are willing to oppose their intuition.
      Flat Earth is the most extreme case of this. Evolution deniers exist because it's hard to have intuition for something that takes millions of years. Vaccine deniers exist because of the intuition that injecting an unknown substance into your body is dangerous. Viewers of this channel will ridicule all of these.
      However let's not forget that there is no scientific evidence for free will, while there is plenty evidence for determinism, yet there are most likely people in this comment section who consider themselves "scientifically minded" but cannot go against their intuition when it comes to free will.

    • @Ben-pd2bx
      @Ben-pd2bx 6 місяців тому +28

      Right. It's not remotely about what's true. This stuff meets a psychological need. Whether it's flat earth, QAnon, creationism, Scientology, or gender ideology, arriving at the facts is not the point. Such belief systems are not information that "out there" that these people have considered, perceived and understood - they are ideologies that they have adopted and *identified with*, and that's a big difference. The truth doesn't confer an identity. Ideology does. These kinds of beliefs give people membership in a core group of believers who know the Ordained Truth, while everyone outside that group is thought a fool, a sinner, a bigot, an infidel, a sheeple, etcetera. It's tribal and evolutionary. The people I know who go for this stuff are always insecure, and often have very deep traumatic wounds from early life. They want to belong. They want to be special. They want to feel empowered. The want to feel they have an enemy to oppose. They want to define themselves in relation to all these things. To present them with evidence that their claims are false is not to dissuade them. It is to further radicalise them. The reason is two fold: 1. All criticism of their ideas is perceived as an attack on their identity and personhood. 2. All criticism of their ideas is evidence their ideas are correct, because the "sheeple" or whoever, are trying to defeat the truth. The reason to confront these people and their ideas is not to dissuade them, unless you're able to actually involve them in long term deprogramming. The reason to confront these ideas is so that others who are yet to be indoctrinated and may be watching may be spared the same fate. Meanwhile, if you really do want to help someone who has fallen prey to these kinds of ideologies, the only thing that will do it isn't to confront them with facts, but to engage them in relationship. Rarely, this will work. Remember, it's all about identification. If they start identifying with people who believe things that are true, they are likely to change their beliefs. People believe what their tribe believes more often than not.

    • @jtjames79
      @jtjames79 6 місяців тому +7

      Flat Earth debunkers will never admit it's just a big troll.
      Sufficiently advanced incompetence is indistinguishable from malice.
      It's ridiculous how many people will accept incompetence as an excuse just because it makes them feel smarter for themselves.

  • @BoBoZoBo
    @BoBoZoBo 6 місяців тому +74

    I have a private pilot and space enthusiast and my father-in-law in Iowa talk about aviation and space all the time for the first 10 years of our relationship.
    One day he got a new smartphone and I introduced him to UA-cam. Told him I had really good videos on space flight and aviation.
    6 months later he became a complete flat earther. True fucking story.
    One day I had asked him if he had seen the SpaceX launch and then he told me it was bulshit it took me a good full hour to realize that he wasn't joking around with me and that he had seriously changed his mind about everything.
    Thank you internet.

    • @raypeery6317
      @raypeery6317 6 місяців тому

      Cool story bro. Variation 11,075 on the same story.
      Globetards have no imagination, just parrots and sheep.

    • @ronpapi9539
      @ronpapi9539 6 місяців тому +3

      All retired Pilots come forward with FE Truth, so as not to lose their retirement benefits by exposing the Lie of a Globe

    • @parody_bear_mike
      @parody_bear_mike 6 місяців тому +3

      Bruce McCandless made history performing a spacewalk during STS-41B with no lifelines Bruce's rotation 1,000 mph
      Bruce's orbit around the sun 66,600 mph
      Sun's orbit around the galaxy 514,000 mph
      Galaxy traveing thru space 3,600,000 mph
      not felling any of it Priceless? or MindLess!!

    • @grahvis
      @grahvis 6 місяців тому +22

      @@parody_bear_mike .
      The human body has no mechanism for detecting constant, steady movement, only a change in speed or direction over a certain amount.

    • @distortionhead37
      @distortionhead37 6 місяців тому

      Much ouff!

  • @BobDiaz123
    @BobDiaz123 4 місяці тому +10

    In a funny way, I have to thank the Flat Earth People, because they challenged me to prove the Earth is not flat. So I thought up an experiment to prove whether it's flat or not. It was fun to go through the steps to prove that the results proved the Earth is NOT flat.

    • @MsCaleb79
      @MsCaleb79 4 місяці тому

      How were you able to prove? Did you go to the moon too? You can buy a ticket from me If you like, its discount now, only 2000000$

    • @ronpapi9539
      @ronpapi9539 4 місяці тому

      @@BobDiaz123 Waiting............

    • @BobDiaz123
      @BobDiaz123 4 місяці тому +6

      @@MsCaleb79 Are you a flat Earth believer? Because your comment is 100% stupid. I said NOTHING about going to the moon, so why suggest I said it?

    • @BobDiaz123
      @BobDiaz123 4 місяці тому +3

      @@ronpapi9539 Waiting for what?

    • @ronpapi9539
      @ronpapi9539 4 місяці тому

      @@BobDiaz123 All talk ,no walk.No Proof!

  • @wonderpope
    @wonderpope 6 місяців тому +211

    My main problem with flat earthers is that they give a bad name to skeptical people in general. The push by authorities to censor social media because of "misinformation"/"desinformation"/"malinformation" is getting stronger. This starts silencing anyone who might have good reasons to counter official narratives, because you are put in the same basket as flat earhters.

    • @decafjava8565
      @decafjava8565 6 місяців тому +14

      Very true.

    • @alchobum
      @alchobum 6 місяців тому

      The censorus work hard to create that link. Only a flat earther conspiracy theorist would even dare say higher taxes and not being allowed to drive on weekends are bad.

    • @xintophotography9848
      @xintophotography9848 6 місяців тому +36

      Conspiracy theories in general have so stretched the concept of skepticism that it no longer means anything. Science should invent some new word to represent healthy and informed skepticism.

    • @1238a8
      @1238a8 6 місяців тому +3

      @@xintophotography9848 As if worldwide bullexcretes is sanely explainable without conspiracy theories.
      However, conspiracy theories could have different quality.

    • @emildavidsen1404
      @emildavidsen1404 6 місяців тому

      Im gonna second what another has already commented, flerfs are "just" one of the many conspiracy theories which has flurished over the last couple of decades. We humans have some catching up to do regarding our social and cognative abilities if we are to keep pace with our information tech. Using history as a guide, I'd say there is a decent chance/risk that many wars will need to happen before we take this seriusly enough.

  • @diedertspijkerboer
    @diedertspijkerboer 6 місяців тому +51

    I've personally met a flat earther and someone else who thought that making math-inspired drawings was the same as doing maths.
    The problem in both cases was that they believed that they could figure this stuff out on their own.
    The flat earther read stuff online and was simply unable to detect bad physics because he didn't know physics.
    In the process, he was ruining his life by forcing his views on others.
    I think that the reason why people become flat earthers is that, in their own mind, they've become scientists, while previously, they held or failed at jobs with much less social status.

    • @ronpapi9539
      @ronpapi9539 6 місяців тому

      No they're debunking scientists who are unable to decipher FE Truth and will do anything to protect their social standing with falsehoods .

    • @charlesmiller8107
      @charlesmiller8107 6 місяців тому +4

      My favorite comment is "do your own research". lol It's always a red flag and the crux of their problem.

    • @ronpapi9539
      @ronpapi9539 6 місяців тому

      @@charlesmiller8107 Don't they know that Globeheads do not research or take orders.

    • @ronpapi9539
      @ronpapi9539 6 місяців тому

      @@charlesmiller8107 So researching things that you know Squat about is a Red Flag?FE Prevails!

    • @ronpapi9539
      @ronpapi9539 6 місяців тому

      The JWST has just proved Physics wrong.Read all about it Globeheads

  • @sieglindedeutersbotter1251
    @sieglindedeutersbotter1251 6 місяців тому +68

    I'm sorry, but the flat Earth being hit a meteor, tilting and thus tossing the dinosaurs into space was just hilarious! 🤣

    • @gamingcreatesworlddd2425
      @gamingcreatesworlddd2425 6 місяців тому +3

      😂😂😂😂😂

    • @whichgodofthousandsmeansno5306
      @whichgodofthousandsmeansno5306 6 місяців тому +2

      I thought flat earthers don't believe in space even though that's all we see for pretty much infinity.

    • @lettersquash
      @lettersquash 6 місяців тому +3

      That's why they evolved into birds.

    • @StormsparkPegasus
      @StormsparkPegasus 6 місяців тому +1

      That was actually from a parody video making fun of flat earthers. But yeah.

    • @Fondushkie
      @Fondushkie Місяць тому

      It is now renamed the "flat trampoline" theory.

  • @georgelewis3047
    @georgelewis3047 5 місяців тому +2

    The problem is not lack of intelligence or knowledge Sabine. It drives scientists and universities mad, but they misunderstand this is a socio-political problem, not an education problem.

  • @eunomiac
    @eunomiac 6 місяців тому +151

    The scariest part of this video is the graph showing how much of an impact UA-cam's "algorithm" has on how our civilization thinks.

    • @getsideways7257
      @getsideways7257 6 місяців тому +16

      And if that wasn't scary enough, you need to also remember that the favor is shifting towards TikTok these days...

    • @ASlickNamedPimpback
      @ASlickNamedPimpback 6 місяців тому +1

      its just google graphs

    • @volkerengels5298
      @volkerengels5298 6 місяців тому +2

      The algorithm is aligned with: "'needs' of modern society" It doesn't cause those 'needs'

    • @mementomori29231
      @mementomori29231 6 місяців тому +1

      The movie Idiocracy is becoming real

    • @zyeborm
      @zyeborm 6 місяців тому

      ​@@volkerengels5298nah it's aligned with making Google more money, they changed it because they realised they can make more money in the long term if they allow a long term to exist and don't bring about a new dark age.

  • @TylerAult
    @TylerAult 6 місяців тому +133

    "They're trying to figure out how nature works" (6:27) -- No, they're not. I know this is a segway to the ad but this is the whole problem. Flat Earthers begin with a conclusion and then try to justify it, much like religious people. They aren't interested in observation except to selectively prop up their pre-existing assertion.

    • @MarcPagan
      @MarcPagan 6 місяців тому

      Leftists, Democratic Party voters in the USA, are on par with Flat Earthers
      ......for their impressive immunity to facts, science, and reality.

    • @michaelsommers2356
      @michaelsommers2356 6 місяців тому +14

      A segway is a scooter. A segue, pronounced the same way, as two syllables, is a transition.

    • @rahantr1
      @rahantr1 6 місяців тому +1

      Oh come on, cut them some slack. Every scientific field has some p-hacking issues.

    • @deathsinger1192
      @deathsinger1192 6 місяців тому +3

      except, religious people don't necessarily ignore proof, you cannot proof that god doesn't exist, that doesn't proof his existence either, but you can disprove flat earth quite easily

    • @xintophotography9848
      @xintophotography9848 6 місяців тому +7

      @@deathsinger1192religious people believe nonsense proofs and nonsense logic are actually proofs based on actual logic. Also, most atheists have concluded that religions are dumb and/or that gods are incoherent nonsense. It is rare for them to argue that gods are provably nonexistent (and indeed, religious cosmologies are so ill defined that it isn’t clear what is supposed to be disproven).

  • @SinclairA
    @SinclairA 6 місяців тому +78

    "They are more confident than the average person ..." that's Dunning-Kruger for you there.

    • @catcatcatcatcatcatcatcatcatca
      @catcatcatcatcatcatcatcatcatca 6 місяців тому +13

      It’s not Dunning-Kruger. The effect is often misrepresented.
      In the study, the people with little knowledge still correctly identified they had less knowledge then the experts, they just wastly underestimated the information gap, as they weren’t even aware of much of the knowledge the experts knew.
      The experts in turn overestimated the knowledge the average people had. It’s not that they doubted themselves or weren’t aware of their position as an expert.
      Flat earthers aren’t just more confident in their knowledge, they flat out think the experts are wrong or lying. They aren’t just unaware of the knowledge gap, but believe its just filled with lies and deception.

    • @HolyMith
      @HolyMith 6 місяців тому +2

      ​@@catcatcatcatcatcatcatcatcatcathank you for clarifying that for me, I wasn't aware that was the study that was actually done.

    • @DarkShroom
      @DarkShroom 6 місяців тому

      @@catcatcatcatcatcatcatcatcatca "The experts in turn overestimated the knowledge the average people had"
      -i don't think you have any evidence of that claim otherwie you would have probabally said it, in my experience they are confident in their own reasoning and think the experts are duped, if this is because they are unable to grasp basic science, as most of us judge, then it's technically the Dunning-Kruger effect just i guess i'm tired of people using it when arguing with one another, which is maybe why Sabine didn't mention it

    • @faithismespeaks6848
      @faithismespeaks6848 5 місяців тому

      @SinclairA, I was wondering when one of you liberal thinkers was going to use the Dunning Kruger thing. I could use the cognitive dissonance thing on you but you probably wouldn't grasp that either. The DK statement became almost as popular as your cat rolling all the things off the edge of the Earth. The problem with most BAAL worshipers is you are incapable of being honest, so you resort to smearing people instead of actually looking at the real evidence. I bet you have never even looked at any evidence, or considered why science would create a lie so big nobody could imagine it. I can say honestly I don't know the exact model, I can only state it is NOT what they say it is. Yes everything else is moving but we aren't, it appears to be like a clock, a divine construct. I don't think they will ever really go to some distant planet, besides what would be the point if the exact same group of mask holes were in charge. I do believe the only thing they really sent to so called "space" were people's imaginations. Which easily explains all the science fiction programming in movies, and all this "alien" BS.

  • @clayz1
    @clayz1 5 місяців тому +1

    3:35 Love the bouncing moon animation. Excellent flat earther try at rationalizing orbits.

  • @chrisbullard5901
    @chrisbullard5901 6 місяців тому +106

    I knew a flat earther who tried to explain how complicated the airline pilots had to fly these circuitous routes to “simulate” the Earth being round.
    But why would airlines spend so much more money if they could instead fly their planes in a straight line?

    • @drgetwrekt869
      @drgetwrekt869 6 місяців тому

      nevermind the stupidity of science-deniers

    • @tarunyadav3567
      @tarunyadav3567 6 місяців тому

      ​@@Toxicpoolofreekingmascul-lj4ydto sell more globes xd

    • @RickinICT
      @RickinICT 6 місяців тому +24

      @@Toxicpoolofreekingmascul-lj4yd They'll probably just tell you it's so they can spread the chemtrails further! 😂😂

    • @jaimeduncan6167
      @jaimeduncan6167 6 місяців тому

      For the same reason they pay a woman that just have a baby even when she is not working: the government forces them (great in the case of the woman). That is why Dr. Hossenfelder's type of argument: see this works, is more powerful.

    • @steve112285
      @steve112285 6 місяців тому

      Jet fuel costing money is another lie of the global conspiracy. They really use special Tesla tech that's been suppressed for a century, providing free unlimited power. Or something.

  • @UnMoored_
    @UnMoored_ 6 місяців тому +66

    These people are not essentially crazy, but they were left behind during the critical mental development during childhood which left their ability to reason and conceptionally represent reality with sufficient fidelity as to participate constructively within society. This creates a profound sense of incompetency and compromised social identity which motivates them to join groups which are susceptible to harmful conspiracy theories.

    • @duanecarroll8255
      @duanecarroll8255 6 місяців тому +4

      Otherwise known as HOME SCHOOLED!

    • @Nefville
      @Nefville 6 місяців тому +1

      While I assume I would agree with the intent of what you are attempting to say, I'll take ranch on my word salad.

    • @juimymary9951
      @juimymary9951 6 місяців тому +3

      @@duanecarroll8255 Well...considering what the public school system is like in places such as the US...

    • @eh1702
      @eh1702 6 місяців тому

      There is some research to show that people who believe a lot of conspiracy theories are more fearful than general. And also not generally of high educational attainment. The feeling of being bewildered by a fast changing world, by social and technological change, being clobbered by scary phenomena that seem to come out of nowhere (like economic recession) - all of this resolves once you are “in” on the secret of the lizard people or whatever.
      It is a more inchoate, ad hoc way of dealing with Big-Scary-Hard-To-Get-A-Grip Reality than the more conscious religious injunction to accept the will of God whether or not you understand it. It has the comforting advantage of feeling like you do understand it. Plus it gives you the fantastic feeling of at last being smart- smarter than the smart kids you went to high-school with.

    • @jflaplaylistchannelunoffic3951
      @jflaplaylistchannelunoffic3951 6 місяців тому +6

      @@duanecarroll8255 I would argue that home schoolers are less prone to become flat earthers, since during home schooling one has far more opportunity to think things through.

  • @itchyomalley
    @itchyomalley 6 місяців тому +19

    You can't reason someone out of something they didn't reason themselves into. My brother's a flat earther (among other things) He's been dismissed by his family and friends for so long, he seeks out like minded individuals and lives among them now.

    • @mkx9095
      @mkx9095 6 місяців тому

      ua-cam.com/video/qEaHjPF47_E/v-deo.htmlsi=CkC3Hh1CvfdJm9z1

    • @chetb2593
      @chetb2593 2 місяці тому

      Yeah, people like that...and I'm sorry for your family...seek out echo chambers rather than face cognitive dissonance.

  • @kacpermalina308
    @kacpermalina308 4 місяці тому +1

    Its even worse, there are 3 versions: Riding on giant turtle, disk in space, and dome witch bottom as earth. Lack of consistency.

  • @eighteenin78
    @eighteenin78 6 місяців тому +26

    Never could I ever get an FEer to explain how the stars rotate in a clockwise direction around the South Celestial Pole.

    • @Globeisahoax
      @Globeisahoax 6 місяців тому

      Is south celestial pole located at the bottom of the globe?

    • @eighteenin78
      @eighteenin78 6 місяців тому +2

      @@Globeisahoax No it is not.

    • @seanmchugh2709
      @seanmchugh2709 6 місяців тому +5

      Depends on what you arbitrarily call 'up'. In any case, your question is a red herring. The opposite rotation, with respect to the observer, cannot occur with a space pizza and star dome, regardless of observer location.

    • @mleise8292
      @mleise8292 6 місяців тому +3

      @@Globeisahoax How does the sun rise to the South of Perth, Australia in December if it cannot go beyond the tropics?
      Now you may think, "ha ha, as if it was so easy to debunk flat earth", but it is. Grifters like David Weiss or Witsit Gets It and all the others would just withhold such knowledge from you so they can continuously bank on your support.

    • @kevin7410
      @kevin7410 6 місяців тому +2

      Easy, the stars are just little holes poked through the firmament!!!1!

  • @taWay21
    @taWay21 6 місяців тому +26

    The scariest thing is there seems to be a growing reality gulf between folks with common sense and critical thinking skills, and folks who just consume everything they see on their phone screen.

    • @YellowKing1986
      @YellowKing1986 6 місяців тому +4

      The population of flat earthers is utterly insignificant. It's like a certain group of people who think they are not who they've been born as. Its a tiny fraction of people and yet we are expected to accomodate it and have the one correct opinion on it. Personally I don't think they matter that much. Let people be wrong. The only reason you know they exist is because it's a click inducing topic. So dumb you just cant help but be fascinated by it. In reality its just a drop in a bucket.

    • @declandougan7243
      @declandougan7243 6 місяців тому +3

      @@YellowKing1986We are not expected to accomodate flat earthers. They are flat out wrong. We should be expected to accommodate transgender individuals, because that’s not about belief it’s about survival and wellbeing.

    • @GusOfTheDorks
      @GusOfTheDorks 6 місяців тому +4

      You know, maybe saying this would mean something if we didnt just spend multiple years of scientists and the public regurgitating whatever their phones and TV screens said about covid.

    • @YellowKing1986
      @YellowKing1986 6 місяців тому +2

      @@declandougan7243 But we are expected to accomodate other cultist believers, like transhumanist ideas. It's interesting about why is that the case with some, and not with others. Why is it that so many people who aren't part of their weird niche community are thinking about, talking about and making videos and consuming videos about it? It's a curiosity. It's weird adn bizzare thing you notice because it stands out. It doesn't tell you anything interesting about people as whole. Other than that some people are just into some weirdness. And it has no impact on your life, if you don't let it happen.

    • @YellowKing1986
      @YellowKing1986 6 місяців тому +2

      @@GusOfTheDorks Exactly, the term "conspiracy theory" or "misinformation" lacks any substance. It's not saying anything about the quality or validity of information.

  • @scollyb
    @scollyb 6 місяців тому +46

    The thing that really amazes me is that the rise in cheap drones hasn't killed flat earth. You literally have a machine where you can move the horizon back and forth at will

    • @osmosisjones4912
      @osmosisjones4912 6 місяців тому +2

      You can test curvature of the ground why towers get shorter before They get smaller Tower . Traffic lights behind other traffic lights are visible

    • @M_SC
      @M_SC 6 місяців тому +13

      You don’t understand psychology, which I don’t mean as an insult. It’s not about physical facts. It’s about emotions

    • @Llortnerof
      @Llortnerof 6 місяців тому +7

      These people will literally refuse to accept reality if it doesn't fit their preconceived notions.
      Not that reality gives a damn either way.

    • @thorwaldjohanson2526
      @thorwaldjohanson2526 6 місяців тому +2

      It's usually people who believe in other conspiracies, have distrust of the government and anything they don't understand. Being part of a group and having an external reason why things are bad can be comforting to people.

    • @matthewedwards9423
      @matthewedwards9423 6 місяців тому +6

      Drones are in on it.

  • @craigbrown2952
    @craigbrown2952 5 місяців тому +19

    Gene Wilder says it best when he explains to Clevon Little, "You know..........morons."

  • @MrEW1985
    @MrEW1985 6 місяців тому +120

    I just had the biggest laugh when the Flat Earth society claimed that it had members all around the globe.

    • @gsmollin2
      @gsmollin2 6 місяців тому

      Really? Now THAT is irony!

    • @richardalvarez2390
      @richardalvarez2390 6 місяців тому

      Flat earth Society is controlled opposition. Flat earthers do not take that statement seriously. As being around the world is bogus

    • @richardalvarez2390
      @richardalvarez2390 6 місяців тому

      Let's not forget, there is a 3 hour testimony of pilots and pilot instructors admitting the earth is flat, on UA-cam

    • @wiredforstereo
      @wiredforstereo 6 місяців тому

      So effing cliche.

    • @technolus5742
      @technolus5742 6 місяців тому

      ​@@acmhfmggruLmao no, they flat out deny any evidence no matter how direct and accessible no matter if it literally disproves their own proposed experiments.
      There is skepticism, and denialism. They fall on the blatant denialism side.

  • @radiobabylon
    @radiobabylon 6 місяців тому +83

    never underestimate human stupidity. i am constantly thinking ive seen its limit, and am constantly surprised how wrong i was.

    • @Llortnerof
      @Llortnerof 6 місяців тому +10

      Two things are infinite: The universe and human stupidity. And i'm not sure about the former.
      - supposedly Albert Einstein

    • @normangensler7380
      @normangensler7380 6 місяців тому +1

      Makes you think that Satan himself roams the entire earth messing things up, doesn't it? Now that makes more sense.

    • @szolanek
      @szolanek 6 місяців тому

      Agree. They tried hard many times to infect a healthy person with a virus and never succeeded. They never isolated one. Still, we live in the age of viruses.
      Also, we went almost extint of low CO2 levels. We managed to pull it back a bit. Still needed more for healthy plant life, but they don't want undeveloped countries to develop, so they lie about climate change. Only the night temperatures riser in cities, as they developed.
      Also, the US has 800 military bases around the world. Russia has one, therefore they want to take over the planet.
      Also, Israel collected all weapons from the kibuces a month before okt 7 around Gaza, shut down the security systems, responded in 7 hours, instead of 15 minutes with chopters, and killed about 1000 of their own, but they were attacked "by surprise" and from self defense they can exploit the gas-and oilfields offshore Gaza. If you criticize them you are antisemitic, while Israelis are European and Palestinians are semitic indeed.
      Yeah, I have to agree with you.

    • @haqvor
      @haqvor 6 місяців тому +3

      @@normangensler7380 except that introducing such a being into the equation doesn't pass the test of Occams razor. The existence of supernatural beings is neither a necessary nor required condition to explain the observed phenomena, human shortcomings is more than enough. I would instead argue the opposite, the human tendency for religious believes, and with that an accepted lack of critical thinking, is at the center of all conspiracy theories.
      Humans are not much more than a glorified chimpanzee after all.

    • @combatepistemologist8382
      @combatepistemologist8382 6 місяців тому +4

      "Think of how stupid the average person is, and realize half of them are stupider than that." - George Carlin

  • @angryoldcanadian3905
    @angryoldcanadian3905 6 місяців тому +107

    I work with a flat earther and there is no amount of evidence he will accept. My theory is that these people think that they are 'special' because only they and a few others know 'the truth'. This is important because most of them have done nothing special in their lives and this makes them feel good about themselves.

    • @pnichols6500
      @pnichols6500 6 місяців тому +1

      Just like the protesters right now, grasping at relevance.

    • @ddd7254
      @ddd7254 6 місяців тому +2

      @@pnichols6500 They're protesting, that's doing something relevant. The Pro-Palestine protesters for example are all over the news and internet gaining more and more sympathy and attention for their cause.

    • @pnichols6500
      @pnichols6500 6 місяців тому

      @@ddd7254 Yes because supporting a group that would murder them is so brilliant 🙄.

    • @Mike-zs2rc
      @Mike-zs2rc 6 місяців тому +1

      Do they site Terry Practhets Discworld books as documentaries?

    • @pnichols6500
      @pnichols6500 6 місяців тому

      @@ddd7254 Protesting for people that won't allow women to work or leave the house without permission, let alone speak their minds just shows you how clueless these protesters are.

  • @smith2781
    @smith2781 4 місяці тому +6

    When I was 10 years old I was lucky enough to fly on Concorde. At 60’000ft I remember looking out the window and you can see the curvature of the earth yourself. If you looked up you could see the sky was black because the atmosphere is so thin you can see space.

    • @ronpapi9539
      @ronpapi9539 3 місяці тому

      @@smith2781 Weather balloons reaching an altitude of 120,000 ft.have seen no Earth Curvature and looking at a 360 °view it is perfectly Flat.You Lose!

    • @smith2781
      @smith2781 3 місяці тому

      @@ronpapi9539 😂🤣😂🤣. Ok mate, I strongly suggest you don’t watch the footage from Felix Baumgartner’s space jump from the same height neither. You won’t like the fact that you can also see the earth’s curvature from there too. I have a Google at these weather balloon photos that you’re talking about though.
      Did you want to start a business with me doing tours to the end of the earth?? Think of the money we would make doing tours to the world’s edge. We would be filthy rich.🤑

    • @ronpapi9539
      @ronpapi9539 3 місяці тому

      @@smith2781 Have seen Felix's jump.Fish Eye lens at its best.LMAO!

    • @smith2781
      @smith2781 3 місяці тому

      @@ronpapi9539 excellent stuff my man. Now are you interested in making some serious money?? I’m being serious about these tours, we could rival Richard Branson and Elon Musk.

    • @A15degreeperhourdrift
      @A15degreeperhourdrift 3 місяці тому

      ​@@ronpapi9539Watch Mr Sensible's MAGE 11 experiment available on UA-cam, earth curve clearly visible from 37 Kilometres (121,000 feet) and _demonstrably_ not a fish-eye lens.

  • @groaningmole4338
    @groaningmole4338 6 місяців тому +45

    They dismiss anything that they can't understand in 10 seconds as being a lie.
    Nothing can be done about this.

    • @johnjeffreys6440
      @johnjeffreys6440 6 місяців тому +1

      I was often the first person to make a comment on Eric Dubay's channel, but he or any other viewer ever replied to my comment, which leads me to believe that most of them didn't believe it either.
      I would say, if the earth is a disc, then all the bodies of water would be still like a pond, but the oceans are always churning because water can't settle ion a spherical surface.

    • @marksea64
      @marksea64 6 місяців тому

      @@johnjeffreys6440 Spherical has nothing to do with it. Water could perfectly well settle on a spherical surface if the sun weren't mixing up the oceans and the atmosphere.

    • @johnjeffreys6440
      @johnjeffreys6440 6 місяців тому

      @@marksea64 the moon has more to do with the tides and the waves of the ocean than the sun.

    • @marksea64
      @marksea64 6 місяців тому

      @@johnjeffreys6440 I wasn't referring to the tides, but yes, the moon has a stronger effect on tides. The point stands.

    • @getsideways7257
      @getsideways7257 6 місяців тому

      10 seconds have nothing to do with that, it's basically religious at this point.

  • @deep_space3491
    @deep_space3491 6 місяців тому +138

    Yep it's definitely worrying, social media has played the main role in spreading misinformation to people who want to feel special believing in something ''different''.

    • @paulmichaelfreedman8334
      @paulmichaelfreedman8334 6 місяців тому +6

      It comes down to the fact that a small group controls everything, makes many lives miserable, those lives then wanting to believe in something else than the depressing truth.

    • @seanfaherty
      @seanfaherty 6 місяців тому +8

      if social media is able to overcome what they learned in school where was the failure ?

    • @eh1702
      @eh1702 6 місяців тому

      Just as with QAnon and MAGA, the governmental enemies of the free world are happy to take advantage of every conspiracy (they don’t really need to invent them) to undermine political support for national scientific and technological programs, and to undermine public onfidence that scientists have any integrity.

    • @denxero
      @denxero 6 місяців тому +2

      Call it what you want, it's pure Liberalism.

    • @seanfaherty
      @seanfaherty 6 місяців тому

      @@denxero how do you figure ?
      most of these people are not liberal by any definition.
      There are truthers who claim to be anarchists and some are white supremacists, not too many liberals there.

  • @haynerbass
    @haynerbass 6 місяців тому +224

    IF the planet was flat cats would have knocked everything off the edge by now.

    • @SuckPuppet-xv1dv
      @SuckPuppet-xv1dv 6 місяців тому

      One of my favorite 'conspiracy theories" is that cats are aliens in disguise sent to monitor humanity. Don't worry, tho', they are mostly benevolent.

    • @neko_neko9
      @neko_neko9 6 місяців тому +9

      This should have more likes

    • @Buckdawg
      @Buckdawg 6 місяців тому +14

      Was funny the first time i heard it. Ten years ago...

    • @scottfw7169
      @scottfw7169 6 місяців тому +2

      @@Buckdawg And still is, as the cat here on my computer desk has just knocked my pen off and is now working on the placemat in front of this keyboard ...

    • @davidgray5570
      @davidgray5570 6 місяців тому +4

      You are misinformed...the cats are in on the conspiracy!

  • @Neverforget71324
    @Neverforget71324 4 місяці тому +3

    How do we know the earth is not flat?
    Because over the 10 million+ years that cats have been around, they would have already knocked everything off the edge...

    • @ronpapi9539
      @ronpapi9539 4 місяці тому

      @@Neverforget71324 Low IQ post.

    • @MarkBachelder-ie7hi
      @MarkBachelder-ie7hi 3 місяці тому

      You have fully debunked this conversation finally - thank you.

  • @lavieestlenfer
    @lavieestlenfer 6 місяців тому +77

    Someone has to populate the left tail of the bell curve.

    • @anotherfreediver3639
      @anotherfreediver3639 6 місяців тому +9

      The problem I suspect is that many would come out as quite intelligent on a Stanford-Binet IQ test. There's something else going on here; people with an IQ of less than say 70 just wouldn't be able to work out what the flat earth debate was about, because it would be too abstract for them.

    • @hanfrånnorr1986
      @hanfrånnorr1986 6 місяців тому

      ​@@anotherfreediver3639 No butt remember those betwen 70 and 80! Nott officialy handicaped but to stupid for the modern jobb market. I bett your typical flatt earther lies att 75 points.

    • @Vaeldarg
      @Vaeldarg 6 місяців тому

      @@anotherfreediver3639 The "something else" is exemplified in when at a failed Qanon event, as people started to leave someone shouted "don't leave! remember when we were alone!" These people just want there to be others (that either already do, or have been tricked by them) to be in the same boat of willful ignorance as them. Reality, much less science, moved beyond their understanding, and they gave up even trying to understand it. They just don't want to be the only one believing in the lies they've made up for themselves to explain how reality should actually be something it isn't.

    • @Alex-js5lg
      @Alex-js5lg 6 місяців тому

      ​@anotherfreediver3639 narcissism.

    • @jschudel777
      @jschudel777 6 місяців тому

      😂

  • @juliavixen176
    @juliavixen176 6 місяців тому +48

    You can't reason someone out of a belief that they weren't reasoned into. If their beliefs are not based on evidence, then evidence isn't going to change their beliefs. There is an emotional/psychological need that these beliefs fulfill. It's something inside of the person, not in the external world. You need to address the psychological needs to change a person's beliefs or behavior.
    (This is how it works in general, not just for conspiracy theorists.)

    • @higztv1166
      @higztv1166 6 місяців тому +2

      exactly

    • @johnjeffreys6440
      @johnjeffreys6440 6 місяців тому

      Ask a flat-earther to call the earth a disc instead of flat. Most won't because the earth is flat from the surface, but not from space.

    • @heteroerectus
      @heteroerectus 6 місяців тому

      Yes you can, this is one of those cute little sayings that people just accept, like, fight fire with fire. You absolutely should not attempt to fight fire with more fire, it will definitely get worse. And similarly, it’s much easier to convince someone that a completely unreasonable idea that they never thought through is unreasonable than one where someone actually spent time reasoning, but got it wrong somehow. A wrong idea born of flawed reasoning or bad data is by far much harder to reason out of.

    • @mikewood8695
      @mikewood8695 6 місяців тому

      and that's religion for you - and let's face it, apart from the folk at the top of religious organizations that know full well it's a scam to have power of people - and accumulate vast amounts of wealth, everyone else is believing a whole load of stuff with zero evidence - by all means have an open mind about possibilities, but to attend church or some other building with others and do what a bloke - and it is usually a bloke, tells you what to do - just another human with often very few qualifications or sign of real intelligence - is quite remarkable, but it usually involved your time and money and being subservient. All the while the hypocrisy of those at the top of those religious institutions IS just laughable - hoarding vast amounts of wealth, whilst telling us the meek will inherit the Earth - wakey wakey folk!!!

    • @WojciechowskaAnna
      @WojciechowskaAnna 6 місяців тому +2

      Galileo was prosecuted for heliocentrism, nothing changed much since those times - majority of people, regardless of education, would build their world-view on belief, not on evidence or critical thinking. Simply because actual thinking and providing proofs to oneself requires quite an effort and curiosity. Many scientist are also rather followers than sceptics.

  • @doraemon402
    @doraemon402 6 місяців тому +57

    The thing that sets flat earthers apart is the fact anyone can prove them wrong, unlike with many other topics that require far more complex experiments.

    • @drgetwrekt869
      @drgetwrekt869 6 місяців тому +1

      so true. instead, there are some fields where proving some bs wrong is basically impossible or very hard (for many reasons), including one of Sabines lovers: fusion.

    • @catman8770
      @catman8770 6 місяців тому +1

      At this point I am starting to be convinced flat earthers exist solely as a psyop to make anyone who questions anything look absolutely stupid and insane.

    • @MarcPagan
      @MarcPagan 6 місяців тому

      Exactly like Dem Party voters
      ...Flat Earthers are fact immune.

    • @KendraAndTheLaw
      @KendraAndTheLaw 6 місяців тому +3

      Ask them how eclipses work. The answers are most hilarious.

    • @六工業のカービィ
      @六工業のカービィ 6 місяців тому +1

      Actually, you can't use facts against them or probably even the arguments. Only one will remain eligible at the end: the problem of which model is more absurd.
      I've argued with the russian community back in 2018 end to beginning of 2019. They just come up with some magic always. They'll bring out any magical, absurd hypothesis that can contradict their other assumptions only for the earth to remain flat.

  • @hansmeier3815
    @hansmeier3815 2 місяці тому +4

    Why flat earthers scare me: they are allowed to vote.

    • @tatonemio6388
      @tatonemio6388 2 місяці тому +2

      I'm more concerned by the fact they are allowed to drive!

    • @daddy4934
      @daddy4934 2 місяці тому +2

      ​@@tatonemio6388 And breed.

    • @Gonzalez700
      @Gonzalez700 Місяць тому

      ​@@daddy4934 and talk

  • @Funbot15th
    @Funbot15th 6 місяців тому +17

    I like Dan Olson's explanation. Flat earth is not about finding the truth. Rather, it is about finding some comfortable explanation for chaotic nature of reality and having some power in it.

    • @mithrae4525
      @mithrae4525 6 місяців тому +1

      As with all conspiracy theories the feeling of being special, "in the know" is one of if not the main attractions; especially so for flat-earthers where other common components (eg. eliminating cognitive dissonance as with climate science deniers/Biblicist young-earthers, or narrative framing as with contrails/FEMA death camps/anti-vaxxers) don't really seem to apply.

    • @citoante
      @citoante 6 місяців тому

      @@mithrae4525 And, so what? Who cares? All I see is a superiority complex over something stupid.

    • @scotttaylor9133
      @scotttaylor9133 6 місяців тому

      @@mithrae4525 Well, I'm certainly glad you know that you're not one that needs to feel you're in the know when others aren't.

    • @scotttaylor9133
      @scotttaylor9133 6 місяців тому +1

      I think this is a VERY universal and human thing you're talking about here, and I think it will continue to rear its head in all sorts of ways, areas, people and ideologies as we become increasingly specialized with our ever increasing body of human knowledge. It's not about smart or dumb, or even being right or wrong. It's about how we cope with a world far, far too large and a body of knowledge way too broad and deep for anyone to even really conceptualize. Standing and looking at that, it's very difficult to understand how we fit in or how to even approach or deal with it in my opinion. We've all just found different coping mechanisms, some more sanctioned and normalized than others.

  • @rastanz
    @rastanz 6 місяців тому +28

    A flat earther told me when the tide goes out it's because the ocean's water is being recycled. Somewhere on flat earth there is a giant water recycling plant.

    • @PsychoMuffinSDM
      @PsychoMuffinSDM 6 місяців тому +1

      Tide goes in.
      Tide goes out.
      You can’t explain that!
      /s

    • @jamesmnguyen
      @jamesmnguyen 6 місяців тому

      As long as my water is clean, I'm ok.....(sarcasm)

    • @Slartyfartblarst
      @Slartyfartblarst 6 місяців тому

      The land surface also moves, to a much lesser extent. Water is recycled, by the hydrosphere.

    • @partymantis3421
      @partymantis3421 6 місяців тому

      lol i have yet to hear that one, these flearth models are a riot,
      the one i hear to explain the sea involves the famed ice wall melting in the summer & reforming in the winter,
      also theres ofcourse an armada guarding it that the UN protect (man i WiSH we could work that well together on something like that)

    • @neuvocastezero1838
      @neuvocastezero1838 6 місяців тому +1

      At least they seem aware of recycling.

  • @brothergrimm9656
    @brothergrimm9656 6 місяців тому +74

    The information age has revealed one thing, nothing travels faster than light except ignorance and conspiracy theories on the internet.

    • @tvviewer4500
      @tvviewer4500 6 місяців тому +3

      How many covid boosters do you have in your arm, slick?

    • @yeroca
      @yeroca 6 місяців тому +1

      obviously wrong, but also correct for comedic purposes

    • @Rhomes7
      @Rhomes7 6 місяців тому +1

      Truth. Even the universal speed limit bends the knee for Dunning-Krueger.

    • @Raphael4722
      @Raphael4722 6 місяців тому

      I'm tired of people complaining about the internet. There were probably even more uneducated people with ridiculous beliefs BEFORE the internet. You just didn't know about it because they would only talk to their friends and family about it.

    • @tvviewer4500
      @tvviewer4500 6 місяців тому +2

      @@Rhomes7 how many Covid boosters do you have in your arm, smart guy?

  • @adamrussell658
    @adamrussell658 2 місяці тому +4

    When its sunset in England and the sun is half under the horizon, its noon in California and the sun is straight up overhead. There is no flat earth theory that can explain that.

  • @Deltarious
    @Deltarious 6 місяців тому +26

    When you made that initial video Sabine I already had the understanding that you are now coming to, and it's been a real brewing problem for *much* longer than I have understood it to be one too.What you really missed the first time around was how the actual belief system and structure works. For *most* of them, the ones who really believe, it's not a simple issue of just doubting science, it's a fundamental philosophical shift away from believing in truth and reason, from scientific concepts. This is why you see flat earthers nearly universally become wider conspiracy theorists too as it is basically an entirely different worldview. There have been some great videos about it that I am not doing justice to, but what fundamentally tends to underpin their beliefs is that there is some special plan for them in particular and that they are the 'in' group, and that necessarily there is an 'out' group that is the majority and who are controlled by others plotting against them. For most of them, especially in the US, it is directly tied to religion too, and the system of beliefs itself *is* a religion, independent of anything else.
    It's frankly very scary and is hard to do anything about. This is the very same set of fundamental beliefs and mentalities that 'power' the other conspiracy stuff such as "q anon" and anti-vax disinformation, it's just that flat earth is one of the most extreme examples where to beleive it you really have to have fully 'bought in' already

    • @creedsixteen891
      @creedsixteen891 6 місяців тому +4

      Wow.

    • @alchobum
      @alchobum 6 місяців тому

      A fertile group is those that believe all things come from 'Odd. Only the 'Odd one has real knowledge because all knowledge comes from the 'Odd one. All else is necessarily false. An odd conundrum and oddly circular.

    • @unbreakablefootage
      @unbreakablefootage 6 місяців тому

      anti-vax is not a conspiracy. this was now shown in germany with corona vaccines

    • @GlazeonthewickeR
      @GlazeonthewickeR 6 місяців тому +4

      This comment should be pinned.

    • @ETM2024
      @ETM2024 6 місяців тому

      It's a cult but some people don't want to admit that. Aside from meeting many recognised criteria you can actually see direct parallels in their anti authoritarian dogma with the likes of Jim Jones and Manson, especially the former with his sermons filled with a blend of religious fanaticism and anti government rhetoric.

  • @ernestuz
    @ernestuz 6 місяців тому +75

    I met a flat earther in Texas 5 or so years ago. The guy was an engineer, at the beginning I thought he was just joking, but nope, he was genuine. At the end everything came down to his religious beliefs.

    • @GuardianSoulkeeper
      @GuardianSoulkeeper 6 місяців тому +30

      _"Religion Poisons Everything"_

    • @johnhough7738
      @johnhough7738 6 місяців тому +4

      If his religion involved engineering, and if his engineering involved religion; just so long as none of his bridges or buildings fell/fall down, no problem.
      But if he cast aside practical safety considerations and just prayed to The Lord for those to be covered; I think he should be promoted to ex-engineer.
      Perhaps he compartmentalised? A lot of them do, and some are brilliant at it. (And now to look up 'cognitive dissonance' again ...)

    • @gibfear
      @gibfear 6 місяців тому +13

      He "said" he was an engineer you mean? 🤣

    • @johnjeffreys6440
      @johnjeffreys6440 6 місяців тому +7

      Flat earth is not biblical.

    • @pvanukoff
      @pvanukoff 6 місяців тому +1

      I've known at least one educated, professionally productive flat earther. It's weird.

  • @kevinmcdowell9074
    @kevinmcdowell9074 5 місяців тому +35

    That graphic of the sun and moon bouncing in and out of the ocean is amazing and the dinosaurs flipping... Im convinced, this flat earth thing sound like fun.

  • @adigaw587
    @adigaw587 3 місяці тому +3

    The only thing flat earthers prove is that common sense isn't that common

  • @armorvil
    @armorvil 6 місяців тому +51

    I lost it at 0:45 : did that guy really try to prove the earth is flat by spilling water on that ball? What a genius 😂😂🤣🤣

    • @alienrenders
      @alienrenders 6 місяців тому +2

      That's actually THE primary misunderstanding by ALL flat earthers. They believe that a river that flows North is proof the Earth isn't round. I'm not making that up. They just don't understand gravity. So I think flat earthers aren't all people that don't understand science, but perhaps have limited spatial visualization skills. So they have no choice but to believe in flat earth.
      And you laugh at this example, but there's another example that's just as bad. Trying to explain curvature of space around a gravitational body by using a sheet and a bowling ball on it. What's causing the bowling ball to deform the sheet? The gravity of Earth. It's stupid as all hell and it's exactly the same thing that flat earthers are doing, except it's being done by physics teachers. There's plenty of these videos on youtube by "educated" people.

    • @JohnSmith-ux3tt
      @JohnSmith-ux3tt 6 місяців тому

      It isnt just him. Many flat earthers have done the same over the last 10 years.
      They have no clue.

    • @ianmccurdy1223
      @ianmccurdy1223 6 місяців тому +1

      @@alienrenders I don't understand your issue with the bowling ball demonstration. It's just a 2D visualization of a 3D effect, I don't think anyone is suggesting that the effect on the sheet by the bowling ball is literally the same as the warping of spacetime by the Earth

    • @littlefishbigmountain
      @littlefishbigmountain 6 місяців тому +1

      @@alienrenders
      With the sheet visualization tho isn’t the idea that, although yes the mass of the earth obviously causes a nice convenient gravity well for us to live in, that by spreading the sheet out for our model we are simulating a slice of unwarped spacetime. Then by placing a bowling ball into the center, the model takes advantage of the gravity well the taut sheet is in to place a massive object in the center to create curvature to show how the path of least resistance can be a different kind of straight line than we might imagine.
      It seems like you’re suggesting the sheet demonstration somehow begs the question by using gravity to demonstrate gravity, but I don’t really see how. It just seems like it cleverly takes advantage of local gravity to apply similar warping to the fabric of the sheet. In a zero g environment, couldn’t we hypothetically replicate this experiment with some force that simulates gravity instead of gravity itself and the result would be fundamentally similar? For example, if we were on a ship accelerating upwards relative to the conduction of the experiment at about 9.8m/s^2 give or take, no gravity needed and fundamentally similar results. Theoretically anyway, obviously I haven’t a spaceship to test it.
      That being said, because the gravity well we’re living in is effectively not represented in the model at all (since the sheet is flat, it represents a slice of spacetime with no massive bodies in it) and curvature is only introduced upon a body of mass entering the system. Since the sheet already cancels the curvature of earth’s gravity on the model, utilizing the earth’s gravity well to reintroduce massive bodies is actually really clever because it uses gravity to simulate gravity in a non-circular way, which makes it actually an amazing representation since it literally is the thing it’s trying to help you to visualize.
      Interestingly, in this model setup there is even a preference for direction of orbit, just like we observe in space. Although here I must admit I cannot say for sure that it also related, for all I know it’s caused by the Coriolis Effect and it’s just a coincidence for example. It does make it an even more useful demonstration model and teaching tool, though

    • @C_Becker
      @C_Becker 6 місяців тому

      @@ianmccurdy1223 What? So the ball is 2D?

  • @isilver78
    @isilver78 6 місяців тому +58

    When I was faculty member in a physics department at a well known R1 institution, I received an invitation to be a panelist at the International Flat Earth Society annual meeting. I kid you not, the invitation said “come join our members from all around the globe.” You can’t make it up.

    • @User-yy6xt
      @User-yy6xt 6 місяців тому +6

      You just did make it up

    • @Azuria969
      @Azuria969 6 місяців тому

      Nah I believe this peoplebare dumb

    • @livebungusreaction
      @livebungusreaction 6 місяців тому +4

      @@User-yy6xt 🤣

    • @samrowbotham8914
      @samrowbotham8914 6 місяців тому

      Everyone whose done the research knows that the FE Society was set up by globers to discredit real Flat Earthers. No real Flat earther could possibly say such a thing its a non sequitur they do not believe in a globe.

    • @samrowbotham8914
      @samrowbotham8914 6 місяців тому +3

      No Flater earther would make such a comment it is a non-sequitur. Why would they reference a globe when they do not believe there is a globe.

  • @Dr.M.VincentCurley
    @Dr.M.VincentCurley 6 місяців тому +161

    Here I was thinking that "Flat Earthers" didn't experience life in 3 dimensions. I was going to sell them some art work that could double as a short term rental.

    • @Alleged_Mercenary
      @Alleged_Mercenary 6 місяців тому +1

      I would invest in that business.

    • @grindupBaker
      @grindupBaker 6 місяців тому +5

      Homer Simpson thought the Universe was a straight line until he fell into the Spooky Theoretical SECOND DIMENSION

    • @danbance5799
      @danbance5799 6 місяців тому +1

      Edwin Abbott likes this comment. As a 3 dimensional being, I can only perceive the world in 2 dimensions.

    • @moomoodeadcow
      @moomoodeadcow 6 місяців тому

      Isn't that called NFT?

    • @lemdixon01
      @lemdixon01 6 місяців тому +1

      The galaxy is flat and the universe might be

  • @macbrush
    @macbrush 16 днів тому +1

    To many flat earthers, this is now a crusade, nothing more.

  • @waskus
    @waskus 6 місяців тому +21

    When I try to have a diskussion with flat earthers, none of them can explain it to me.
    They all type: do your researche😂😂😂

    • @juliachristinaheikamp246
      @juliachristinaheikamp246 6 місяців тому

      I am still waiting for the answer to the question, WHY we are all told lies by scientists, and fake organizations.
      The most I ever got out:
      To keep us scared of dying out someday and to be obedient to the overlords, which no one knows who or where they are and how they pay for all of the deep fakes necessary to complete the globe narrative.
      But how the flat earth actually protects humanity from going extinct is never answered.

    • @dickbanger8924
      @dickbanger8924 4 місяці тому +1

      It's hard for people with a double digit I.Q to follow along you see, that's why they invented tik tok to keep you lot occupied.

    • @Gnulcho
      @Gnulcho 4 місяці тому

      @joenahhas4377 Hotel = Trivago

  • @Dooguk
    @Dooguk 6 місяців тому +22

    The web has given the hard of thinking a voice.

    • @JZsBFF
      @JZsBFF 6 місяців тому +4

      That voice was around well before the internet, but it surely made that voice louder.

    • @Dooguk
      @Dooguk 6 місяців тому +1

      @@JZsBFF Maybe from the End of the World people or the Alien/UFO clowns, but not very much before the www became a thing.

    • @JZsBFF
      @JZsBFF 6 місяців тому +1

      @@Dooguk Flerf is actually a very old concept that got gradually suppressed by testable science, but it got never eradicated.

    • @Dooguk
      @Dooguk 6 місяців тому +1

      @@JZsBFF Yes. Obviously centuries or millenia ago it might have been difficult for people to understand., but these fools have to dismiss so many different inventions and discoveries it makes no sense at all.

    • @JZsBFF
      @JZsBFF 6 місяців тому +1

      @@Dooguk Sounds like any nowaday religion to me.

  • @vgernyc
    @vgernyc 6 місяців тому +7

    "Turns out, far too much has been written about great men, and not nearly enough about morons." Tyrion Lannister

  • @juliachristinaheikamp246
    @juliachristinaheikamp246 6 місяців тому +67

    I had my share of debates with flatearthers, trying to take them seriously.
    I am done with that, counting all the online harassments following every attempt of discussion on eyelevel.
    They become aggressive, act like heavily disturbed psychopaths, troll your accounts, tag you in public posts where they insult you and threaten you, pollute your messenger box with crap video's and silly photoshop memes, until all you can do is report and block them.
    These people have serious issues I am afraid basic education does not fix, only therapy and meds.

    • @Globeisahoax
      @Globeisahoax 6 місяців тому

      If you support the globe, you support criminal enterprise. You are an enemy.

    • @kitcanyon658
      @kitcanyon658 6 місяців тому +10

      Yep. They are cowards and liars, all.

    • @C_Becker
      @C_Becker 6 місяців тому +1

      @@Globeisahoax Just shut up.

    • @nickryan3417
      @nickryan3417 5 місяців тому

      There are three types of flerf: (a) tragically stupid, (b) terminally gullible and (c) grifters that prey on the former. All flerf fall into one or more of these categories.
      As for how to flerf? It's lie, to themselves and others, twist words, double down on stupid and ignore every fact presented to them.

    • @dominiccharvet546
      @dominiccharvet546 5 місяців тому

      King James Bible
      The heaven, even the heavens, are the LORD'S: but the earth hath he given to the children of men.

  • @rickt10
    @rickt10 6 місяців тому +34

    I had a flat Earther tell me gravity does not exist. He said it was all density. More dense things go down, less dense goes up.
    I said, "Yep, that is true...in a gravitational field that is true."

    • @User-yy6xt
      @User-yy6xt 6 місяців тому +2

      Now explain the rest of gravity

    • @repeater64
      @repeater64 6 місяців тому +5

      Lol yeah if there was no gravity then everything would float upwards due to buoyancy. Our atmosphere is denser at the ground than further up, meaning the buoyancy force is always upwards, but the reason that things either float or sink depending on their density is just due to whether or not the force of gravity is greater than or less than buoyancy. That’s why I find that flat earth argument so annoying because it’s just painful how little sense it makes

    • @repeater64
      @repeater64 6 місяців тому

      @@User-yy6xtthat’s… very easy lol.
      All objects with mass are attracted to other object with mass. Each of the objects feels a force that pulls it towards the other one. The force is stronger the closer the objects are, and it’s stronger the heavier the objects are. In general the force is very weak so at least one of the objects needs to be really heavy (like a planet) for the force to be really noticeable, but it is possible to observe the attraction between much smaller objects like a few heavy balls if you do some verrrry precise measurements. (look up the Cavendish gravity experiment).
      Therefore on earth, we are all attracted to the planet. The force of gravity acts towards the centre of mass of the planet (ie the middle of it) so us humans and all objects with mass are permanently experiencing a force in this direction, which we consider to be ‘downwards’. Even though if you were to go all the way around the planet the downwards direction would very gradually change since it’s always pointing to the centre of the planet.
      The rules I said in the first paragraph not only explain how gravity works on earth, but also explain perfectly the way that orbits work (ie earth around sun) and can be used to correctly predict the shape and time period of orbits, or calculate the masses of celestial bodies.
      Does that explaination work?

    • @User-yy6xt
      @User-yy6xt 6 місяців тому

      @@repeater64 Then why worry about it.

    • @draakoss1492
      @draakoss1492 6 місяців тому +5

      ​@@User-yy6xt first of all you can't just "explain" gravity in a youtube comment section
      You want to understand what is gravity. gravity is a forcefield that give every object with mass a pull effect or force towards it's center. Everything has this. the force's intensity is measured by the distance between the two objects and their mass.
      Isaac Newton centuries ago deducted a formula that helps us interpret this phenomena....
      If you wanna Understand why gravity does exist and why the earth is Round. I suggest you go study physics just the basics ofc.

  • @tonykelpie
    @tonykelpie 6 місяців тому +7

    Conspiracy theories in general are very attractive to many people because they offer simplistic explanations to many things that are difficult to understand, and they particularly avoid the anxiety that many people feel when faced with a world, and a universe, which is really difficult to completely understand

    • @Globeisahoax
      @Globeisahoax 6 місяців тому

      SYSTEMATIC POISONING BY THE GOVERNMENT TO PREVENT FLAT
      EARTH AWAKENING
      1. CHEMTRAILS/ GEOENGINEERING
      2. VACCINES: HEAVY METALS +
      GRAPHENE
      3.4G + 5G RADIATION
      4. PESTICIDES IN GM FOOD
      truth.to.the.rescue
      5. GRAPHENATED PCR PINS AND MASKS
      6. GRAPHENATED
      PERSONAL CARE PRODUCTS
      1. GRAPHENATED MILK, MEAT, WATER
      8. ELECTRIC CARS WITH SUPER
      EMF
      FIELDS
      9. MARXISM + TOXIC IDENTITY
      CULTURE
      10. ECONOMIC WARFARE
      AGENDA 2030

    • @euphoricbliss6699
      @euphoricbliss6699 6 місяців тому

      Oh wow I've not heard that old trope before. Man your so original 😂

    • @Coromi1
      @Coromi1 6 місяців тому

      Most of the time, conspiracy theories are more complex than the official version.
      The official version says that JFK was murdered by a loony. The conspiracy theory says it was the CIA with the involvement of several people and it discusses the motives. Way more complex.
      The official theory says that certain jabs are save and effective. Conspiracy theories discus at least four mechanisms how they increased the rate of cancer and make it grow faster. Way more complex.
      Can you name examples of popular conspiracy theories that are less complex? Flat earth or reptiloid theories are fringe.

  • @vikramanand2052
    @vikramanand2052 5 місяців тому +9

    I saw the total solar eclipse on April 8, 2024. I challenge Flat Earthers to come up with a
    model that does all of the following:
    -Explains why solar eclipses occur
    -Explains why eclipses don't happen at every new moon
    -Explains why we can also get annular solar eclipses where the Moon doesn't fully cover the sun and leaves a "ring of fire" around the edges
    If you can't come up with a self-consistent flat earth model that explains all of the above (which I know you can't), then that means that all the Flat Earthers are wrong.
    However, the globe earth explains all of these perfectly:
    - The Moon orbits the Earth and the Earth orbits the Sun. The Moon's orbit occasionally takes it directly between the Earth and the Sun, briefly casting a shadow on a portion of Earth's surface.
    -Solar eclipses do not happen at every new moon because the Moon's orbit is tilted about 5 degrees relative to the plane of Earth's orbit around the Sun. This means that the Moon often does not pass directly between the Earth and the Sun at the new moon; solar eclipses only happen when a new moon occurs near one of the points where the Moon's orbit intersects the plane of Earth's orbit.
    -The Moon's orbit isn't quite a perfect circle; therefore the Moon's distance from Earth is not constant. When the Moon is near perigee (the point when it is closest to Earth), its angular size in the sky is larger than when it is at apogee (when it is farthest from Earth). When the Moon is near perigee, its angular size as seen from Earth is slightly larger than that of the Sun; we can therefore get a total eclipse. However, if an eclipse occurs near apogee, the Moon's angular size isn't quite large enough to cover the entire Sun, and the best that we can get is an annular solar eclipse, where the Moon appears directly in front of the Sun but leaves a ring visible around the edges.

    • @ThomasKundera
      @ThomasKundera 5 місяців тому +7

      Flerfs can't even explain a sunset, so an eclipse... Well, LOL.
      Basically they can't explain anything as nothing works on FE.

    • @hadesunderworld4203
      @hadesunderworld4203 5 місяців тому +2

      Oh that was a beautiful site , I was in the 💯 eclipse area . South eastern Ontario . Got to watch it in my backyard , craziest thing I’ve seen …
      And they can’t answer any of your statements lol
      Wish they had a factory reset button or something … save them from themselves

    • @wendigo53
      @wendigo53 4 місяці тому +2

      I'm holding on to my eclipse glasses, as we're having a lunar eclipse in September, and I don't want to be damaged by lunar rays.

    • @ronpapi9539
      @ronpapi9539 4 місяці тому

      @@vikramanand2052 Wrong , t h e Sun and Moon are very small and the same size.They are located some 3000 miles above Earth in the Upper atmosphere.

    • @ronpapi9539
      @ronpapi9539 4 місяці тому

      @@ThomasKundera The Sun never sets on our beautiful Flat Realm.The Sun just travels beyond the Human vision.Bang!

  • @borysoppenlander4521
    @borysoppenlander4521 6 місяців тому +27

    One rather important point that wasn't mentioned here is the fact, that a lack of scientific education is not the only reason for people to start believing/ comprehend the world in/ through conspiracy theories. A large number of these people develop a kind of need for recognition as they get older. They want to make themselves heard, to set something in motion in their lives. It often doesn't matter to conspiracy theorists whether they are right or wrong. They often know very well that what they are saying is not true. It's more about finding supporters who give you a feeling of validity, rightness and, above all, importance.

    • @raypeery6317
      @raypeery6317 6 місяців тому

      " is the fact"
      Followed by a bunch of opinions.
      Tell me you're globetard without telling me you're a globetard.

    • @User-yy6xt
      @User-yy6xt 6 місяців тому

      So all you can do is insult people not offer and proof

    • @Azuria969
      @Azuria969 6 місяців тому +1

      So all you can do is insult people not offer a proof evidence, typical flat earther🤣

    • @User-yy6xt
      @User-yy6xt 6 місяців тому

      @@Azuria969 Wow aint you stupid

    • @getsideways7257
      @getsideways7257 6 місяців тому

      You know, it's not nice to just put everyone in the same basket. If a person believes in a "Flat Earth", that's one thing, but if they suspect 9/11 was an inside job or that JFK was killed by CIA - that's quite a different story, don't you think?

  • @milodemoray
    @milodemoray 6 місяців тому +17

    I was born on the coast of South Africa. I watched ships of all sizes come and go from Cape Town and witnessed first hand what my school's teachers were saying about the earth being round.
    When I was 16 I went on my first airline flight with a window seat, and we were high enough up at 10 kilometres to see the curvature, which just confirmed what my teachers had been saying all along.
    Furthermore, I didn't even have to have all those experiences to show me this as I was fortunate enough to also learn that there had been so called experiments to prove that the earth was indeed flat but none of those theories stood up to any real scrutiny.
    Besides, world governments can't agree on the smallest fact or details so how would a conspiracy the size of this one even get off the ground?

    • @gowdsake7103
      @gowdsake7103 6 місяців тому +1

      NOPE at 10 Km up no way can you see the curve you need to be at 60

    • @UnsoberIdiot
      @UnsoberIdiot 6 місяців тому

      "Besides, world governments can't agree on the smallest fact or details"
      lol
      LMAO even.

    • @enadegheeghaghe6369
      @enadegheeghaghe6369 6 місяців тому +2

      Obviously your eyes, the ocean, the ships and your airplane window seat were all part of the conspiracy. LOL

    • @FriedEgg101
      @FriedEgg101 6 місяців тому +1

      @@gowdsake7103 I've flown at 38000ft (11.5km) and thought I could just about make out the curvature if I pushed my nose to the window and looked from left to right. You'd probably tell me it was distortion from the plane window, to which I would say; maybe. But I've flown a lot at 32000ft (9.7km), and the same effect is harder to make out at that height.

  • @Raptor302
    @Raptor302 6 місяців тому +14

    I will empty my bank account to any flat earther who can find and view Polaris through their telescope while standing in Australia.

    • @mkx9095
      @mkx9095 6 місяців тому

      How much you got ?

    • @Raptor302
      @Raptor302 6 місяців тому

      @@mkx9095 Couple hundred thousand. Do it.

    • @mkx9095
      @mkx9095 6 місяців тому

      @@Raptor302 I can’t find the moon neither , I asked to know if you was worth an hack 😅

    • @mkx9095
      @mkx9095 6 місяців тому

      @@Raptor302 I’m joking , don’t worry

    • @sicuro5050
      @sicuro5050 6 місяців тому

      @@alexg4462lol

  • @SunnyAquamarine2
    @SunnyAquamarine2 Місяць тому

    I like the flat earth idea that if the earth is spinning so fast, why don't we land in a docent place when we jump? I think it's kinda cute. Misdirected? Sure. But fun to use to mess with others.

  • @edemilsonlima
    @edemilsonlima 6 місяців тому +19

    I try my best to teach them scientific truth. Some are polite and try to understand what they lack knowledge. But some are a complete waste of time.

    • @tomsanders5584
      @tomsanders5584 5 місяців тому +2

      I'm with you bro. I was teaching some kids about the man that drives a fiery chariot across the sky every day and some just weren't buying it. Like you said, a complete waste of my freakin' time...😐

    • @destructionman1
      @destructionman1 5 місяців тому

      But would you try to teach a schizophrenic person the clown isn't actually in their bedroom? Point is, any "debate" with a flat earther will not be productive, and only serve to further alienate them and stigmatize their condition.

  • @BattleAxe1345
    @BattleAxe1345 6 місяців тому +10

    I lol'ed so much seeing that animation of those dinosaurs being yeeted out of orbit into the void by an asteroid.

  • @peterkuchenbrod5696
    @peterkuchenbrod5696 6 місяців тому +13

    The real problem is that even if you explain in precise, easy to understand terms on how we know that the earth is round, they STILL won't believe it. I've experienced this firsthand and have given up. Quality science education needs to start when they are young.

    • @johndor7793
      @johndor7793 6 місяців тому

      I dont think it has anything to do with education since its so easily disproved. Imho its most likely different mental disorders.

    • @getsideways7257
      @getsideways7257 6 місяців тому

      FE is basically an alternative religion. Trying to argue with a religious person is about as futile, although of course religion promises much more than just a pancake Earth.

  • @ks1u
    @ks1u 5 місяців тому +2

    Apparently, ignoring these people and their ideas has not worked. We should all address these mind-bogglingly stupid ideas whenever we encounter them.

  • @augustinfrancotte3163
    @augustinfrancotte3163 6 місяців тому +39

    You say it is a matter of lack of basic knowledge, it certainly is, but I say something more concerning: it is a matter of trust, first. It means the institutions showed flaws to the point some ppl are so deeply upset and hurt in their trust that they can't believe anything coming from an institution.

    • @UnsoberIdiot
      @UnsoberIdiot 6 місяців тому

      As is only right and proper- they've proven that they can't be trusted whatsoever.

    • @hanfrånnorr1986
      @hanfrånnorr1986 6 місяців тому

      It is also a mater of simple intellect. Flatt earthers ocupie the iq-spectra below 80. The lowest 8% of all humans that cant really make it good in the modern world.

    • @almightyzentaco
      @almightyzentaco 6 місяців тому

      And I think sadly this mistrust is justified. But just because institutions are corrupt doesn't mean we live on a disc held up by elephants floating through space on the back of a giant turtle. People need to temper their mistrust.

    • @the8bitkit
      @the8bitkit 6 місяців тому +2

      In the UK at least, it wasn't just the institutions that were flawed - politicians ran campaigns on being "tired of experts" (the brexit leave campaign used this as their major argument against economists saying that leaving would be bad). Even those institutions that were reputable and still are are now ignored because politicians have weaponised people not liking being told things by smarter people in that field. It's so frustrating.

    • @augustinfrancotte3163
      @augustinfrancotte3163 6 місяців тому +1

      @@the8bitkit the smart ppl and experts you are talking about are also part of the problem. it is not just that ppl don't like to be told what to do by smart ppl, but by any authority that broke their trust or doesn't seem legitimate. In France, some of these experts were caught having conflict of interest in some situations. I say that for France, it's the case for many countries and institutions and what I don't like here is that we then blame ppl for not trusting the politics, the experts etc. If those ppl were trustworthy, no one would believe that the earth is flat, that the vaccines kill babies or make them autistic or Idk what other kind of unscientific claim.