The Simulation Hypothesis is Pseudoscience
Вставка
- Опубліковано 12 чер 2024
- Signup for your FREE trial to The Great Courses Plus here: ow.ly/6ymM30rvhBa
Is it possible that you, I, and everything we experience is a computer simulation? Why do people like Elon Must and Neil DeGrasse Tyson think this is possible? In this video I will explain how Nick Bostrom's argument for the simulation hypothesis goes, and what the problems with it are.
The reference I mention at around 6 minutes is eg
Constraints on the Universe as a Numerical Simulation
Silas R. Beane, Zohreh Davoudi, Martin J. Savage
EPJ A, 50, 148 (2014)
link.springer.com/article/10....
#science #physics #philosophy
0:00 Intro
0:25 What is the Simulation Hypothesis?
3:52 Can we simulate consciousness?
4:38 Can a computer replace the laws of nature?
6:18 Can we avoid calculating details?
8:14 Conclusion
8:52 Sponsor Message - Наука та технологія
This is... Exactly what the simulation would WANT us to believe.
lol you are making simulation sound like they are illuminati
And why do you believe that is the case? Maybe the programmer wants us to find out we're not real. This could even be the sole purpose of the simulation, a simulation is usually run with a purpose/goal in mind.
PS: I want it to be clear that I personally do not believe we are in a simulation.
@@kratosgodslayer6171 Or God... and round we go again.
She's an agent.
@@CvnDqnrU She did make a pop song about being an alien observing humanity...
I absolutely love your strict sense of epistemological truths by saying that illogical things are not necessarily wrong. We just can't verify them scientifically
Lolz simulation theory people wouldn't try that.
Maybe the scientific method is limited then, and in the future it may change.
@@jge123 Of course the scientific method is limited. Science only attempts to explain natural phenomena by natural causes. All claims that the only form of knowledge is science is scientism, a philosophical/religious position.
This is how I approach the concept of God. For simplicity I describe myself as an atheist. But really, I'm an agnostic atheist. I don't BELIEVE there's a God because there is no scientific / tangible evidence, but don't entirely rule it out since I know things can exist that can't be verified (at least, not yet).
Every so often Occam's razor fails, after all. The cosmological constant is such an example, which Einstein proposed to explain how the universe could not collapse, before learning the universe was expanding and labeling that his biggest mistake. But it turned out that needless complication that wasn't needed to explain the universe was true anyway.
Just discovered your channel, you remind me of so many of my favorite teachers from growing up, and it makes your videos and learning from them really cozy. Keep up the great work!
I appreciate that the hypothesis we live in a simulation is untestable, and thus, fundamentally unscientific. However, that doesn't make it impossible. A big shortcoming in the argument against the simulation hypothesis that's presented here is that it assumes that the higher level reality must abide by the same laws of physics and use the same mathematics that we have. There's no reason to assume this. For example, for all we know, in a higher level reality, information density and/or processing power/speed could be infinite, and maybe spacetime itself doesn't exist in any form that we'd even recognize. The laws of physics that we struggle to comprehend may just be some made up rules that a superintelligent being created in their spare time, with the "real" universe profoundly more complex than we can comprehend.
this
Given what we do know presently, your statement is making a lot of assumptions, and yet again, no explanations for how such things would work. It is thus, poor theory at best, which is the gist of this video.
Without explanation for how the mechanics of such a thing would work, that beat present, extremely thorough natural explanations, indeed, all we can have is faith is simulation.
Thats why I often hear other physicists when asked about this say "possible, but I wouldnt bet on it".
@@shkotayd9749 There is an "extremely thorough natural explanation" to the origin of the universe? Really? I think a lot of cosmologists would be surprised to hear that!
My statement is the opposite of "making a lot of assumptions" by pointing out that it's an assumption that a parent or higher-order universe must necessarily adhere to physical laws and mathematics that remotely resembles the ones with which we are familiar.
Regarding "Without explanation for how the mechanics of such a thing would work...", yes, that's part of the point: If we are in a simulation, it would be fundamentally impossible to understand or even hypothesize about how its works. We would have no greater ability to understand the true nature of reality than an NPC character in a video game could understand the game's code.
I'm not saying we live in a simulation, or even that it's likely. Instead, I'm saying (as many others before me have) that it is non-falsifiable, so we cannot completely discount the possibility, even if we can label the idea as unscientific given its inability to be tested and its apparent inability to make predictions.
@@StrongMed You will notice I never said anything about the origin of the universe ;) But, nice try :D
"Instead, I'm saying (as many others before me have) that it is non-falsifiable, so we cannot completely discount the possibility, even if we can label the idea as unscientific given its inability to be tested and its apparent inability to make predictions."
If its utterly undiscoverable, has no explanatory power, and thus adds nothing to our knowledge of the universe, then what is the point of even considering it? You can and frankly should be free to simply discount it.
Extrapolations from GR and SR leading to the multiverse, also do not factor anything of the like, and those deal with universes that are potentially similar to ours, to others that are unimaginably different.
The MV is just an extrapolation though. Like simulation, its untestable. Even as it has what looks to be quite good theoretical support and provides potential explanatory power.
Well, anything is possible if you disregard of physics 🤣
Hitchhiker's Guide to the Galaxy: "There is a theory which states that if ever anyone discovers exactly what the Universe is for and why it is here, it will instantly disappear and be replaced by something even more bizarre and inexplicable."
Lol yes.
Sabine is getting us ever closer to the next level of bizarre inexplicability.
Adams continues: 'there is another theory which claims this has already happened.' At least once,I might add.
One of the finest books ever written.
“Goodbye! And thanks for all the fish!”
@@dakotadad8835 Nope, it is "So long, and thanks for all the fish". This might sound nitpicky, but it makes a difference. Your simulation is sloppy, so you might actually be a simulation, as a real conscious being would have looked it up … (3 + 3) x 7 … ;-)
I really appreciate how she just basically told us the conclusion of the video in the title. No misleading or baiting title.
She's a very clear and honest presenter, for sure.
The crux of her counter-argument is that we do not possess any computer algorithm capable of re-producing various physics, like general relativity. That isn't exactly true anymore. Wolfram's latest project is doing exactly that: reproducing the systems we see in our own universe, like quantum mechanical effects or relativity, etc., using simple cellular automata algorithmically modified via simple rules. Just google Wolfram's New Physics. Verrrry complex systems have been algorithmically generated by simple cellular automata and, while the underlying mechanisms of our own observed universe have not yet been reproduced in this way,- they might be, and there's little reason to think that they cannot, given what Wolfram's project has already churned out.
@@tylerchambers6246 she's also partially incorrect. there are ways to experimentally test for various simulation scenarios, there are actual scientific papers on this.
obviously, if all of the tests turn up negative then maybe the simulation hypothesis is wrong (for what we can check), and the hypothesis has other problems on its own beyond tests. But that's the opposite of pseudoscience, that's science.
So honest that its clickbait
We are immortal, non-physical beings having a temporary human experience in a "virtual reality", and the purpose of life is to increase the quality of our consciousness, while lowering our entropy, through learning and evolving by making good and bad choices.
Please familiarize yourself with former NASA physicist and consciousness / out-of-body expert Tom Campbell's Theory of Everything, if you'd love to have your mind blown by a non-dogmatic reality model without a single flaw.
Thanks Sabine - I did think that when Tyson brought out the 50-50 odds about simulation, it sounded like something being thrown in from nowhere rather than actual science. I expected better than that from an astrophysicist
@@MrHurricaneFloyd Oh cool, cheers for that
Also, scientist don't pretend that their conversations is "sciense" or even should be. Kinda weird to critique a statement or dialogue for not "being science," since it probably even can't be. Statements CAN be part of science o/c, but that's a different matter.
If you watch the interview where he says that, you'll see it's just a bit of fun (which Sabine acknowledges). He wasn't saying it within a serious scientific context
no person is perfect
Tyson definitely lives in a computational world where he is God and he can define what and when apply logic/scientific rules
I really like this youtuber's delivery and style, deals with complex subjects intelligently but with great clarity.
Yo whoever is controlling my character, there's no need to choose hardest level everytime.
Agreed, winning the lottery buying a super yacht and having Miss World as a gf would be nice
Noob
I get glitches with no sign of patches in the near future. So I'll continue to trip over nothing and randomly walk into walls.
I’ve narrowed this to the following possibilities:
1. It’s boring if you don’t
2. You’re being punished
3. It is specifically these difficult situations that need studying
4. The rewards are greater if you do.
5. The universe (or the creator of the program) is intrinsically evil.
@@jmarkinman woah, I'll go with 4th one. Even though it wasn't what I expected but still choosing the hardest level has provided above average success (only once as I haven't explored other servers/maps).
I think smbc's take is funniest: if there are many arguments and most arguments are wrong, then the simulation hypothesis is likely to be wrong.
Lmao.
Very nice
That's fantastic.
LoL!
I wasn´t aware of this "argumentation" - it is so flawed it coud be from an flat earther of religious extremist. Didn´t they teach anymore basic reasoning anywhere?
The simulation argument concludes we are most likely NOT in a simulation. Sometimes it seems like no one has actually read the paper. (I really hope im not wrong on this one lol I've read the paper several times it's pretty interesting but maybe i forgot)
Really??? 😮
There's more than one version of the argument, and lots of iterations from many different sources. Mostly I think it's just an interesting idea, but it'll be great if someone ever develops some testables.
@@Egonkiller Yes. If you, like the person in the video, are referring to Bostrom's Simulation Trilemma ... yeah, it absolutely does NOT claim we are simulated. It sets forth a scientific/philosophic trilemma that concludes ONE of three things must be true ... only one of which is that we are simulated beings. For some reason, "hard scientists" have lost their minds over this, while scientist/philosophers like Nick Bostrom and David Chalmers talk about it reasonably. I guess science without philosophy really is a bad thing.
Wow, thanks for the bonus information/ explanation of climate modelling/prediction.
The 10 km resolution description you gave helped me to have a better understand, that climate modelling systems use low res approximations, that are linked with regular observation to prove whether or not the low res approximation is accurate enough and useful.
My understanding of the "simulation hypothesis" was that it was a thought experiment and much more philosophical than scientific.
Ekactly - it's mostly philosophical with some theological variants, at least for now. Different mathematicions have tried calculating the probabilities for the simu. Hypo. To be true, but for that they need to do a loooot of assumptions s which may or may not be true, and in the end the reselts no far have always come close to 50%. Once phycicists discover something that allows us to decide whether the universe is computable or not, or neurologists and/or computer scientists discover just how consciousness arises, then we'll have actual data to fill in the blanks of those calculations. So far, the best we have is educated guesses, no more
Errr... brush up on your Neuro-Science subject and get back to me on this one.
@@JosePineda-cy6om ...Plus philosophy, physics, mathematics and proofreading. I'd add English language comprehension and syntax usage, however Google's g-board is now so completely broken that adding these latter two would be somewhat unfair of me. If you *do* happen to use g-board, that is. And, on a seemingly unrelated topic, but just while we're all here, it may prove fruitful to actually read the words of comment you're responding to *before* responding to the comment.
Me too. It's only pseudoscience if you thought it was supposed to be scientific in the first place.
He didn't write the paper to argue that we are in a simulation. It is entirely philosophical. See my full reply in the main comment thread. Bostrom believes his argument is sound, and that the simulation hypothesis itself is unlikely.
www.simulation-argument.com/faq.html
The main concern I have about the simulation hypothesis, other than being unfalsifiable, is its recursive nature. If we would indeed be living inside a simulation, there's no reason whatever is running the simulation isn't inside a simulation itself. It's turtles all the way up.
It's funny you say that, because NDT used a supposed recursive nature in his argument that it's > 50/50. His argument presupposed that it's possible to simulate a universe in a universe in a ... But where, might these simulations be in each universe? It would seem bold to assume a piece could simulate another with comparable detail. So then we either we are the top level universe or we assume universes with greater complexity to explain our own.
That's not why he said it's 50/50. It's 50/50, because we don't know whether the conditions for the theory will be met, ie. that ancestor simulations are indeed possible and that humans don't become extinct in the future. Under these condition, he argues we definitely will create one, and then the chances that we are in thr real universe is basically zero, because the simulated universes will outnumber the one non-simulated 1 to almost infinity, due to their recursive nature.
His 50/50 proclamation is a pure guess and honestly bullshit, as it is impossible to say whether we will be able to create ancestor simulations. That's also why his theory is so worthless. It is a nice thought experiment, nothing more.
@@zagreus5773 sure, it's just rediculous to assume that gives you 50/50 odds. Potential conditions we don't know the truth of doesn't automatically get 50/50 odds. Most ideas a human can come up with are false, even when you narrow down to the ones that seem very plausible.
EDIT: Grammar
How's that an issue? It doesn't need to be infinite, anyway. It could be that our creators live in an universe which is not a simulation, and they're wondering about its nature.
@@emotionblur7214 It needs to be infinite for you to be sure. If we in our universe create an exact copy of it in form of an ancestor simulation, the copy will also create an exact copy, and so on. Therefore the number of simulated universes would approach infinity and we could say with certainty that we live in a simulation. The problem is that ancestor simulations are very unlikely to be possible. Therefor the theory is an interesting thought experiment, but nothing more. The theory was originally created by Nick Bostrom, a philosopher, NDT just jumped on it and seemingly never understood it. It is well known that NDT is a great example of Dunning-Krueger if it comes to philosophy.
Your example isn't even a thought experiment. Theoretically anything is possible if you allow for other universes. That's nothing new and not interesting.
When I finally read the details of the simulation hypothesis it seemed clear to me that it's based on a lot of unfounded assumptions about the limits (or rather, lack thereof) of computation.
So a good quantum calculator can be concious along with qualia and subjective sense of being? Ok.....
I think the biggest mistake is people make assumptions about the physics of the hosts "reality".
A hypothetical host reality could feature many more dimensions, completely different laws of nature, and/or our simulation just ticks at a much slower speed to compensate. The beings in that reality could be able to perceive our four dimensions at once, so our whole past and future is rendered out to them as a single static 4D model.
Either way it's useless to think about it because there is no way to verify nor falsify it...
@@YogarineWell a spatial dimension alone isn't a big deal, you can easily communicate across spatial dimensions. 2D being can send an SOS Signal to a 3D and vice versa. Different laws would be easier to explain since we can tweak the physics of our games
In short it is the dream of a dream
Limits in our universe do not equal limits in another.
6:55 actually such a concept exists and it's called LOD (Level Of Detail) in game dev. LOD main goal is to improve the performance
BTW superposition state till the wave function collapse could be a result of such a system 🤷♂️
But LOD changes are not invisible to sufficiently observant players. (and sometimes it doesn't take much to be "sufficicently" observant). And once you enter the realm of simulated physics, it becomes a lot harder, especially if you need to simulate an environment for multiple players (conciousnessses). You can be less precise with your car physics for a car outside of the view of player 1, because player 2 can still interact with it. You might for the sake of resource managemnt despawn some cars and NPcs, but it can be quite noticeable for a player to return and see the cars and npcs gone (or alive again). All these tweaks to improve performance cost something in the fidelity of the simulation, and become observable to the people inside your simulation.
This channel should be called, "um actually"
Ha, I wish I'd thought of that!
The title of 'Dr. B's' next song?
@@SabineHossenfelder It is possible to rename your cannel...
"um actually" Pseudoscience is “a collection of beliefs or practices mistakenly regarded as being based on scientific method.” By definition, Multiverse, RNA World, Scientific Racism Hypotheses are classified as “Pseudoscience”.
@@moses777exodus The RNA-World-Hypothesis is based on the observation of information storage and catalytical behaviour of RNA molecules. So I would argue that it is a valid hypothesis derived by scientific means. The downfall of all abiogenesis hypotheses is, that it is hardly testable what the first replicator was. On the topic of the Multiverse and Scientific Racism I am with you.
"It's just normal paranoia, everyone in the universe has that"
Douglas Adams
So you know every species in this Universe ?
@@johnb8854 woosh
@@kensho123456 I'm not sure why you'd be proud to not read them. Would you consider it? There's tons more great little bits like that!
Douglas Adams wrote irreverent comedy. He wrote for Monty Python’s Flying Circus. I would think that one must have a dull life if they are proud not to have read his stuff.
@@tonylalangue6243 ua-cam.com/video/DaydqnqJYvA/v-deo.html
Here's an idea to consider.
1- I can run a virtual machine (VM) on Windows 7, which simulates a physical machine with software, albeit slower due to *power and speed limitations*
2- Inside the Windows 7 VM, I can run Minecraft, just as I would on the host machine, albeit slower. *There is no difference in logic* between the VM and host machine.
3- I can build *computers within the Minecraft world* , but I cannot create a *computer that can run an exact copy of Minecraft within Minecraft* . The *in-game logic and physics would prevent this* , even if it were possible, it wouldn't be a perfect one-to-one copy.
Where I'm going with this is, just as the in-game physics of Minecraft prevent us from building a computer that can simulate the Minecraft world, we can expect that the physics of our universe may also prevent us from simulating it. The physics of the "outer world" may be more permissive, allowing its "inhabitants" to create our universe as a computer game for their children to play with.
As of now, we cannot prove or disprove this idea, which indeed places it within the realm of pseudoscience. However, to me, this idea makes more sense than the notion of a god simulating his own universe one-to-one. Unless I'm wrong, in which case I would be interested in learning how.
I've done the simulation hypothesis argument too many times.
I have settled on a single anti-SH argument.
A single argument which is to consider ....... a single droplet of water.
If you simulate a droplet of water you can do an excellent job with several graphic tools and AI models. BUT if you take the simulated droplet, extract the profile with high resolution, determine the first and second derivatives along the profile and then try to verify the Laplace Young equation it will be off by ... a lot (at least a couple of orders of magnitude).
Point being.
It is EASY to SIMULATE a physical object to the point that is seems real to casual observation but it is extremely HARD, borderline impossible (due to things like resolution limits and computational round-off error) to simulate the same physical objects to the point that they seem real under determined physical analysis.
So, we are NOT a simulation, and to convince yourself of this take a photo of an actual droplet and try to extract the LY equation. That exercise will be a humbling experience.
All of this is completely irrelevant. Getting a hacked job done is the same as saying the whole is already done, true. We don't need to create with our hardware, we just need the idea because the brilliant minds of the industry simply make this stuff happen. There's literally no "this needs to be this or that." We have Minecraft to show that things work because the logic works...explanations be damned. They aren't necessary for anything. As long as a computer program compiles and does what you set it out to do it is a truth regardless of if it malfunctions later. It can scientifically be studied and reverse engineered by someone choosing to download it and open it up using various tools like GDB to browse non-stripped source code if not compiled without it.
Her argument that it's not easy to reproduce the foundations of physics with code is valid only if we accept that the same foundations are true outside the simulation too. But if we live in a simulation the physics of our universe may very well be only an artifact of the simulation
In fact it would be a necessary consequence.
@@mdbk2 but that is just another assumption and like stated at the end: it does not mean it is a wrong hypothesis. it just cant be proven therefore its unscientific to believe it is true.
But if that would be the case, it is still unscientific because science is a product of our “world”. Hence, circular argument, hence scientifically irrelevant. Hence, just a matter of faith, which is also fine. I think she’s just clearing the use of the terms.
@@mdbk2 erm a lot of people who've done the lightest pop science reading repeat this. Anecdotally my sister, my flatmate and one of my colleagues fully believe that we are in a simulation. The plot of the matrix revolves around this, and people have taken to using it for simulation theory example. This video is probably more for those who do believe in this hypothesis and this is an educational channel
It's basically solipsism. Not a very useful idea.
I think the simulation hypothesis is one of those cases where we can quote Carl Sagan:
"It pays to keep an open mind, but not so open your brains fall out."
Flat earther friend I need to tell this.
Hahahahahahaha! Right.
Sabine was speaking in another video that there is no infinite in real life. I think this is the strongest support for this hypothesis because it implies that there is a minimum resolution and a maximum limit which may be imposed to the simulation. Also, the existence of entropy is a strong advocate for this theory. Why ? Because over time everything gets destroyed which you can associate with small glitches/uncorrectable errors that piles as the time passes. You don't need to calculate everything to the smallest details and this was proven by Machine Learning models being able to simulate physics in almost real time . This is done by approximating the outcome of a simulation based on lots of training and without being aware of the underlying physical laws. You can even go further and look at the uncertainty principle which clearly limits your resolution and amount of details you can discover . Dismissing this as based on religious reasons doesn't mean your brain "falls out" but it means that we don't have enough information to confirm if this is true or not. It is easy to dismiss the existence of Jesus and the events in the Bible or other attempt to religions (like hinduism , islam etc) now , because after we got smarter and the humanity discovered more and more of the secrets of the universe the basis of those religions became childish and their stories are just less and less believable. This is not true of the simulation principle which, by every year that passes, becomes more and more likely just by observing simple stuff like the evolution of games from Pong to Huge Open Worlds , the increase in computation power or the increase migration to the virtual space which for many has become the place where they spend most of their life
@@danielstan2301 WTF are you even talking about? "Also, the existence of entropy is a strong advocate for this theory. " This is absolute nonsense.
"Dismissing this as based on religious reasons doesn't mean your brain "falls out" but it means that we don't have enough information to confirm if this is true or not."
Yes your brain has fallen out especially your reasoning from "entropy is strong advocate" just made me laugh. Go back got to watch Matrix stan.
" because after we got smarter and the humanity discovered more and more of the secrets of the universe the basis of those religions became childish and their stories are just less and less believable."
Exactly and some people decided to change those stories into STORIES ABOUT SIMULATION.
" This is not true of the simulation principle which, by every year that passes, becomes more and more likely just by observing simple stuff like.. "
EXISTENCE OF SIMULATION IN REAL WORLD DOESN*T IMPLY THE WORLD ITSELF IS SIMULATION YOU F IDIOT.
Ha Ha very good.
As a programmer, and having a best friend that's also a programmer, we both came up with this idea as late-teens. It was fun to kick around, and to toy with, as it meant that somewhere in the code, we could turn on "god mode" and possibly "no-clip" modes. Mind you, we never really believed it, because a lot of observation just didn't line up, but it was really easy to draw "conclusions" that we were in a video game. Also, having played around with that, when I first heard about Simulation theory, I laughed and dismissed it as 20 years too late and fraught with holes.
I think it is likely that the universe arises out of infinitely large probabilities (relative to everything else) of certain sets existing that have properties that self promote their growth and stability. For example, having the ability to change (time), and allowing the set to have operations which allows duplication, interactions, etc. can increase the relative amount of sets of this type. Sort of an evolutionary + probabilistic model of power sets.
Keep in mind. In the end it doesn't matter if our experience is real or simulated; It's real to us, and affects us just the same.
As a philosophical idea the simulation hypothesis doesn't make specific claims about the nature of this reality, as much as it entertains the notion that there may be other realities than our own.
So long as the code is unhackable. I mean that's sort of the point of The Matrix. If you believe you are in a simulation then the idea that you could possibly reach outside that simulation would be fascinating, but there are so many things with so much higher possibilities of both being real and of being unlockable technologically that it seems kind of questionable to spend much time on a cosmic longshot unless you have a really good idea on how you could test it.
One of the weird things about the intersection of science and philosophy is watching scientists, who've spent vast amounts of time learning science, suddenly discovering epistemological philosophies and wading in like because they are scientists and they haven't explored these things before that no one has. There was a big debate in the atheist community about whether Neil DeGrasse Tyson was an atheist, as he'd hedged his bets whenever asked directly but seemed to be leaning that way, but there he was, wading into simulation theory. (It was actually a fascinating debate that pitted some diverse ideas, from what is the difference between and atheist and a agnostic, but also do people have the right to label themselves something even if the evidence suggests they don't fit that label... which was getting some weird responses from people who in almost every other aspect of life would be all for letting people label themselves.)
It matters if there is a way out.
@@jscott4081 There isn’t a way out bud you’re made out of the simulation there is no ‘you’ beyond it
Exactly. Even if reality is just interactions of fields and one dimensional strings of vibrating ???? - I still have to pay my mortgage by the 5th of the month.
"I had a dream: I was a butterfly. But now I have a problem: did I dream about being a butterfly, or am I the dream of that butterfly?"
[Chuang Tzu]
Ah, let me rephrase this but in 600 pages written on turgid prose but laced with so many pop-culture catch-phrases that you don't notice.
It's gonna be a hit! :^)
No problem, A & CT, the neural structures of a butterfly cannot possibly support the complicated ideas of Chung Tzu, so he dreamt of the butterfly, definitely NOT the other way around. (I'm glad some one finally asked. Cheers.)
@@rexdalit3504 The point is that both in dream and awake state, the basis is the same consciousness. It has nothing to do with neural structures.
@@andsalomoni Ok, good point. But there was this sleep research experiment where a group was deprived of REM sleep and the control group was awakened the same times as the first but on random times.
After a few days the control group was just a bit groggy, but the first group was hallucinating. What dreams are for didn't this experiment answer. But it suggests that dreams are to sort and generalize the impressions the brain gets. A debriefing, so to speak.
Then there's the fact that children more often have nightmares and moves around more when sleeping. There must be some reason to that.
@@abaddonanon7573 Dreams are ways to solve unresolved mental issues. If in everyday life the mind accumulates issues of any kinds, the dreams are ways that the mind uses to solve them, or at least face them, with imagination. If you hinder this solution, the mind goes mad and starts to make it in the awake state, hallucinating.
The one who doesn't accumulate garbage in the mind in daytime life, doesn't need dreams, and actually sleeps in deep sleep only. Persons with a years long experience of meditation practice can reach this condition.
The problem I have with Bostrom's formulation is the same problem I have with the Creationist Fine Tuning argument. The fact of the matter is, we're here, right here, right now. That's the starting point. The probability of the circumstances right now is 100%. You don't get to propose a hypothetical "what if" version of the past and assume is is a roll of random dice to get from there to here, and then form a probability argument. If you want to assert the distribution of possibilities is random (instead of selective, biased, or causal), then you should have to prove it instead of just get it as a free assumption in your argument.
Creationists are not allowed to assume that constants "could have" taken any possible values, and then say the probability of their current values is extremely small. The fact is, the values are what they are, and if you want to assert they "could have" been different, then that is up to you to prove.
So when it comes to Bostrom's argument, where does he get the free pass to propose a totally fictional and abstract space of conscious civilizations, and then get to toss us in that abstract space like a plinko lottery instead of starting with our actual circumstances as the ground truth? So just like the creationist, if Bostrom wants to say there "could have" been these other civilizations that perform simulations, that is up to him to prove, not just get a free assumption as a possibility. We're not some abstract civilization in a 3 step armchair fart, we are a highly specific set of details and circumstances and context, and *every* single variable should factor into a continuously updated Bayesian inference.
The probability of you as an individual getting cancer is not the same as the probability of the average person getting cancer. Every single individual risk factor plays a part as a variable, with your non-statistical individual chain of causal circumstances being the ultimate determination of the outcome.
The fact of the matter is, Bostrom's argument when applied to our actual reality and evidence we have today says there is zero chance of simulation. If the civilization performing the simulation must be "outside" our physical universe in some manner, and therefore excludes all physical civilizations on Earth, then the number of civilizations we have evidence for on step 1 is exactly zero, and (even when you include our own civilizations) the number of simulators for step 2 is exactly zero, therefore the probability of us being simulated is zero.
Thank you. Breath of fresh air! You'd have a lot more thumbs up if there were more people who a) actually understand probabilities and b) bothered to read posts longer than two sentences. But we do exist 😀
Good point re the creationists, who hugely misunderstand the anthropic principle, thinking it means something (in favor of their view of god) which it is not saying.
As Sabine explains, the simulation idea of the universe is a bit silly. However, there is a hint of correct insight, in that conscious experience is a simulation (i.e. model) of the world by the brain that is being constantly updated by incoming sensory information, in a Bayesian updating sense. Specialised parts of the brain contribute parts of the overall conscious experience, e.g., the colour centre in the brain, the movement centre in the brain, etc. Damage to these areas changes our conscious experience. Our neuroconsciousness is a simulation of the world as it is happening, we are our simulation (e.g., red is part of our simulation, there is no red 'out there'), the brain is the mechanism of the simulation, strange experiences such as hallucinations in external space can be accounted for by dysfunctions in the brain's simulation - but there is no simulation underlying external physical reality. Also, time does not exist, its an ordering mechanism used by our brains to construct conscious experience, but that's a longer story.
If we are living in a simulation, then the laws of physics as we know them are really just the rules of the simulation. Therefore, we wouldn't actually know the real laws of physics in the "real" world, so how can we say it wouldn't be possible to simulate?
In the end though, it really doesn't matter. Even if we are in a simulation, that has exactly zero implications for how you live your life. You can't get out of the simulation, and you can't break the rules of the simulation (i.e. break the laws of physics). If the designers decide one day to just shut it all down, not only is there nothing you could do about it, you also wouldn't even be aware it had happened. You would simply cease to exist. This is what happens to everyone eventually, anyway. Whether by the simulation ending or you dying, you aren't going to be aware that it's over. What I'm getting at is that this reality or simulation we live in is what we have, and it makes no difference which it is.
So, my take on the simulation theory is that I don't really care, because it doesn't matter either way.
Except it does matter, just not to you.
@@B1GDINO yeah, it might mean nothing to me or OP but it defo has big implications for MANY people. it would be truly world shattering to anyone devoutly religious
@@Cloudsurfer69 Why? Couldn't you just argue that your particular God is the one running the simulation?
Facts. But this other video breaks it down in a more entertaining and logical way in my opinion... ua-cam.com/video/cszXpIpb_-s/v-deo.html
Not only it wouldn't matter since noone can unplug (unless one starts preaching death is unplugging), but there's another issue - simulating that many "useless" people (possibly animals too then?) is a huge waste, isn't it?
Here's a fun idea. The double slit experiment exposes a code optimisation that approximates light as waves until it is carefully observed. Video game developers use coarser approximations when possible to save computation all the time.
I've played with the thought of explaining relativity as the side effect of some kind of computational optimization also. I know for instance that when you simulate moving bodies that interact, you may want to run a higher rate of update cycles on things moving fast and/or close to other bodies to get more accuracy. Things moving slower and/or far form other bodies you do not have to spend as many cycles on. There are other optimization techniques worth talking about. Have not managed to come up with a hypothesis that makes a link so far. Probably a dead end, but fun speculation non the less.
I see this idea mentioned often but actually simulating quantum systems and entire wave functions is exponentially more complex than just keeping track of individual particles. It doesn't make much sense.
@@JAN0L It's the other way around. You don't need to see the waves unless you're actively looking at them. Everything could just be classical mechanics until you actually peak at the details. What's really nice with this theory is that it is provable!
Assuming that we are in a simulation, and this wave particle duality is indeed a form of performance optimization, it goes in to assume that the optimization was required for the simulation to work properly. In other words, you don't code in stuff that complicated if you don't need it in there. This goes on to imply that the computer running the simulation does not have infinite computation power. If it did, you wouldn't care about optimizations. Ergo, if you make enough quantum observations in a localized region of space, lets say by building a large scale quantum computer (I'm thinking on the order of 1 billionth the mass of the observable universe), then you should be able to measure some forms of lag. If you're lucky, you might not even need that much computing power.
All in all, it's definitely the kind of stuff you'd try out just before going out for lunch at the restaurant at the end of the universe...
@@KawazoeMasahiro Unless the simulation also uses something like EVE Online's time dilation, where it slows the action as it gets overloaded. Not played EVE in years so I could be wrong about what it does, but my point is there's no reason to think we run in real-time compared to the outside, so deliberately taxing our processing resources doesn't guarantee we'd be able to see an effect. Heck, they could just stop the sim until they can upgrade hardware then reload where it left off.
I've considered a similar "optimization" in physics: the heisenberg uncertainty principle. in the "real" universe, it may be possible to measure both the position and velocity of a particle but in our simulation, those properties are compressed to save CPU cycles. as a result, we have an entire layer of particle measurements that aren't accessible because they aren't relevant to the simulation
The argument against any kind of objective reality is a good one. That no matter what we think we are measuring or observing is still only taking place within our mind’s perception of those observations. Die Gedanken sind frei, und alles, was wir wirklich haben.
You shared knowledge of interesting simulated algorithms and state of matter on both sides of probable acted out theories is well presented ...
Thankyou
I've always viewed the simulation hypothesis in the same category as Boltzmann Brains, Brane theory, and even string theory as "fun thought experiments that shouldn't be taken too seriously until there's any actual evidence"
It definitely seems to share some DNA with Boltzmann Brains, and Roko's Basilisk.
@@andrewness Roko's basilisk is idiotic. It has too many holes to even be considered scientific.
Not just that, but the same argument believers in the simulation hypothesis to "prove" that it is overwhelmingly likely that I live in a simulation, works just as well to "prove" that it is even MORE overwhelmingly likely that I am a boltzmann brain. And here's the punchline. It is impossible for me to be both. Because the simulation would have to be run for so long for boltzmann brains to appear that the universe that its computer runs in will have its heat death of its own before that happens. In mathematics, there is a principle, that if you have an argument that appears to "prove" a theorem, and that argument works just as well to prove something else that you definitely know is wrong, then you know there is something wrong with the argument. You don't know what's wrong with it, but you know something is wrong with it. Which means that the argument that it is overwhelmingly likely we live in a simulation, is bad logic.
@@januszpawlikowski6627 Well the question is, is it possible to make the universe cough up specific desired information from the past. They say that information is never destroyed, but then, can it be accessed? It is my understanding that if something is fundamentally unobservable, then it can be said to not exist. So that implies there should be a way to observe any information in the universe. And if that is the case, then it would be fundamentally possible to resurrect the dead, even the long dead, and that would only be a short leap away from roko's basilisk. Feynman's infinite path integrals seem to me like a clue suggesting that. I do think it is infeasible though. Because of the interconnectedness of all the information in the universe when anything interacts with anything else, you would probably have to somehow observe the entire universe in order to collect the specific information you wanted such as the exact location of a carbon atom in the brain of albert einstein on his death bed for instance. I also think that it makes no sense, the motivation of roko's basilisk. Because why would it want to punish everything that didn't get hard to work building it, when it DOES exist, obviously they didn't interfere with it coming into existence.
The Simulation Hypothesis explains a lot of things, some trivial, some quite profound. For trivial, it explains the mystery of "Dolly's Braces"!
“I dare you!”
Lol you’re great and I love your channel.
Sabine really do be out here daring our multiversal overlords to end it all
He could plug it out and then plug in, and we wouldn’t notice anything. Just like virtual machine.
I watched this video in the dark half asleep and you scared the heck out of me with that “I dare you!” Scene. And then you pulled the same stunt again and it shocked and really scared me again :-D The Argument of the simulation of laws of nature is imho flawed, because we could be a simulation for artistic or entertainment purpose, and our creators would care as much about scientific realism as we do when playing a computer game. As long as it is entertaining, we don’t care at all :-)
My biggest concern about the hypothesis is about definitions and clarifying what is meant by "simulation". It's not just semantics, as noted in this video.
When we talk about a simulation, whether computer, scale model, or other types, what we mean is that we've created a limited and bounded model that we run through a process meant to simulate -- an analogy with similarly properties -- to something else in the " real" world.
But these simulations still follow the laws of physics. A scale model of a ship in a wave pool is still a small boat riding real waves. Computer programs are still electricity running through circuits creating patterns. What makes the "simulations" is entirely within the mind of the operator as to how the information will be used.
How people use the simulation hypothesis seems more broad in the sense of a description of the "laws" or our universe being constraints that are a subset of the physics of the higher layer of "reality".
An obvious objection then is simply Occam's Razor. The simulation hypothesis requires " us" to have a physics nested within the physics of a higher level reality. And, the same arguments also mean the higher level reality is also likely a "simulation" in an even higher level reality. Ad infinitum.
It's simulations all the way down.
Adding one layer of reality above us adds complexity without any new explanatory value, and brings along with it all of the infinite layers above it for infinite complexity.
It fails Occam's Razor badly, I think.
Simply & brilliantly presented!
who ever is running the simulations' operating system needs to update the anti-virus protection, given the last year or so.
very good. I'm with you 100%
I’ve said many times, if someone is creating a simulation we live in, they are doing a piss poor job of it!
Couldn't rubbers and other forms of birth control be like "anti-virus software"?
@@charleswoods2996 rubbers make things worse not better.
Simulation:
1. the act or an instance of simulating
2. the assumption of a false appearance or form
3. a representation of a problem, situation, etc, in mathematical terms, esp using a computer
4. mathematics, statistics, computing the construction of a mathematical model for some process, situation, etc, in order to estimate its characteristics or solve problems about it probabilistically in terms of the model
5. psychiatry the conscious process of feigning illness in order to gain some particular end; malingering
1. the act of simulating; pretense; feigning
2. a. a simulated resemblance b. an imitation or counterfeit
I reckon you could apply all of those definitions to Covid; the simulation within our reality.
www.collinsdictionary.com/dictionary/english/simulation
I'm still waiting for one of the knights in the Age of Empires game to ignore my direction into battle, turn around and say, "How bout getting out of your chair and you going into battle."
KEKW
This needs to be an easter egg.
That would actually make for an interesting game mechanic, in the right game. The player's character goes rogue, so you have to take control of another character to try and get them back.
@@voxorox Eugen's Wargame series and WW2 game has a morale mechanic that "panics" units if under too much pressure or too isolated from supporting units and if they are not reinforced and resupplied back they will rout and try to escape enemy fire or the frontline entirely on their own (often with disastrous consequences).
There are several games that, if pirated, make your character drunk or unable to do certain things required by main missions. There are even some I've heard that immediately turn your PC off.
Actually there are many videogames that only generate what the player is interacting with. Kind of like how a partical is a wave until observed/measured/path information is consciously available
Double Slip Experiment
Well they only render what you can see. The physics may still be going on behind the scenes so that they are in the right place when it’s time to view them.
That "I dare you!" was perfectly placed and had me rolling 🤣
Also because of the whole "not being able to falsify or verify" and "not being able to make predictions with it" things
Oh that's right. Isn't that called science? Good point.
@MetraMan09 So you have a citation for the proof that simulation is disproven. I would love to read.
@MetraMan09 citation?
It is actually falsifiable. If a quantum computer has infinite simulation power (e.g. can fully solve a NP complete problem), the universe is NOT a simulation. This stems from the fact that a simulation has to be computed on a finite computer, since it has to be discrete.
@@viniciuscazevedo yea but you don't have proof that the universe is not discreet.
You're assuming the simulator universe has the same laws as our simulated universe. But it's necessary that all simulated universes are simpler than the universe that is simulating them, so the fact we can't sinulate our universe inside our universe isn't a problem for the hypothesis.
All simulated universes must be simpler than the universe running the simulation, or it wouldn't fit.
It may be impossible to simulate our universe with our laws, but easier with whatever characteristics the universe simulating ours has
Though if the universe that simulates our universe runs by different laws, then you don't know if the simulation hypothesis would be valid there, which does seem like a possible flaw.
The problem is that as you observe this is self defeating. The argument relies on 1) it being possible to simulate simulations of _ourselves_ to an acceptable degree, because that is the proposed motivation for creating these simulations to begin with 2) this leading to _recursive_ simulations (i.e. simulated beings created simulations of their own). Without these you don’t even have an argument anymore.
if the universe doing the simulation is different enough, the term "simulation" becomes a hypothesis too, because to the best of our knowledge such a universe may not allow classic calculations, mathematical laws or even intelligent life. we could be living in a type of "pocket universe" that is a by product of that universes laws, which is a different theory entirely. the hypothesis you suggest makes even more assumptions and is alot less concrete as a consequence.
She didn't argue that it wasn't possible, only that it was pseudoscience. Though, I think it's unfair to call a philosophical arguement pseudoscience if it's not presented as science.
A lot people who think about this will only entertain ancestor simulations in particular because then you at least have a reference point of known phenomena to make arguments like the one that Bostrom made, although he does make some assumptions as explained in the video. If anything goes there's nothing to think about; it then becomes the same as how do you know you're not dreaming?
The "game of life" by conway can be run by a Turing Machine and a Turing Machine can be run on the game of life. You claim that it is necessary that the universe being simulated must be "simpler" but do you mathematical proof of this fact? It isn't impossible but the more speculations that you add on (without evidence) the more unlikely it becomes.
Exactly the same as monotheist religions. We can't know how it's done because the creator is beyond our understanding so we'll never understand. Just have faith it's true because we say it's true.
About to hit 400k subs, great job ! 👍🏼
The short scale, weather reference is brilliant and so fundamental.
"It gives me hope that things will be better on the next level", best summary of religion I've heard.
The trouble is we don’t have any awareness of any „next level“.
@@Z-Diode We're all trapped in Frog Fractions and we don't know it yet.
Religion gives us hope it's better for us and worse for our enemies.
dang i thought i was the only one who noticed
This remark about religion got the most likes 👍🏽 so far. Like in her “Fine Tuning theory” video, religion is the cord that she’s after.
to a man with a hammer, every problem looks like a nail. to a man with a computer, every problem looks like a simulation.
You are in wrong context… The simulation argument does not assume the use of specific technology, the simulation(s) could be surged by whatever you want , computers , future technology, inside conscious agents of mind or even brain in a jar..
It works for Thor
David thats exactly what I feel about this. I was born with computers and I dreamed about being the character of a video game, simulated by someone else. I think everyone born in that era that had an interest in computers went through that. Its funny after 45 years its now a theory.
TBQH, it would not be that difficult to simulate our species, because if you look at us in terms of intellectual demographics the individuals of superior intelligence (who would place the most strain on the simulating computer) are few in number. The overwhelming majority of the species are literal NPCs who of the “eat, work, sleep, procreate, consume” variety that don’t need too many flip flops of a logic circuit to fathom. Guys like Einstein or Maxwell or Hawking however, would have been a simulating computer’s worst nightmare come to life-code.
@@rockermilano You missed his point.
Interesting thing about your point about the resolution of the simulation.
If it goes down with simulations being embedded into one another, does that mean it would increase as you expand outside of each simulation?
The simulation doesn't need to produce the whole universe, or even a small localised part of the universe. It doesn't need to maintain absolute consistency with known physical laws. All it needs to reproduce is the input of your senses and your thought processes about that input. Even the most advanced physicist only ever directly perceives a tiny fraction of all that they 'know' to be true. And the brain already has well-known circuits dedicated to making sense of inconsistent or confusing stimuli. It's pretty much the primary function of perceptual systems. Our brains synthesise and confabulate information with such rapidity and ease, and then engages other circuits specifically aimed at making us think those confabulations are true.
In a sense, we are all living in a simulation because that's literally what our brain is doing for us in every waking moment.
From my humble understanding of the simulation hypothesis (SH) I thought the "calculation of details" issue had been addressed. They say that the outcome does depend on whether someone is paying attention or not and point to the double slit experiment for this.
In the double slit experiment we get an interference pattern, if no one is checking which slit every single photon went through. But, if we do observe for every photon which slit it went through, then the interference pattern vanishes. For proponents on the SH this points to the "physics engine" not caring about these details as long as no one is looking.
PBS space time has a fascinating video about the "quantum eraser" where they show how this even seems to be working backwards in time. In a clever setup the photon hits the screen and only after that they measure which slit it went through. This is enough to make the interference pattern vanish as well.
For the SH this means that it simplifies reality at first, but if it turns out later that the details were important, it goes back and puts them in.
This might take some time, but as we are part of the simulation, we don't notice, because we are put on hold until this has been done.
To be clear, I don't believe in the SH, but it is not easy to dismiss.
My main gripe with it is that the SH is unfalsifiable and that puts it into the category of pseudoscience.
Not pseudoscience, but outside the domain of science. It's more a philosophical construction, or a thought experiment.
"This might take some time, but as we are part of the simulation, we don't notice, because we are put on hold until this has been done."
That's a *really* important point, and it refutes Sabine's claim that it may be impossible for simulations to run other simulations because of the recursive complexity. In reality, the simulation could simply pause to produce any computationally intensive result, and then resume, such that an 80 year lifetime inside the simulation might actually take 10,000 years to simulate; and the simulated people would be completely unaware of this!
Again, this points to the true problem with the simulation hypothesis, that it is not falsifiable. Like many religions ;-)
5:08 Plot twist: our universe not just a simulation, it's also written in Javascript. 😱😱😱
Ah, that explains why the speed of light is so damn slow.
Bah. Commodore Basic FTW!
Now that is a nasty idea. The simulation hypothesis on its own is bad enough. But imagine those whole universes full of javascript! Ugh.
Oh good lord.
that would be pretty sick, cause we could find the client side code and become masters of the universe
Your videos are just pure gold
While I know you will be right, I would like to pose just one example of systems that effectively don’t compute what isn’t being actively observed. And that would be something like a computer game. They have worlds, and inhabitants that are there doing things when you’re there actively watching or interacting , but the game doesn’t compute the entire world at all times, just what is around the player at that moment. To save on resources they maybe have a rudimentary background system operating on a much lower level, which then is ramped up to more complex systems when you’re present. I do think this could help explain the sheer computational power needed and how there could be shortcuts in a universe simulation to reduce overheads.
Also, as a complete lay person who watches videos about quantum physics, it does seem convenient that things can behave differently when not actively observed versus being observed. When very intelligent people describe a universe seemingly based on a system like that I can’t help but imagine how well this could fit into a simulation universe as well. There’s probabilities but only when it’s actively observed does the universe calculate an outcome.
Also, I do absolutely agree that there looks like an element of faith involved, which is something I’m uneasy with, but if we really were in a simulation this advanced I can imagine there being mechanics of it we simply could not comprehend that could explain how it all works that seems to be beyond our own current theorising. I mean NOBODY knows or has an explanation yet for how this all got here, real universe or simulation. We’ve dug deep but there’s clearly way more levels yet to decipher.
The weather outside is frightful, but Sabine's so delightful...
there's actual snow out here
Summary :
"We are a simulation" has no evidence.
"We might be a simulation" can't be proved impossible yet.
It's clearly both.
Yes, thank you. Too often people claim something is possible just because we don't know how to prove it is impossible.
"God" has no evidence.
"Maybe God" can't be proven impossible yet.
There you go.
@@petros_adamopoulos Which is why I can't accept the god 'hypothesis' either.
@@petros_adamopoulos The fallacy with both claims of no evidence (simulation theory and God) is that evidence is redefined by those that claim there is none. Evidence for a particular idea does not require no other explanation. Evidence is not proof. Thats a common erroneous conflation. Thus in a murder case opportunity and motive is evidence against a defendant . It doesn't matter if there are alternative motives and others with opportunity. Again evidence is not proof. The defendant may in fact be entirely innocent and still have evidence of guilt. There are numerous evidences for God (which is why around 90% of the population including some scientists believe in god. You just label their reasons as nonevidence because you have alternate explanations (many of which you have no evidence for ). However alternate explanations doesn't negate evidence. they are just alternate explanations for evidence.
Mario concludes that he cannot be in a simulation because he is unable to build an NES out of mushrooms and coins
I WAS rolling my eyes at that exact point when you mentioned it😂👍
0:55 The being outside the simulation doesn't have to be all knowing or omniscient. They just have to have access to more information and and more control over our universe than we do. For instance an outside developer could make changes by observing and allowing an event to play out giving them knowledge of an occurrence. They could then rewind the simulated event and make a small changes and do it over and over again till you get the perfect results. For the beings inside the simulation they would only perceive The single pass through but the beings manipulating the simulator reality will be viewed as omniscient and all powerful when in fact there anything but in their layer of reality.
Ok but that's still making a ton of ideologically assumptions about the simulator and we're still left with the more glaring problem: we have no reason whatsoever to posit that we're in a simulation, whether on evidentiary or logical grounds.
This lady makes learning things I know nothing about very entertaining for me.
This video is really needed! Another point she could make is that Bostrom is assuming that a human brain can be massively compressed in silicon etc. If consciousness actually comes from microtubules or RNA, then the most efficient thing in the universe for simulating a human brain is a human brain. Sometimes there's no substituting for the real thing.
Anthropomorphic argument
Interesting Video. I think that it's somewhat semantics on whether this is a "simulation" or a "real world" with real laws. One difference might be that presumably a sim would have some limits to its fidelity, and some magic to save computation and memory. But don't we see this? The planck scale is the distance limit. And the uncertainty principles define the max precision of the advanced machines running the Universe. The quantum fuzziness prior to observation is a great way to save computation and memory akin to how selective rendering is used in computer games. The discretization part could merely be a design choice though (we do this all the time); The fuzziness to me is more indicative of a sim.
Another diff could be that a sim almost certainly implies a higher power being involved while those believing in a "real world" differ on whether there was a god or things merely arose from a big bang. However, those people can't tell us where the conditions that created the big bang came from. So not too different on this front really.
I think we'll easily prove that it's possible we live in a sim. But to ever really know for sure might remain a matter of personal belief.
I've never thought of it as a scientific argument. Just an argument on probability with very honest assumptions. Like how many theories are based on the universe being infinite?
even a "probability" argument would in some sense have to be scientific as a prerequisite. At least if the argument tries to make claims about reality, you cannot do that without observing a part of reality first, which is a scientific process.
Putting it another way, suppose someone wanted to calculate the probability of a planet within X solar system containing water. They would have to, at a bare minimum, observe a number of planets in the solar system without water, and then contrast it with the number they find with water. You cannot do this by just sitting in your chair and doing math. You have to actually *look* . So to say you're not making a scientific argument, but a probabilistic one based on scientific observations, is without a difference.
What we experience personally is a simulation in the truest sense.
That's not what she's referring to.
If your brain simulates things so you can operate in the world according to it's rules, survive and flourish doesn't mean the whole world is simulation itself. It's just your brain.
@@markiv2942 or rather our perceptions, a result of our brain making predictions and simulations
@@AdaptiveApeHybrid Exactly. Our consciousness is literally the simulation algorithm running in the thalamocortical cognition cycle of the brain, integrating sensory inputs with stored experience and projecting/predicting external reality.
@@kenlogsdon7095 you're clearly much more technically experienced with this than me, well put!
When coding computer games, 3d models that are far away from the observer are usually a less detailed version than what is closer to an observer, likewise map areas not looked at from an observer is not rendered at all
Very well done. I always thought the simulation theories were bogus us for two reasons. 1. That you would generally need a system bigger than the system you are simulating if you want to simulate it exactly and nested simulations would become impossible at some point. 2. There is the stopping problem especially for nested simulations. If any of the simulations above us stops we also cease to exist. The longevity of our universe seems to show this is not the case. Both these point to the real world more likely being base reality rather than some kind of simulation.
Time is irrelevant for this. We could be going through a million years while the simulation in one higher level might be going through a minute. It just comes down go the processing power. In fact since we know that the idea of present time is an illusion, this would likely be the case in case we are in a simulation.
@@Taunt61 And in any case the simulation could easily just "appear" to have been running for X amount of time, or return any result to internal queries that the external programmer decides it wants the internal subjects to receive.
And it's very simple to disprove the 'size' requirement. A VR headset, e.g. Oculus Quest, always and universally creates a simulation environment that is (or rather, appears) "bigger" than the object in which the simulation is created. For those inside the simulation, the physical world of the external programmer is as inaccessible as the 'real world' is for characters in a video game (which are of course the obvious example of simulations that we so far have created).
@@nowandrew4442I think it’s preposterous that people take this theory seriously whilst claiming it is somehow fundamentally different from monotheism.
We don't know if their reality or laws of physics are the same as ours. Again we need proof but there is no way of getting this proof. Also consider that not everything needs to be simulated. Looking at something under a microscope might just be procedurally generated and nothing else is around what is seen.
This is how science communications should be done. I love your channel.
I love how Sabine says 'hypothesis.'
I like how she says "matter".
Calculation.
I realized I love how she says all the words mentioned in this thread.
Or how she can't say hypothesis, but we love her anyway.
@@RobertsMrtn
I live in Germany most of the time.
My mom is German.
Germans have a very phonetic language.
There are no spelling bees in Germany because to hear a word is to know its spelling.
Germans also do not have the 'th' sound and it is difficult for Germans to say words with 'th'.
Sabine does just fine with her pronunciation of English, especially with 'th' and 'w' and 'v' sounds.
Verstehen Sie?
Verstehst Du?
Verstanden?
:)
I think you're missing the crux of Bostrom's Hypothesis, it was that you **cannot** out rule that we are living in a simulation, not that he proves we are.
Thanks for this video Sabine... it's good to always have an objective take on various trendy science topics. It is as you say-- until there is some way to properly test the hypothesis, it remains outside the realm of science.
Humans: make simulation to simulate reality
also humans: "wait reality looks like a simulation"
It doesn't tho
To paraphrase Douglas Adams, because our memory ain't clear enough to quote:
"Man, the maker, looks around at the world and says to himself, 'So, who made this?'"
Always has been
This is exactly my point
Nice, LOL
Recently, Sabine says she has learned to love pseudoscience. Sabine has also shown that the simulation hypothesis is pseudoscience. Therefore, Sabine has learned to love the simulation hypothesis.
Fallacious conclusion
Hmmmm? What?
I love women. Your mother is a woman. Therefore I love your mother?
Do you not yourself wonder how it is whoever is simulating (let us say) X can have any idea whatsoever of what X is a simulation, and the reason that the so-called simulation hypothesis is gibberish is that it falls to pieces the moment you ask: "of what is X a simulation?"
It is such a daft meaningless hypothesis that it seems to suppose that simulation is of another simulation or resembling yet another attempt to mimic or imitate something.
The hypothesis simply falls to pieces when you ask of what the simulation supposed to be a simulation does it not?
Sabina is very wise. Very interesting. Very intelligent. Also, the only simulations you’re aware of is the video. Prove that wrong and your in high cotton.
I love the clarity in regards your presentations; outstanding Sabine..may I call you Sabine)🍃
Excellent. I am happy that people like you exist!!!
The simulation argument is a statistical argument with a sample size of 0.
It will be 1 after I successfully simulate a brain, it doesn't need to be that real of a simulation to deceive most non-scientists.
Yup. This is actually a much better argument than the video. Or maybe more to the point I think the video failed to make the connection between, not knowing if we can make a simulation in our universe of our universe, and without having that ability having no way of even hypothetically getting statistics on other levels of simulation in universes with perhaps different rules than our own.
@@peterisawesomeplease You assume that our simulated universe (edit: I mean what we simulate) must be as complex as we live in right now. What if we simplify things by a lot, for instanse Sims: for a sim that world could be as real as this world for us. Maybe the overlaying universe is much, much more complex than we can ever comprehend.
@@Sekir80 "Maybe the overlaying universe is much, much more complex than we can ever comprehend."
Oh totally possible. That is quite a departure from the original argument though(the original argument assumes that the simulation we are in is from a future state in our universe). It is also a much harder argument to come up with a way to falsify. Which is PsychedelcChameleons point. Yes there could be a higher level universe where simulating our universe is easy. But there is just no way of knowing how likely that is. The sample size is 0. This makes it questionably scientific.
@@peterisawesomeplease Are you sure it is "totally possible"?
Because I don't think you can know that... with a sample size of overlaying universes of 0...
I think what you mean to say is: "we don't know that it is impossible".
"In science we require explanations for how something works." Do we?
What is the explanation for collapse of the quantum wavefunction? How does entanglement work? Why is the strong force 137x larger than the electromagnetic force? What explains the ratio of the electron mass to that of a proton? What can we say about the interior of a black hole? Why can't we see the large majority of the matter and energy necessary to explain the large scale structure and dynamic behavior of the universe?
There are huge areas of QM and GR where we don't have explanations, yet we find it useful to use them nonetheless.
When legit physicists take ideas like multiverses, the 10^500 landscape and Boltzmann brains seriously, its rather slippery to draw neat lines of this type between science and pseudoscience.
Probably the best argument against the simulation hypothesis is the one you brush past at the beginning: Neil Tyson might believe it.
Agree with everything except the uncalled for dig at NDT.
The search for the answers to these questions is still ongoing, so not having them yet doesn't help the simulation theory's chances.
Love the dumping on that clown NDT. Tyson contributes nothing of value to science or scientific research.
@@piccolobolding5059 what about the people he inspires to be scientists? Like him or not, he does contribute in that way.
Collapse of the quantum wavefunction is just one interpretation of QM mathematically indistinguishable from any of the others (that don't violate Bell's Inequality) and only matters to how we think about this unintuitive physics, not how it actually works. "Entanglement" is nothing more than the conservation of certain properties such as momentum, energy, or spin across interactions, and is only mysterious if you choose to interpret QM in ways that make it mysterious. One of the most important properties of a black hole is that it doesn't matter what's inside; it makes literally no difference to the rest of the universe.
But you know you can always go for the ultimate and just ask "why is there something instead of nothing?"
The answer is nobody knows, but as long as you say that and try to find out, instead of declaring there to be an answer and taking it on faith that it is so, then you're doing science.
I really like your video's. Thanks Sabine!
Also I love your top, it's got a low key cyberpunk vibe going on
I don't think you should limit the simulation to being run on the type of machines we have developed so far. Obviously the 'computer' running the simulation of our universe is a tad more advanced.
But again that’s exactly her point, a more advanced computer that can simulate the universe is based on faith, not science. It could happen in the future or anywhere in the universe, but it’s not something we can do now and we might never be able to do it. Regardless, I still think we do live in a simulation.
@@niceone1456 true, the only problem in the hypothesis is that it exists within our reality, simulated by humalike methods.
@Michael Lochlann bro those are video games. Also cpu and gpus do have a verifiable limit (the atom). Video games are As much akin to a "simulation" as a Shakespearean play. They’re made up of textures, meshes, and code which is not even remotely similar to how the real world works, they’re just a portrayal of the real world, exactly like a play.
This episode is flawed from the base. Bostrom’s argument is not the one displayed and commented.
It is more like this :
1- civilization(s) end before able to do simulations
2- civilisation(s) do not want to start a simulation
3- we are in a simulation
Choose which one you want .
Number one I think
@@jamesmcmillan2656 possible.. the point is that all of Sabine's speech does not touch the subject of simulation argument at all..
This, exactly
To arrive at that state where we can even talk about civilizations reaching capabilities to build simulations there is hidden begging of question: while the argument is praised as if it discusses this universe, for the third conclusion which is used to justify 1 and 2, we actually already stepped to some other assumed universe.
How this is justified is by assuming that a civilization in this universe could simulate an exact copy of their own universe. Which is unscientific because it creates an absurd physical problem about information. Just as you can't assume your house is a miniature inside someones living room just because you can build a miniature house in your living room, you can't just assume bigger universe with more information because we can simulate simple things.
So it really does boil down to appealing to god or higher being: a level above reality is assumed so that the argument makes sense, and only justification for that is our ability to create very small and crappy simulations. It doesn't just scale up with technological advancement, unless you secretly already assume there exists other larger universes where this iterative chain of simulations takes place.
Which is done when the argument secretly assumes these civilisations take place in arbitrarily large universe. You can in an argument assume other civilisations than human (if you can explain away our current data), but you can't assume other universes, especially ones with completely different rules.
Except in philosophy. There is no reason to not build such argument as philosopher, if you clearly state you are building an ontology that is not bound to this reality but in fact creates a whole larger theory to explain the existence of this reality. But your friend is just as allowed to say a being omniscient from our perspective could do this as well, and neither of you are any more informative about our existing material reality.
@@catcatcatcatcatcatcatcatcatca the simulation argument is not assuming in any way that a civilisation in this universe could simulate an exact copy of their own universe.
And so to speak , it may be an approximate rendering of what is observed by conscious agents inside the simulation. The more it may be that each level of simulations use less resources than the upper levels and more resource than the lower ones, and so on. Nobody has stated such “exact copy”.
If in ten years , 100 years or in a billion years civilisation(s) run a simulation, then hypothesis 1 is excluded. If civilisation(s) can do but not want to, is the other possible hypothesis (2).
Else if we are not in a simulation, it implies that all the possible civilisation of the universe , our civilisation included, are doomed to die before.
Thank you, for helping me understand loftier subjects.
Sadly, from 4:50 on, this video demonstrates a misunderstanding of how virtual clocks work and how virtualization in general works, even on our current “primitive” computer level. Sorry to say that.
I don’t mean to say we live in a simulation, because I don’t think it matters and I don’t think we have a way to find out. I don’t believe in the simulation argument. I’m just explaining why one specific counter-argument presented here is wrong.
The assumptions at 7:05 and afterwards are flat out wrong. Here’s an oversimplified summary of a way to avoid an “observable inconsistency” perceived by the simulation’s guest environment.
- Stating the obvious: When you simulate a universe with civilizations, you observe, in real time, whatever they “observe”.
- Each time they “observe” something you don’t like, you stop the simulation, fix your virtualized environment, rewind the simulation to a snapshot before their “observation”, restart the simulation. Rinse and repeat.
- Understanding the step above goes back to my introductory gripe about (mis)understanding of virtual clocks.
- On the next level, to make the simulation progress faster with fewer stops and rewinds, the simulation can be forked a massive number of times with slight variations introduced to each replica. The most “promising” branches (think of them as UNIX processes with fork() if it helps your intuition) are allowed to develop further whereas the ones that malfunction, “collapse” or perhaps expose virtualization to the guest environment are stopped (what an euphemism) to free up computing resources for the more promising ones.
That’s all, that’s it. There goes the “observable inconsistency” argument.
Notice that there’s nothing that would require this ”simulation development model” to cover the size spectrum in its entirety, all sizes at once.
This is (again) because there is no need to avoid an “observable inconsistency” at all cost. When you spot an inconsistency - next branch, please / last snapshot, please! No big deal.
The thing is, if you made a simulation of a (part of a) universe, you don't have to follow any specific set of natural laws exactly. From within that universe, whatever laws were there, approximate or not, would just be "the laws" of nature.
I agree the hypothesis does make the assumption that whatever is running the simulation may need to intervene. But the thing is we would be totally unaware if the simulation was paused, rewound, tweaked, and fixed in case any flaw was observed in universe that leads to the discovery of the simulation. I don't think that's as hard a problem to solve as Sabine does. If you're running the simulation of course you can detect when something with agency in the sim starts seeing evidence of the sim.
I do think the idea that anyone will ever be able to run any sims on the equivalent of their laptop is ludicrous, these would be planet scale computers simulating tiny pieces of a universe to high fidelity. And you wouldn't be able to run a simulation of a universe where it was possible to do much interstellar travel, or you wouldn't run it that long, or you'd kill off any progress made to that.
I guess my point is just that I don't think it's hard at all to argue that everything we observe *could be* simulated, it is all within the realm of possibility. But to take it on faith, well, that's just faith.
True, but the bit about the laptop sim I don't agree with - you don't have to simulate a universe with QFT/GR, you only have to simulate the experience of a single guest consciousness (or any number you want), and just render its surroundings like any computer game (that can run on your laptop now already!). How many have actually looked at quantum particles with their own eyes? You could easily simulate the entire environment with pre-fab experimental HEP-TH papers all over the place without actually simulating the experiments themselves :)
@@ingeniouswild which is why the dual slit experiment is spooky to me - it looks like an optimization that simulates what "should" have happened whenever someone was looking
“I dare you” to god shutting off the simulation is priceless I subscribed immediately
He would die of boredom, come on.
To who?
I LOVE Her sense of humor!!! The way she delivers it is absolutely priceless!
"How DARE you"
Unfortunately, she does not realize that she (or any of as for that matter) doesn't count. I expand: if you write a genetic algorithm you only care about the outcome of it and you have no interest in the failed ones led to it. This means we are all just the stepping stone for the next generation and who knows how long this simulation will go. So, right now, no one is watching us, we are just run, therefor she won't be disappearing by "daring" the runners. :D
Isaac Asimov - "The Last Question" is basically the Simulation Theory. He wrote it in 1956.
It is a plausible explanation.
Why? Heisenberg: "...the smallest units of matter are not physical objects in the ordinary sense; they are forms, ideas which can be expressed unambiguously only in mathematical language."
I do love a well argued takedown of some currently fashionable nonsense idea. 🙂 Very entertaining / informational.
It’s honestly just delusional if we were in a simulation then we wouldn’t know we are in one right ?
I think this (saying the simulation hypothesis is pseudoscience) is a classical example of mixing logic/philosophy (or other not empirical science) with empirical science. As far as I know, the simulation hypothesis is a form of the "brain in the vat", or originally "evil demon" argument from Decsartes. This argument is used to impress upon us that we cannot know anything for certain except the fact that a thing that is thinking these thoughts at this moment exists ("I" or "me"). Everything else is uncertain. This is not an empirical argument per se but much more a logical one. If you mix this epistemological argument with probability (which is a very contentious thing in itself as far as I am aware of) you get the simulation argument. The point of the argument is, I think, that we cannot possibly ever know whether we are living in a simulation or not (even if it should be "likely" that we do live in a simulation according to Bostroms argument).
Concerning the physical arguments from the video I am not convinced: only 200, or say, 500 to be on the safe side, years ago nobody in their right mind thought we could split atoms, fly to the moon, have video-meetings or simulate the birth and life of galaxies (which we didn't know existed) on computers etc. etc. So of course we would today think that such simulations (as suggested by Bostrom) are not possible. Who knows what will be possible in 100 or 1000 years time?
So the simulation hypothesis is/can be logically or philosophically quite scientific. It is just not an empirical statement, a statement about the real world ("we do live in a simulation"). But to call something not empirical is not the same as it being unscientific: nobody would say that mathematics is pseudoscience though all of it is grounded in unprovable and completely abstract axioms.
It is very sad, I completely agree, that people who should know better, like Neil deGrasse Tyson do not and say stuff like that (i.e., derive empirical statements from non-empirical ones). This is quite scientifically illiterate imo. But I have heard "proven" or "bewiesen" in an empirical context so often from so many otherwise smart people, my ears have bled all out.
One last thing: pseudoscience is very, very hard to define... This is called the problem of demarcation and it has not been solved, as far as I know. But it's fun to think about! :) Like the simulation hypothesis or the problems of the definition and meaning of probability and all that good stuff :D
"60% of the time, it works everytime." - Anchorman
I realize there is an a apriori argument refuting simulation hypothesis. It comes from a published paper. I think the paper points out that in line with the thinking in this video, the simulation hypothesis is not a scientific hypothesis; And if it can be refuted, it can only be refuted non-empirically. And I think it does give a compelling case why we are not in the simulation, by showing that the thinking itself that we are in the simulation is nonsensical or incoherent.
Well.....I was actually getting anxious and fairly nihilistic as the theory took hold in me, slowly degrading my religious faith.....whether that is a logical response, I cannot as yet discern. However.....your well stated and cogent arguments permit me see that a belief in the theory is currently akin to transferring my faith elsewhere, but not relinquishing existing faith for a purported scientific alternative. And so, I thank you very much.....you have in a very real sense brought me back from the abyss!
Some scientists: The universe had no creator. Same scientists: the universe has a creator, and he lives in his mom's basement.
I'm not worried that someone might pull the plug, I'm terrified that it might be running on Windows.
And we know how crappy Windows upgrades can be!
Yet another Unix fundamentalist (I bet) likely not realizing the irony: Unix itself has been a religion ... for decades! Signed: #PlatformAgnostic :D (still gave you one like)
Not just Windows, Windows 7. (Last update, 2015.)
I'm worried that we might be running on Mac OS and get shut down because the upper level didn't pay their monthly bill to Apple.
@@rah938 Windows 7 is a lot better than later versions.
In the video the hypothesis is explained from the perspective of our technological capacity. If there is a higher intelligence, we do not know what would their technology be and if it has or not the capacity to simulate the laws of nature we have found so far. We cannot but maybe they can.
It's great to see a computational arguement against the idea.
“If you thought that science was certain - well that is just an error on your part.” Richard Feynman.
Yet the hypotheses surviving enough testing to be 'promoted' to 'theory' are so certain, only the logical conclusions of mathematics are more certain. No other method of inductive reasoning is as certain as the scientific method -- when it works.
Theoretical science isn't certain, that's why it is still theoretical. Science is the journey from theory to facts. Since the journey started centuries back we have already established many things that are Factually Certain. Don't confuse the places we've been with those still to discover. Where we've been are now Factually known, but where we are going are still just Theoretical mysteries. The journey continues.
Richard P Feynman. My hero. We owe him so much, but most people don't even know his name. Ty for his endorsement.
True, but I fear that people who post these quotes are saying in other words, "Since science isn't certain, there's nothing wrong with me taking something on faith."
This quote is not saying what you think it says.
Nerd scientist: simulation hypothesis
Occam: hold my razor
cringe
@@bingerasder6466 maybe a little bit
Occam's Razor gets it's ass kicked by Rapid Prototype Engineers every day of the week. It's great for indoctrination and snide observations, however.
Occam's razor actually proves the simulation hypothesis.
@@dirremoire why? It's totally unnecessary to add a more complex reality that simulates the actual reality, given that there are no proves and it's more of an intellectual tickle.
Not sure if I agree. To my knowledge, no one is claiming that the simulation hypothesis is scientific, and Sabine seems to imply that if something is not scientific then it must be religious or taken on faith. This is a false dichotomy. If this were true, then the classical Greek process of deduction or inference through pure reason would be classified as a religion, which is ridiculous. It's possible to arrive at a conclusion in the absence of direct empirical evidence through the application of logic to a set of premises that are by themselves not particularly controversial. I think that this is the key to Bostrom's argument. Each step is not particularly implausible. Humans create increasingly more sophisticated simulations, and in general we run a lot of simulations to understand the statistical properties of what we are studying. The resolution limit of our simulations is set by computational power, which is ever increasing, but eventually we would hit the Planck limit, which is itself an arbitrary scaling factor for our universe. If the universe simulates at a resolution below this limit, there is no way, even in principle, we could tell the difference.
I love how you say hypothesis.
I always love how the people like Elon musk and Neil deGrasse Tyson throw around these probabilities like “1 in 1000000000” or “better than 50/50”. Like how did they get their?? What formula did they use to calculate this probability? Does it work on known facts or do they add unfounded assumptions to make it work? It’s, like, explain yourselves!
> Like how did they get their??
From the same place Sabine got her "0%" probability of it being true. From their intuition, which they mistake for rational conclusion.
@@xs10z Sabine got her 0% probability from a rational analysis of irrational and unproven claims.
Neil and Elon got their numbers from irrational and unproven assumptions.
@@stemcareers8844 0% probability means impossible. The simulation hypothesis is not falsifiable. Therefore the analysis wasn't rational.
Each of them derived this estimate based on a very specific point in localized space-time that they instinctually pulled from, i.e., their asshole.
@@stemcareers8844
"Sabine got her 0% probability from a rational analysis of irrational and unproven claims.
Neil and Elon got their numbers from irrational and unproven assumptions."
0% probability means it's not even wrong. It means it's unfalsifiable. To prove that a Rolex unit is fake, you must provide another unit which is the genuine one, and then compare the differences between the two. To prove that our universe is a simulation/fake, you must provide information about the real one. So far, information from the outside of our universe has never contacted nor reached us.
So, the conclusion is either our universe is the real one, or our universe is indeed a simulation with one way information stream (only from our universe to the outside, not the other way around), aka the most perfect deception.
No need to simulate an entire universe - just simulate a single consciousness.
I don't think some higher intelligence being will stimulate entire universe for me, and only watch me playing with my pepe 1/4 of time.
@@bhagva8268 Well, I have bad news for you...
@@bhagva8268 Your “Pepe”? Lol
That approach also requires simulating the entire environment in which that consciousness finds itself embedded. A lot of what Sabine was trying to do was to establish that simulating that environment would be very difficult.
Assume you have a certain scientific/technological problem to solve. Just start 1,000 universe simulations with accelerated time so you have 100 trillion trillion people research it for 100 billion years while only a minute passes in your real time.
(A similar idea is used in the Perry Rhodan series where chaos ships have hundreds of thousands of pocket universes which they can use to develop a defense against a previously unknown weapon within seconds.)
The example of how would it be possible for a simulation to know when someone is looking at an area, and then fill in the detail - look at what the whole of quantum physics is based upon though - that outcomes appear to change when they're observed. Entanglement could be a convenient explanation out of that one, perhaps.
@Sabine I like your argument, however I have to add one observation (I work in the field of IP design for computing).
It is already the case that at a low level, circuit behaviour can be non-deterministic. This is partly a result of the extremely small size of modern silicon, and partly due to the extremely complex interactions of the architecture.
To some extent, that is also an argument against the simulation hypothesis. It is unlikely that you can have deterministic behaviour (e.g. chemistry, newtonian physics) that is absolutely reproduceable in any location, combined with the utterly non-deterministic behaviour of living organisms.
That physics works the same everywhere is an assumption we make because we haven't witnessed the opposite, but it might be the case that once in a full moon, at some point in the universe where you specifically are not, a minor glitch occurs. I would also challenge the notion that living organisms are non-deterministic, as they run on the same physics as everything else.
@@alronthunderdrummer I am really not an expert at this, but surely any system that is chaotic is by nature non-deterministic?
For example, we understand the principles of fluid dynamics quite well. However, it is extremely difficult to predict the exact motion of an individual particle.
We use this inability to predict (precisely) the results of an operation in devices as simple as a ring oscillator, to provide pseudo-random number generation. These are a common function in silicon to create unique cryptographic keys. Although we know the function of the circuit and its parameters, the output is not deterministic.
@@Alastair510 I'm no expert either, I'll have to admit. I think this might be one of those cases where we say the same thing but using words differently.
I think there is a difference between sensitive dependence on initial conditions, aka chaotic behavior, and an independence of initial conditions, aka non-deterministic, true randomness. at least that's how I see it. I might be wrong about the definitions, but as I understand it, it is deterministic if causality holds, that is, if the outcome is determined by the input. chaotic behavior is unpredictable without accounting for more variables than we can practically account for, but it is calculable in principle.
@@alronthunderdrummer for devices such as a ring oscillator, given a particular set of initial conditions, the output will vary. That it is somewhat random. Unfortunately not 100% random statistically you can predict a tendency towards a certain set of results.
Human behaviour is statistically predictable when you examine a population. However an individuals behaviour is extremely difficult to predict. This is why I believe the simulation hypothesis is not credible.