Alofs: A Steampunk Mousetrap for a Shotgun

Поділитися
Вставка
  • Опубліковано 29 вер 2024
  • utreon.com/c/f...
    / forgottenweapons
    Cool Forgotten Weapons merch! shop.forgottenw...
    patents.google...
    Contact:
    Forgotten Weapons
    6281 N. Oracle 36270
    Tucson, AZ 85740

КОМЕНТАРІ • 4,9 тис.

  • @richieb7692
    @richieb7692 2 роки тому +4718

    Considering all the springs, sliders etc, are all over 100 years old.
    I'd say its working really well
    Fantastic design

    • @keyboardstalker4784
      @keyboardstalker4784 2 роки тому +88

      They sure don’t make them like they used to.

    • @intrepidferret6704
      @intrepidferret6704 2 роки тому +22

      @@keyboardstalker4784 yeah, "the best designed product, meets you need and doesn't last."

    • @kenanderson3954
      @kenanderson3954 2 роки тому +68

      Yeah, it feels like a bit of calibration and fresh springs would make this thing run real smooth, it's impressive they've held up as well as they have though.

    • @BreakdancePeach
      @BreakdancePeach 2 роки тому +132

      @@keyboardstalker4784 In 100 years, a future soldier shoots a functional M4 Carbine or M16: "Wow, weapons from 2022 still work! They sure don't make them like they used to!!!"
      That's because all the bad products from 2022 already disintegrated. It's 'survivorship bias'. It's why you don't see the bad stuff from 100 years ago, because they all already broke down and were scrapped. I can't buy that things were magically better back then.
      Anyway, not directed at you in particular, but it's weird, the comments that don't think garbage American products and cheap con-artists were JUST as common back then. The issue was seriously so bad, that they invented an insult so popular it still exists today -- "Snake oil salesmen".
      Aside. I'm so happy Ian finally did a video on the Alofs. I've been wanting to see this for a long time.

    • @immortal218
      @immortal218 2 роки тому +4

      Springs at 2.54 are not that old

  • @custardavenger
    @custardavenger 2 роки тому +141

    I'm sure when new, and with some fine tuning, that would cycle pretty well. There are lots of options to tune the device to match the gun its mounted on.

    • @mpetersen6
      @mpetersen6 2 роки тому +6

      And places for it to get out of alignment. In a way it reminds me of the table saw I've got for just general use. It's got a sliding table that movable on the fence rails which are moveable all on a sheet metal box with an cast aluminum table. Cuts nice when set-up properly. But it is a real PITA to get set-up.

  • @evanlee93
    @evanlee93 2 роки тому +36

    This is unbelievably cool. I love old mechanisms like this.

  • @johnbraadland9556
    @johnbraadland9556 2 роки тому +267

    I always wondered if there was a left handed version of this, so you could mount one on each side of a double barrel shotgun.

    • @prjndigo
      @prjndigo 2 роки тому +48

      Yes, but it wasn't production. You can actually mount one of these on a break double to keep firing the left barrel.

    • @This_is_my_real_name
      @This_is_my_real_name 2 роки тому +34

      If you mount one on both sides of a shotgun it would work, except for your being unable to _fire_ the thing! (Recall the _reason_ he could not shoot it left-handed -- this would make it impossible to shoot left OR right-handed!)

    • @Bozar91
      @Bozar91 2 роки тому +22

      I wonder if you could bubba some onto a Chiappa Triple Threat.

    • @Ezekiel_Allium
      @Ezekiel_Allium 2 роки тому +13

      @@Bozar91 .... imagine a custom device for a liberator quad barrel

    • @russetwolf13
      @russetwolf13 2 роки тому +1

      That's just the shotgun from Devil May Cry.

  • @notanuberweeb
    @notanuberweeb Рік тому +19

    this is actually one of the coolest designs ive ever seen

  • @_gungrave_6802
    @_gungrave_6802 2 роки тому +68

    Out of all the guns I've seen over the years this device is still one of the most fascinating things to me when it comes to firearms. It serves such a simple purpose even if its a bit finnicky in operation but so much ingenuity had to go into its creation.

  • @reecethurman4714
    @reecethurman4714 2 роки тому +11

    This is such a fun design, and the movement of the action is incredible!

  • @astridvallati4762
    @astridvallati4762 2 роки тому +52

    Dear Ian, I have a lot of fair to good H&R singleshots ( also Steven and Iver Johnson)
    In Australia, Pumps are highly restricted, but mechanical ( lever, straight pull) are not.
    So this design being totally manual operation ( not "Pump") would be quite legal ( and close to 100 years old!!)
    Your videos give me a good idea to reverse engineer this accessory to convert the numerous single bbl..break actions, which otherwise would be " chopped" as un-saleable.
    ( I am a dealer and manufacturer)
    DocAV

    • @jamesfisher9594
      @jamesfisher9594 2 роки тому +4

      I live in the US but have wanted one since seeing it on C&Rsenal. If you reproduced or just loosely base something off of the original I will buy one from you!

    • @abcdefghijkl123454
      @abcdefghijkl123454 2 роки тому +8

      @@jamesfisher9594 i believe you could just straight up copy it since the patent expired quite a while ago

    • @Matt_The_Hugenot
      @Matt_The_Hugenot 2 роки тому +3

      Even more restricted here in the UK. Even attaching one of these to a shotgun would land me in a whole heap of trouble.

    • @ecarlate
      @ecarlate 2 роки тому +1

      @@Matt_The_Hugenot i feel you, was wondering if that will be legal in france with all the restriction we have too lol

    • @SnoopReddogg
      @SnoopReddogg 2 роки тому +1

      Won't someone think of the Australian children????.

  • @fryfrom98
    @fryfrom98 2 роки тому +3

    This is the coolest gun attachment ive seen by FAR. absolutely beautiful action

  • @lanedexter6303
    @lanedexter6303 2 роки тому +16

    Fascinating! From the time period when MANY inventors were trying MANY things! You’re right, this Rube Goldbergian device has a steampunk vibe. It would be great fun to see it in a steampunk action movie.

  • @Shadow_Hawk_Streaming
    @Shadow_Hawk_Streaming 2 роки тому +82

    In defence of this, if someone is expecting to need more than 4 rounds than this they'd probably spend the extra money, but for someone with a single shot or just not willing to spend the extracts on a pump this could be a pretty good force multiplier

    • @overlyobsolete2797
      @overlyobsolete2797 2 роки тому +20

      The modern generation of gun enthusiasts who are invariably high speed low drag tacticool autists know jack shit about any shooting sports or hunting, pretty sure they only magdump paper silhouettes at 7 yards.
      Due to this, they can't fathom any purpose for such a device other than doing what they do. To them, the rifle or the shotgun will never be something that provides, it'll just be a toy.

    • @shoelessbandit1581
      @shoelessbandit1581 2 роки тому +5

      @@overlyobsolete2797 call of duty and it's consequences has been a disaster for the gun community

    • @Double_Vision
      @Double_Vision 2 роки тому +2

      @@shoelessbandit1581 That you, Uncle Ted?

    • @JennyGormanRitter
      @JennyGormanRitter 2 роки тому +4

      Jesus you guys are all cringe af. Yes Shotguns were primarily used as a hunting tool. Do you really think that's all people used them for? Really?
      Like I said. Cringe.

    • @JennyGormanRitter
      @JennyGormanRitter 2 роки тому +5

      @@overlyobsolete2797 stfu you're a part of said Generation. If you're Gen X then good for you, this is all arguably your fault. If you're older, gtfo off the internet and take your meds. If you're younger... then smfh cringe bruh.
      There's nothing saying you can't use this as a "force multiplier" if a group of people are trying to steal your cattle or break into your house.
      What, do you think crime just magically appeared in the last 20 years or something?

  • @Lodr222
    @Lodr222 2 роки тому

    Well thanks for wishing a wonderful new year. But I didn't expect I would see so many wonders this year.

  • @snifftheshark
    @snifftheshark 2 роки тому +1

    Whoever put that shiny Phillips screw on there is a lunatic

  • @EmreGhost
    @EmreGhost 2 роки тому +1

    If I were a game producer that recently been working on an FPS Shooter game, I would definitely add this very unique one to the game.

  • @splnter648
    @splnter648 2 роки тому +1

    Imagine the mess that would be a double barrel shotgun with 2 of these. It’d be so impractical it’d be perfect.

  • @theducksauce4851
    @theducksauce4851 2 роки тому +1

    This gun with modifications was just added to the game Hunt:Showdown. Its fun.

  • @thegentheadcrab7008
    @thegentheadcrab7008 2 роки тому +10

    As someone who lives in Grand Rapids it’s really interesting to hear about lesser known stuff like this instead of just furniture

  • @cgmason7568
    @cgmason7568 Місяць тому

    If it could recock the hammer on closing it may be my favorite invention ever

  • @theoneaboveall9930
    @theoneaboveall9930 2 роки тому

    I'd like to imagine copying the mechanism and putting it on both sides of a double barrel shotgun. So everytime you fire both, it reloads both barrels similarly to this one.

  • @TheLobstersoup
    @TheLobstersoup 2 роки тому

    If these tubes weren't so heavy and cumbersome, you could just pre-load a few tubes with shells and have a mechanism that lets you drop the entire front loading tube. Alternatively, you could have several (tube) magazines revolving around the barrel as you shoot and empty them.

  • @Balevolt
    @Balevolt 2 роки тому +6

    The could have made them longer to hold more shells, this thing is genius

    • @pretzelbomb6105
      @pretzelbomb6105 2 роки тому +2

      Weight is always a concern when dealing with weapons. The magazine is already throwing off the center of mass by being off to the right. Also, comparing it to popular Semi-auto shotguns of the time, the Remington Model 12 only held 5-6 in the magazine, so 4 shells in the magazine and 1 in the chamber is not bad at all.

  • @sincereflowers3218
    @sincereflowers3218 Рік тому +1

    Got the amount of maintenance this would need to me an everyday use weapon...

  • @YerluvinunclePete
    @YerluvinunclePete Рік тому

    The interface plate likely rotates on the centre stud shaft and only controls the forward and backward movement. So the oval holes for the other nuts do control the tilt

  • @mattwoodard2535
    @mattwoodard2535 2 роки тому +4

    I would expect to something like this in a BioShock game. This thing is excellent and thank you Ian for giving us a look at it. sm.

  • @Renard380
    @Renard380 2 роки тому +6

    I think even if it's a bit faster, the questionable reliability makes it a "for entertainment purpose only" device. But each successful operation is more enjoyable than the shot itself 😂

  • @Angelofdeatification
    @Angelofdeatification 2 роки тому +3

    Romero alamo loving this

  • @keithweiss7899
    @keithweiss7899 2 роки тому +4

    When Peter Kokalis died I wondered if there would ever be another person in the gun industry who could match him. Well, you surpass him in every way! Thank you for your knowledge and your ability to present it to me!

  • @joshgirndt4896
    @joshgirndt4896 2 роки тому

    I feel like this is actually meant to be a 4 + 1. Place 3 into the holding tube, 1 in the loading tube, and then after those are loaded, place one directly in the chamber. That way, the first shot becomes the spent casing which triggers the action, and the cycle begins naturally, instead of by a manual flick of the release or by placing an already spent casing into the gun

  • @ShogunMongol
    @ShogunMongol Місяць тому

    A Turkish firearms maker, Sulun Arms, has made a new age version of this action, called the ST-601 or the "Auslof" because from what I can tell, this might act as some sort of loophole potentially in their laws, not quite sure though. This company is also responsible for a lever action revolving shotgun in 410.

  • @macmacdonald9565
    @macmacdonald9565 2 роки тому +4

    Hunt Showdown vibes intensifies

  • @WEMS20
    @WEMS20 Рік тому +2

    Ah, yes...the days when the mosin nagant were "cheap".

  • @simqbi4135
    @simqbi4135 2 роки тому

    this would be a perfect thing to implement in game or a movie where guns never jam

  • @curtisdowling3773
    @curtisdowling3773 Рік тому

    Awesome!!! Perfect for the man who loves his break-open shotgun.

  • @supertonyjr8903
    @supertonyjr8903 Рік тому

    this would rock my socks off if it had some sort of shell catch in the ammo tube and if it was double mounted in a double barrel shotgun

  • @sheogoraththedaedricprince9675

    If there was a left and right sided version of this I would put it on a double barrel shotgun. I know that that dp-12 shotgun is around and you could get a pump but, I could easily see someone who already had a single barrel break action shotgun not wanting to have to buy an additional firearm would want something like this.

  • @zacharywranovsky
    @zacharywranovsky 10 місяців тому

    If you ever feel bad that your firearm of choice failed a Garand Thumb mud test, just be glad you’re not stuck with an Alofs

  • @daveh4914
    @daveh4914 8 місяців тому

    Never saw or knew about these until just recently. As I understand it, Sulun arms makes and sells new shotguns with this system in places like Canada, Australia, and maybe New Zealand. I can only guess it to be a fascinating response to draconian legislation in certain jurisdictions. If the Sulun arms auslof was available here in the US I would buy one simple because it is weird and mechanically interesting.

    • @SoMuchFacepalm
      @SoMuchFacepalm 7 місяців тому

      Yeah, this is the kind of thing I imagine making if the government fails and we go full Mad Max.
      Like a lever action converted to Gatling action rifle with a massive box magazine. Just add a power drill for a truly stupid rate of fire!

  • @steeperpeer5705
    @steeperpeer5705 2 роки тому +2

    Coming here again after hunt added alofs to the Ramiro

  • @nealjustus9500
    @nealjustus9500 2 роки тому

    this looks like an upgrade to the shotgun in a steam punk fps game. i love it

  • @stormthrush37
    @stormthrush37 Рік тому +1

    With practice, this could probably be even faster. You could train in to cock the hammer in the same motion you're breaking the action open, for example.

  • @davidintrabartolo5887
    @davidintrabartolo5887 Рік тому

    This is straight out of a Power to the People machine from the BioShock series

  • @kraven195
    @kraven195 2 роки тому

    i low key feel like the max shell count is 5 shots before reload, 3 in the long tube 1 in the transfer tube and finally 1 in the chamber ready to fire

  • @BryanCampoli
    @BryanCampoli 7 місяців тому

    This whoud come in handy during the depression hunters didn't need to spend a lot of money for a repetster

  • @iggysfriend4431
    @iggysfriend4431 2 роки тому

    This looks like a gun that is a accident waiting to happen.

  • @trippstewartm4a1
    @trippstewartm4a1 2 роки тому +7

    Romero 77 Alamo

  • @fdk7014
    @fdk7014 Рік тому

    A bit of lubrication in the feed system and it would work brilliantly I think

  • @dont_risk
    @dont_risk Рік тому

    The first automatic shotgun refile

  • @Girvo747
    @Girvo747 2 роки тому +2024

    The fact this thing works with 100 year old springs in such a Rube Goldberg manner and actually DOES work is amazing

    • @lukewarmwater6412
      @lukewarmwater6412 2 роки тому +36

      not realy. people took pride in their products back then, not at all like now.

    • @Zaque-TV
      @Zaque-TV 2 роки тому +29

      @@lukewarmwater6412 things made in the USA and not outsourced for cheap labor are very well made. Even down to some zipper pouches I bought. Support US made!

    • @nick4506
      @nick4506 2 роки тому +58

      @@lukewarmwater6412 spring steels now are way better. and back in the day there was no way to make something cheap because plastic didn't exist and international shipping was incredibly expensive. people didt take pride in there products, they cheaped out exactly as mutch as physically possible at the time. and stuff back then was stupid expensive like 32 bucks in 1927 is 521 today. you could buy a whole repeating shotgun for that money not just a conversion kit for that.

    • @chuckhoyle1211
      @chuckhoyle1211 2 роки тому +6

      The best thing about it is that even if it fails in some way, there is no danger to the user. You may eat a spring loaded shell, but I don't see a way to accidentally fire a shell out of battery with this contraption.

    • @Aliyah_666
      @Aliyah_666 2 роки тому +15

      @@lukewarmwater6412 Bro metallurgy was trash back then, pride....lol funny you said pride and meant cheapest possible solution.

  • @RTJsims
    @RTJsims 2 роки тому +548

    I am honestly shocked you guys didn’t slow motion capture the reloading sequence. We need that in our life.

    • @SundownMarkTwo
      @SundownMarkTwo 2 роки тому +56

      C&Rsenal has a video on the Alofs and has slow-mo for it.

    • @AbananaPEEl
      @AbananaPEEl 2 роки тому +34

      ua-cam.com/video/hNIkca8k1UQ/v-deo.html
      This is the C&R vid with the slowmo

    • @saintrico3456
      @saintrico3456 2 роки тому +10

      And as I watch the reload slow motion sequence for the 20 millionth time; I would need to have a backup tab open so when my wife walks in I can pretend I'm just watching porn.

    • @shooterqqqq
      @shooterqqqq 2 роки тому +5

      Check the settings in the lower right hand corner and select video speed.

    • @haylinpm8973
      @haylinpm8973 2 роки тому +2

      @@shooterqqqq I was about to say this

  • @Lethyss
    @Lethyss 2 роки тому +1209

    When I saw the shotgun in Hunt: Showdown with this system, I thought it was something weird created for the game.
    But damn, it's a real life design.

    • @DetectiveLance
      @DetectiveLance Рік тому +56

      Isn't it great!? I started playing Hunt again for the first time in a while and I was like "wait, haven't I seen this before..."

    • @thertsfan
      @thertsfan Рік тому +15

      I remember seeing this device attached on a double barrel shotgun instead for demonstration purposes, but I don't remember the video

    • @DetectiveLance
      @DetectiveLance Рік тому +13

      @@thertsfan Shit, now I gotta find that atrocious looking thing.

    • @thertsfan
      @thertsfan Рік тому +8

      @@DetectiveLance I'm not sure if I'm missremembering, could be that I mistook that device for a second barrel of a double barrel shotgun, been a long while

    • @gozadinhaplays69
      @gozadinhaplays69 Рік тому +7

      EVERY gun on hunt showdown exist in real life, they got these forgotten guns and changed their names for the game

  • @Vaultmon
    @Vaultmon 2 роки тому +713

    I don't care that pump and semi shotguns are available, I want one.
    Also, imagine if a similar contraption was made for the m79 grenade launcher.

    • @nothim7321
      @nothim7321 2 роки тому +38

      Who needs an m203 or m320?

    • @sarath431
      @sarath431 2 роки тому +78

      There exists something like that. It is called china lake. Its a pump action style grenade launcher. I too love to see a m79 with alofs system

    • @46jerdboy
      @46jerdboy 2 роки тому +31

      I think grenades would be too heavy / potentially dangerous (front to back misfire chance would be very low, but catastrophic).

    • @Vaultmon
      @Vaultmon 2 роки тому +45

      @@sarath431 I know. But pump action is not the same as alofs.

    • @sarath431
      @sarath431 2 роки тому +28

      @@46jerdboy - the weight is indeed an issue. However, the chances of exploding via dropping is less as the grenade require some arming distance like 5 mts. It'll be a rare case the grenade might explode upon dropping. I might be wrong on this.

  • @bfchristianbf
    @bfchristianbf 2 роки тому +3509

    i imagine what a device like that would look like for a double barrel,like two of these one on each side,or maybe just one for the 5 plus 1 ammo capacity

    • @mattandrews8528
      @mattandrews8528 2 роки тому +433

      Kind of like the Bioshock 2 double barrel capacity upgrade? I loved the look of it in the game.

    • @RalphReagan
      @RalphReagan 2 роки тому +29

      Yes! :)

    • @Excalibur01
      @Excalibur01 2 роки тому +353

      It'd be like if Kel-tec existed in the 1800s

    • @calvingreene90
      @calvingreene90 2 роки тому +86

      A longer magazine tube with two transport tubes and one spring pushing both shells out at the same time so that they load the correct barrels.

    • @User-dc6sm
      @User-dc6sm 2 роки тому +54

      you'd have a steampunk DB-12 or DBS

  • @timfoster7979
    @timfoster7979 2 роки тому +578

    I have one mounted to my Grandfather’s Champion 12ga. The barrel has had so many buckshot shells run through it the top end has grooves.

    • @nickmaclachlan5178
      @nickmaclachlan5178 2 роки тому +15

      Not wanting to be a Safety Sally, but with that much wear on it, I'd probably retire it to a mount on the wall......... you don't want it blowing up in your face.

    • @dai2dai246
      @dai2dai246 2 роки тому +51

      @@nickmaclachlan5178 why ? If the chamber is fine, you won't have issues. It isn't a rifle, you can drill a shotgun barrel without it exploding...

    • @youtubeSuckssNow
      @youtubeSuckssNow 2 роки тому +38

      @@nickmaclachlan5178 as long as the chamber is fine then theres nothing really wrong with it. Theres not really anything that would make a shotgun barrel explode

    • @dundun8640
      @dundun8640 2 роки тому +8

      please post a video i have no idea what you said but it sounds like something i want to see (the grooves (i have no idea what top end means))

    • @colejosephalexanderkashay683
      @colejosephalexanderkashay683 2 роки тому +1

      totally do a video of this

  • @infamoushacker4chan883
    @infamoushacker4chan883 2 роки тому +3310

    Honestly, I *love* this. It screams steampunk, but unlike random exposed gears on a hat, it has practical use. I wish I were a machinist so I could recreate this with modern carbon steels and for today's standard shell length.

    • @AmaraTheBarbarian
      @AmaraTheBarbarian 2 роки тому +307

      I wish you were too, because I'd like to purchase a left and right pair and cobble them onto a dual triggered side by side for the most absurdist BS I can come up with...

    • @canobenitez
      @canobenitez 2 роки тому +282

      "but unlike random exposed gears on a hat" shots fired

    • @t4nkychannel921
      @t4nkychannel921 2 роки тому +78

      @@canobenitez Most likely from an Alofs, no doubt.

    • @airplanemaniacgaming7877
      @airplanemaniacgaming7877 2 роки тому +34

      @@t4nkychannel921 you can hear the singe-shot-turned-lever-action shotguns!

    • @cookieschocchips5551
      @cookieschocchips5551 2 роки тому +29

      You'd also need to be a gunsmith... As a machinist though, those parts wouldn't be impossible to manufacture. (Unfortunately the law and my lack of a modern lathe prevents me from manufacturing them)

  • @Abatement7
    @Abatement7 2 роки тому +332

    What is more impressive is the spring tension is still good after 100 years

    • @tochka832
      @tochka832 2 роки тому +10

      probably is replaced tbh, but who knows

    • @Oblithian
      @Oblithian 2 роки тому +20

      I suspect that may have been the source of malfunctions. Or people doing it improperly like that one instance.

    • @mpetersen6
      @mpetersen6 2 роки тому +13

      As long as the springs haven't been compressed and released 100Ks of thousands of times and gotten rusty there's no reason they should have failed.

    • @fairulaiman9648
      @fairulaiman9648 2 роки тому

      If it on my table, i rather swap the spring with semi auto revolver prototype in the early videos and add up grips to improve the chamber capacity and stable rate of fire.

  • @Pcm979
    @Pcm979 2 роки тому +311

    I've always wanted to see two of these mounted to a double-action shotgun as an upgrade in an FPS. In real life it'd be a hilarious disaster, but in the world of say Bioshock it could work perfectly and look cool doing it.

    • @Attrixine
      @Attrixine 2 роки тому +43

      So effectively something to increase the firerate of the doom super shotgun

    • @Louber1115
      @Louber1115 2 роки тому +20

      The reload would take a good 20 minutes 😂😂😂

    • @vahidmoosavian6313
      @vahidmoosavian6313 2 роки тому +10

      That'd be awesome!!!
      Unless BF vanguard team gets wind of it😒.

    • @notablediscomfort
      @notablediscomfort 2 роки тому +8

      have the ammo tube work like a magazine so to reload you twist a thing and slide it off then put another one on. but have a different animation for topping off where you just top it off normally.

    • @abysswalker2594
      @abysswalker2594 2 роки тому +4

      Metro would work in that 2

  • @ABCDEFGHIJKELA...
    @ABCDEFGHIJKELA... 2 роки тому +223

    A pocket full of shells, and a proper break action(with eject) is pretty damn fast once you get used to it, so I can understand why this didn't catch on. It's still beautifully designed, considering how raw everything is, and being a lover a mechanical movement, it would definitely be a wonderful item to have!

    • @creakycracker
      @creakycracker 2 роки тому +20

      I remember watching my Dad take out 4 phesants in about 5 seconds by keeping 3 shells in the web of his left hand. I practiced this technique as a boy but never got as good as he was.

    • @TheMulti313
      @TheMulti313 Рік тому +6

      I would imagine adding a lock of some sort to keep the feeder away from the chamber, so you could still operate it as a regular break action would've helped. Its like the SMLE'S with the magazine cutoff so you could feed fire it, but still have a mag ready if you needed it. Would've worked wonders for bird shooting.

    • @samuelstacey2309
      @samuelstacey2309 10 місяців тому +1

      I think you are spot on, I completely agree! Though I too am a lover of fine mechanical movements lol. So we’ll put, like clockwork!

  • @groundscorecuisine9959
    @groundscorecuisine9959 2 роки тому +337

    Im possibly more impressed with this than any other gun on this channel, and I've spent countless hours watching. Thanks for finally getting this footage out here bro. I love the complex engineering with no thought given to practicality. "we'll make it work, damn it!" I can just hear the guys designing this awesome thing

    • @jeffpayne4697
      @jeffpayne4697 2 роки тому +14

      I think between modern design and manufacturing techniques you could do a modern version of it that would be pretty dope

    • @absalomdraconis
      @absalomdraconis 2 роки тому +7

      And you know what? For bird or skeet shooting, this is every bit as practical as a single shot so long as you have the right length of shell.

    • @TheOrangeRoad
      @TheOrangeRoad 2 роки тому +4

      This is cool af, but I still gotta give it to that 40 or so shot chain pistol, where the chain goes through the handle

    • @groundscorecuisine9959
      @groundscorecuisine9959 2 роки тому

      @@absalomdraconis not really cuz you need to cock back the hammer too. Maybe some kind of crazy linkage?

    • @Nerdnumberone
      @Nerdnumberone 2 роки тому

      I'm personally impressed by the various attemps at repeating blackpowder weapons.

  • @U6kCtBuN
    @U6kCtBuN 2 роки тому +570

    im almost certain the issues with loading in and out of the intermediate tube are an issue because of modern oversized shells causing increased spring tension and i would love to see this thing ran with ones closer to what was intended, just in case it could operate flawlessly a century old

    • @thamojster
      @thamojster 2 роки тому +69

      I was thinking it might be because hes not tilting the barrel downward so gravity can take it further than the spring can travel, it seemed like every smooth load he had he had that barrel angled further down, and every jam it was near level

    • @xferth
      @xferth 2 роки тому +16

      Maybe just boring the tubes and new springs would let it load easier its hard to say without it all disassembled but man would it be cool to see a modern one running. but i think you right the shells are just a tad bit bigger. but the fact it does work close to 100 years later shows craftsmanship

    • @gavinperch9413
      @gavinperch9413 2 роки тому +1

      I dunno a lot about guns but I was thinking that maybe brass shells might work better but that thought is based on my (possibly misinformed) recollection that old shotguns used brass or paper shells.

    • @conmcgrath7174
      @conmcgrath7174 2 роки тому +3

      Holy shite! I was just about to make a similar comment but read yours and got spared some embarrassment/ repetition? Shells in that time were most likely made with waxed cardboard, the more yielding edges (waxed) might have seen this thing run flawlessly.
      Cheers and Pax,

  • @MrPanzerDragoon
    @MrPanzerDragoon 2 роки тому +722

    As much as I love seeing the modern and advances milled weapons out there, THIS TAKES THE CAKE for just the sheer cleverness of the homegrown style, steampunk like, design.

    • @MrPanzerDragoon
      @MrPanzerDragoon 2 роки тому +12

      @@industrialvectors yeah, it's steam punk like for sure. But it's just one of those unique work arounds. Not all work arounds are pretty, I will have to admit, but when they work...it just shows there were some hard and clever thinking involved. I love it!

    • @zealot777
      @zealot777 2 роки тому +5

      I would say more diesel punk. But it works for both.

  • @adamshira6368
    @adamshira6368 2 роки тому +916

    Someone needs to remake this with modern materials and manufacturing, for no other reason than just because it would be cool!

    • @StreakedSilver
      @StreakedSilver 2 роки тому +43

      Get Brownells on it

    • @stevenlee798
      @stevenlee798 2 роки тому +14

      I'm sure Mr Novak would be delighted to take on this project 😀

    • @stevenlee798
      @stevenlee798 2 роки тому +2

      I'm sure Mr Novak would be delighted to take on this project 😀

    • @jacobmccandles1767
      @jacobmccandles1767 2 роки тому +14

      Im also sure you're looking at quite a price in today's world.
      The Krag-jorgensen for instance would be about $3500 worth of machine work.

    • @anilin6353
      @anilin6353 2 роки тому +15

      The ender 3 goes brr my friend

  • @wesleykupic627
    @wesleykupic627 2 роки тому +1010

    Just the sound of that reload; all the springs, levers, movement falling into place perfectly is beautiful

    • @acomingextinction
      @acomingextinction 2 роки тому +31

      It's so satisfying. It's the sound of mechanical rhythm.

  • @ObsoleteVodka
    @ObsoleteVodka 2 роки тому +551

    Would be cool if someone makes an entire gun around this concept. Impractical for sure, but undeniably cool.

    • @This_is_my_real_name
      @This_is_my_real_name 2 роки тому +37

      I'm surprised there was never a field artillery piece that used this concept. Maybe they didn't want to pay his patent license fee?

    • @noahboat580
      @noahboat580 2 роки тому +54

      @@This_is_my_real_name seems too complicated to make an alofs-styled magazine tube for an artillery piece, especially when manpower is its own action for any artillery piece.

    • @bstrd5573
      @bstrd5573 2 роки тому +20

      This is the whole definition of steampunk:"very impractical, but very cool looking"

    • @Schregger
      @Schregger 2 роки тому +27

      @@bstrd5573 Was about to say, "impractical, but cool" is the whole point of steampunk. Now, you make something like this for a double barrel side-by-side, that would be a interesting videogame gun.

    • @maxpulido4268
      @maxpulido4268 2 роки тому +7

      Going bankrupt is never as cool as it seems

  • @XWar_LockX
    @XWar_LockX Рік тому +266

    Theses are the kinds of "weapon modifications" I love to see. Really would like to see things like this in more FPS games

    • @nightraven836
      @nightraven836 Рік тому +18

      would be awesome to see in a Fallout game.

    • @nazaryunis2443
      @nazaryunis2443 Рік тому +17

      its in hunt showdown as the romero 77 alamo

    • @XWar_LockX
      @XWar_LockX Рік тому +1

      @@nazaryunis2443 Awesome!

    • @theshellderinslowbrostail5422
      @theshellderinslowbrostail5422 Рік тому +4

      There is a weapon like this in Warframe called the Rauta

    • @1SilverDollar
      @1SilverDollar Рік тому +3

      ​@@nightraven836would have been a beautiful mod for the single shotty

  • @Genny207
    @Genny207 2 роки тому +514

    The only thing that disappoints me about this video on such a cool mechanism working, is the fact that we didn't get to see any high speed footage of it. Getting to see it work in slow motion I think would be REALLY cool!

    • @matthaught4707
      @matthaught4707 2 роки тому +39

      Check out C&Rsenal's videos on it, they have some slow-mo of it operating with snap caps.

    • @ThraceVega
      @ThraceVega 2 роки тому +36

      tadaaaa! ua-cam.com/video/hNIkca8k1UQ/v-deo.html

    • @matfhju
      @matfhju 2 роки тому +7

      They had so much funn with this system that they probebly forgot about it XD

    • @xmanhoe
      @xmanhoe 2 роки тому +2

      You can slow down the video speed 😉😎

  • @akaLethal
    @akaLethal 2 роки тому +186

    The Alofs seems to load more reliabily when the shotgun barrel is pointed towards the ground. Most of the hiccups occured when the shotgun barrel was at or near horizontal. It appears that when the barrel is pointed down, the shell is able to slide a bit further into the chamber which helps it to clear the receiver when closing the action. I bet a thorough cleaning and perhaps light oil on the chamber would aid reliability as well. Very cool video, nonetheless. Thanks!

    • @silentferret1049
      @silentferret1049 2 роки тому +20

      I would give in part that the spring more than likely being original could be weaker than new so that could cause the bind ups.

  • @StopMoshin
    @StopMoshin 2 роки тому +239

    I'm surprised I haven't seen these in Hunt: Showdown, considering that they have something as niche and weird as the auto Mosin, which is a Huot conversion on a Mosin Nagant which wouldn't work for obvious reasons.

    • @ZezacleB
      @ZezacleB 2 роки тому +19

      I AM HERE SPECIFICALLY THINKING ABOUT HUNT
      Was loading up the game to see if the Romero had a Manual Hammer or not while scrolling through the comments. Absolutely love that someone else was thinking the same thing LOL

    • @MatigrisSH
      @MatigrisSH 2 роки тому +16

      That on a Romero would be OP.

    • @andrewlavoie6034
      @andrewlavoie6034 2 роки тому +6

      You can make auto mosin conversions, the one ingame has only a few problems, but I mean Fedorov was doing it

    • @Skulgar321
      @Skulgar321 2 роки тому +12

      @@andrewlavoie6034 Avtomat is a general term for automatic weapons (AK, AN) the Fedorov is a ground up weapon. The mosin would require a bolt turning mechanism, the Fedorov is a recoil operated rifle.

    • @kaniodon
      @kaniodon 2 роки тому +7

      I saw someone present this gun in the suggestion channel on the Discord a couple of months ago and it was swiftly downvoted to hell unfortunately

  • @lordmado3918
    @lordmado3918 2 роки тому +10

    Ah yes the Romero Alamo.

  • @h.a.9880
    @h.a.9880 2 роки тому +427

    The whole design, the basic idea and the intended market... This is absolutely genius. And to think it runs this well after a hundred years, I would not be surprised if those hiccups were very uncommon when it was brand new. And even if that wasn't the case and it had those hiccups out of the box, it's still nothing more than a tiny inconvenience to an amazing, useful gadget.
    If you squeezed my arm and forced me to come up with anything that could be improved, I'd suggest to add a lever that disconnects the feeding tube tilting mechanism, so when the main tube runs out of ammo, the feeding tube gets fixed in place so you can manually reload without the feeding tube getting in the way.

    • @TheHatori1
      @TheHatori1 2 роки тому +37

      I love how the designer encounters a problem, finds a solution and not only makes it work, but also makes it kinda universal. Which is why I think that it wasn't flawless even back in the day - it seems that the main problem is the fit, not springs or something. Either way, systems like this are what makes me interested in weapons from engineering perspective, even though I have never had an oportunity to shoot one.

    • @1978garfield
      @1978garfield 2 роки тому +13

      I suspect the springs are worn out.
      Not so much from use but from age.

    • @khrisna-k1x
      @khrisna-k1x 2 роки тому +1

      I think I have the faint image of the feeding mechanism to the magazine(?) but not the problem of the feeding tube get on the way.
      For my image, just make some sort of one way resistor(?), make it active when the feeding tube in reload state and disabled when in feeding state.
      For your problem, adding some mechanism that doesn't conflict with the feeding tube's spring is kinda hard. Maybe like add some mechanism to the spring under the the feeding tube where when the feeding tube is empty, the feeding tube slide to the side more when the gun's barrel closed by tweak the already existed spring's mechanism or add some new. That might also can solve the problem of barrel alignment issue if the spring can be adjust.

    • @h.a.9880
      @h.a.9880 2 роки тому +4

      @@khrisna-k1x I was imagining a little plunger that gets pushed out when the feeder tube is empty and then arrests the inward tilting. As long as there's a cartridge in the feeder tube, the feeder tube is movable, when the feeder tube is empty (ie: no more ammo in the magazine) the feeder tube gets fixed and you can just use the gun like a normal break-action.

    • @jth_printed_designs
      @jth_printed_designs 2 роки тому +1

      @Jorj Yeah, it looked like a tuning issue. If the transfer chamber was limited in how far down it swung then it wouldn't bind the shell half way into the chamber. It would be in good alignment and the hiccup would disappear.

  • @codyopperman5930
    @codyopperman5930 2 роки тому +492

    17:02. You can see the problem that causes the boble to be necessary. The transfer tube is over too far. The adjustment screw is probably worn from use, and needs to be tightened so the tube doesn't go so far. Or replaced, depending on if it will move.

    • @lunarpking
      @lunarpking 2 роки тому +45

      It's REALLY close to being right too, I could see it being fixed easily.

    • @Noarisonn
      @Noarisonn 2 роки тому +8

      Also the angle that Ian is breaking open the shotgun is a bit upward for the camera to see if he pointed it down the way most people operate a break action it *might* be a little more reliable.

    • @ethinos2719
      @ethinos2719 2 роки тому +10

      One of the screws on the transfer tube turned easily as he was handling it during the show-n-tell portion of the video. I wonder if it was still loose when he was shooting it.

    • @daviddomanski4872
      @daviddomanski4872 2 роки тому

      @@Noarisonn I noticed that too! It was always smoother with a more muzzle down barrel position.

    • @UH1Phil
      @UH1Phil 2 роки тому +1

      And perhaps the spring is worn too. A little bit more spring pressure might do it good.

  • @epejija9519
    @epejija9519 2 роки тому +7

    Hello from Hunt: Showdown community!

  • @jeffprice6421
    @jeffprice6421 2 роки тому +555

    When this was new, I don't think people had the expectation of flawless function that we have today. So the little bobble to get the round to feed would have been taken in stride and without much notice... Very cool. Tinkering at it's best.

    • @sgas
      @sgas 2 роки тому +12

      I thought it was old and that's why it's not perfect

    • @DjDolHaus86
      @DjDolHaus86 2 роки тому +35

      Yeah there is also the cost factor of upgrading the single shot break action you've already got versus buying a new pump action to consider. It doesn't have to work perfectly straight out of the box, it just has to work well enough for the price and offer enough fine tuning for someone to make it work better

    • @beargillium2369
      @beargillium2369 2 роки тому +2

      So you've never heard the phrase "they don't make em like they used to"

    • @Gameprojordan
      @Gameprojordan 2 роки тому +21

      @@DjDolHaus86 iirc this thing came out around the time pump actions were first introduced. So they were expensive enough where this design was an actual cost effective alternative at retrofitting a commonly owned single barrel break action shotgun into a repeater shotgun

    • @MasterN64
      @MasterN64 2 роки тому +6

      I very much doubt this though. There are many examples of firearms this old and older that are semi auto or pump actions that function basically flawlessly and they would have been the standard at the time. This would have absolutely been looked on unfavorably and its easy to tell that it was considering that the concept never caught on and it faded into obscurity.

  • @TimperialBroadcastingAgency
    @TimperialBroadcastingAgency 2 роки тому +345

    This is where you can really see that Ian is, deep down, a mechanist that loves mechanisms. He just really wants this to work and is so happy when it does.

    • @evilparadigm
      @evilparadigm Рік тому +5

      That's me too. I love the French(I think it was French) MG that has the little rod supporting the iron sight that corrects the sighting, as the barrel of the MG heats up the sight post. It's one of the guns Ian reviews. I do a lot of #D printing and am excited to get into gun smiting some day!

    • @Zorglub1966
      @Zorglub1966 Рік тому +3

      @@evilparadigm I love this kind of "tricks" too. It's the Saint Étienne (*) Modèle 1907 (*) pronounce "saintaetiaenn" all vowels shorts

  • @katori.mp4647
    @katori.mp4647 2 роки тому +491

    This looks like a badass videogame upgrade, never thought I'd see someone so cool irl

    • @danbell3827
      @danbell3827 2 роки тому +46

      It really does, like something from metro, to turn a single shot into a magazine fed gun, made out of scrap tube and springs.

    • @lxDastanxl
      @lxDastanxl 2 роки тому +19

      a lot of players from hunt showdown are asking for it so since the game it's actually going well they may try to put it in this shotgun it's call Romero in the game

    • @Sn0ws519
      @Sn0ws519 2 роки тому +5

      @@lxDastanxl I was just going to comment this. I immediately thought of Hunt when I saw this, it would fit in perfectly.

    • @weaponizedautism3269
      @weaponizedautism3269 2 роки тому +1

      I wish we had this in hunt showdown

    • @walkingburgers95
      @walkingburgers95 2 роки тому

      @@lxDastanxl I saw this shotgun attachment about a year ago and my very first thought was "we need this in Hunt". It'd be really cool

  • @hootinouts
    @hootinouts 2 роки тому +364

    As a mechanical designer, I had my doubts about this contraption but after watching you work it out in the field, I am duly impressed.

    • @SeventhGod77
      @SeventhGod77 Рік тому +10

      The ability of Americans to make any weapon have more gun per gun is astounding.

  • @samuelneese482
    @samuelneese482 2 роки тому +272

    I'm amazed that it actually worked. I'd imagine that when it was brand new it probably functioned quite smoothly if it works this well after all this time. I think part of the problem might be that 2 3/4" shotgun shells are the norm nowadays but they weren't back when this was made. I have dug up a box of shotgun ammo that my grandfather had and it was 2 1'2" which leads me to believe that the shells this was designed for were 1/4" shorter.

    • @JCGver
      @JCGver 2 роки тому +22

      I wonder if any of the youtube machinists would be down for reproducing a one of, I mean with the patent in hand it shouldn't be impossible.

    • @beeboop1726
      @beeboop1726 2 роки тому +16

      Yeah I have a sbs made in 1921 and it has 2 1/2 inch chambers, 2 and 3/4 inch chambers weren’t that common until after 1930s

    • @absalomdraconis
      @absalomdraconis 2 роки тому +33

      @@JCGver : Honestly, this mechanism is so simple & straightforward that a lot of them wouldn't even need schematics. Working out the correct _springs_ would likely be the hardest part.

    • @Nerdnumberone
      @Nerdnumberone 2 роки тому +3

      It's made for an arbitrary shotgun and shell. You need to calibrate a lot when affixing the mechanism and probably be consistent with whatever ammo you use. I think that careful calibration and luck in picking the right shotgun and ammo would be significant.

    • @1978garfield
      @1978garfield 2 роки тому +2

      @@JCGver If they remake it they need to increase the capacity by lengthening the tube. Might as well make it barrel length. After they get that working they start on making it work the hammer automatically :)

  • @eliandominguez3575
    @eliandominguez3575 2 роки тому +67

    Crytek is literally taking note for putting this in hunt showdown

    • @RmacNet
      @RmacNet 2 роки тому

      Wait - for real? My first thought when I saw this was it needs to be in Hunt

    • @yurimanniello5286
      @yurimanniello5286 2 роки тому +1

      as i said before this thing belong to hunt showdown, romero variant would be fun entering compounds blasting like a k&k but with a damn romero

  • @graham1034
    @graham1034 Рік тому +111

    Given that it still functions reasonable well after 100 years, I bet it worked almost flawlessly when new.

    • @grimmjowjaegerjaquez3750
      @grimmjowjaegerjaquez3750 7 місяців тому +1

      And modern springs are way better. The design is solid and can use longer tubes for more ammo if you can handle the weight

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 2 роки тому +321

    This thing is genius. I imagine it started as “what if a cylinder holding a new shell could push the it into barrel automatically?”. And then each and every problem that arises was addressed one by one.
    Where does this cylinder come from? It pivots in when the lock is opened. How does the old shell get ejected? The ejected shell triggers the mechanism, so the cylinder only pivots in after successful ejection. How does the cylinder hold the shell in while not in action? There is a blockage on the side of the gun… Wait let’s put more shells held under spring tension there! Those shells get held on the side by an extra blocker when the mechanism operates.
    I think it looks steam punk because every piece is visible and has a simple function. It’s not that the mechanism is overly complex, but that it has many simple steps that none were hidden or integrated to one part. You can pretty much draw a circle between each and every part of the action, and end up with the whole shape of the visible area.

    • @peglor
      @peglor 2 роки тому +7

      This design could be tweaked do the same for a double barrelled shotgun too, especially an over under layout by putting two on one gun.

    • @ComotoseOnAnime
      @ComotoseOnAnime 2 роки тому +11

      @@peglor That would be kinda insane with an over under, effectively an 8+2 break action shotgun, on par with some modern magazine fed shotguns. And there's really no reason the feed tubes couldn't be extended with lighter modern materials to potentially double capacity, or use a more effective spring to allow for shortie shells to be used, potentially adding a couple more shells in as well.
      Just imagine loading an entire box of ammo into one of these things lmao.
      OOoo, you could also potentially make detachable tube mags, something similar to an SRM 1212, with a little spring loaded catch to prevent shell expulsion that would be interfaced with a nub on the receiver, which would cycle two shells into the moustrap elevator thing to be cycled into the gun. I can think of a half dozen ways to improve this design to make it higher capacity and more reliable.

    • @BleedingUranium
      @BleedingUranium 2 роки тому +7

      @@peglor I would love to see a pair on a side-by-side, it would be so wide hahaha

    • @njones420
      @njones420 2 роки тому +5

      I'd like to see a scaled-up one on an M79.

    • @clonemarine1
      @clonemarine1 2 роки тому +1

      @@njones420 How different would that really be from a China Lake? lol

  • @casey1441
    @casey1441 2 роки тому +251

    This mechanism seems more complicated to design than the whole gun, and I love it.

    • @absalomdraconis
      @absalomdraconis 2 роки тому +7

      It's like half a step past the complexity of those twin hammer revolver.

    • @frbe0101
      @frbe0101 2 роки тому +4

      Its the really weird reloading mechanism that I love about this channal more then anything else.

    • @Motleydoll123
      @Motleydoll123 2 роки тому +2

      I am suprised they didn’t have some varient showing up in either a western game, steampunk game, or a post apocalyptic game. Like it could fit so well as a shotgun mod for a single barrel shotgun, or if you get wilder, a double barrel with 2 on each side.

    • @frbe0101
      @frbe0101 2 роки тому

      @@Motleydoll123 I can see doomguy with a double barrel version now!

  • @Farfetchd.
    @Farfetchd. 2 роки тому +16

    This video single handedly brought this attachment to Hunt.

  • @jubuttib
    @jubuttib 2 роки тому +140

    The fact that it's such a weird design, managed to be a cheaper combination than an actual repeating gun, worked back then, and STILL mostly works today with nearly 100 year old springs... I'm honestly flabbergasted. I don't even have a shotgun, yet I want one of these. Someone will surely come up with a 3D printable design (with store bought springs and metal pipes) for this at some point.
    EDIT: And it wouldn't even be that much more difficult to design some quality of life improvements into this, like a cut-off for the loading mechanism when empty, so that it doesn't get in the way of loading manually after you run out, cartridge stops, etc...

    • @pouncepounce7417
      @pouncepounce7417 2 роки тому +14

      no need to 3d print, all parts are either tubing, plates or springs or bars, minimal workshop equipment should be enough

    • @sirapple2406
      @sirapple2406 2 роки тому +4

      Loading cut off could be done by having the follower stick out slightly into the “loader” thereby basically jamming the system, all you’d need then would be a slot and hole in the follower and magazine tube to pull back the follower.
      Or just have a slot going all the way down the magazine tube attached to the follower allowing you full control over it.

    • @TylerMcL3more
      @TylerMcL3more 2 роки тому +5

      Lol- that’s the first thing I thought too! My friend is actually about to start modeling this as they’ve been wondering exactly how it works for years… and Ian’s explanation explained the last bits so… design time!

    • @TylerMcL3more
      @TylerMcL3more 2 роки тому +10

      @@W1ldt1m the reason is that it’s cool- why must you hate that what which is nifty?

    • @alexisrivera200xable
      @alexisrivera200xable 2 роки тому +3

      Flaring up the tubes a millimeter at the ends would clear the feeding issues and would speed up the loading process while at it. its a clear simple design so its not difficult to improve on it to up the reliability.

  • @Senator_Byrd
    @Senator_Byrd 2 роки тому +54

    9:22 Imagine the creator and his boys having this same excited “heh heh!” over 100 years ago

  • @Dumorimasoddaa
    @Dumorimasoddaa 2 роки тому +37

    The idiotic dream of setting up two of these or similar on a double barrel like some dumb video game upgrade path is real.

    • @moomeansmooable
      @moomeansmooable 2 роки тому

      Theoretically you could run two of these on a side by side above the barrels and still have a sight picture

    • @Barefoot-Bob
      @Barefoot-Bob 2 роки тому

      with 2 brass 7 round extension tubes and a brass 1800s rifle scope .

    • @moomeansmooable
      @moomeansmooable 2 роки тому +2

      @@Barefoot-Bob dear lord imagine how front heavy that would be. Still worth it

    • @joshuahadams
      @joshuahadams 2 роки тому

      @@moomeansmooable you could probably do something kinda silly with this idea if you built the gun from the ground up for it. Mag tube and barrel side by side with your stock centred between them. Fire control group on one side and transfer tube on the other. It’d probably end up being handed though, putting the barrel on the side facing in.

  • @JimTheZombieHunter
    @JimTheZombieHunter 2 роки тому +40

    I love how this channel focuses on historic and obscure .. and sometimes unique and bizarre - firearms engineering rather than how many pumpkins can be blown up. You bring a certain awesome class and honest respectability to shooting.

    • @gsilva220
      @gsilva220 Рік тому +2

      It's like Jay Leno's historic car show

  • @JazzKazoo0930
    @JazzKazoo0930 2 роки тому +712

    For anyone wondering what the price in 1924 equates to now, $6 then is a bit under $100 and $20 then is about $325 now. So to buy a single shot break action and this add on would run you about $350 to $425 today as opposed to the $575 that the price of a factory repeating shotgun is equivalent to today

    • @cycoholic
      @cycoholic Рік тому +64

      So essentially still worth the bang for your buck. 😂👍

    • @travisdoe4663
      @travisdoe4663 Рік тому +95

      I would imagine a lot of people at the time already had a single shot shotgun.

    • @FirstGameFreak1000
      @FirstGameFreak1000 Рік тому +108

      @@travisdoe4663 this is the real answer, repeating shotguns were a fairly recent invention. You could either spend $600 on a new one when the single shotgun you own does basically the same thing, just slower, or you could spend $100 to upgrade your single shotgun to something that even closer to the same thing as a repeating shotgun.

    • @OntarioBearHunter
      @OntarioBearHunter Рік тому +2

      the new versions of these are 399 Canadian

    • @garyslayton8340
      @garyslayton8340 Рік тому

      ​@@FirstGameFreak1000not really drones have existed since ww1
      Its just a casw of convenince

  • @doomer_to_boomer2402
    @doomer_to_boomer2402 2 роки тому +511

    The ingenuity of the designers of this era never ceases to amaze me

    • @ASlickNamedPimpback
      @ASlickNamedPimpback 2 роки тому +7

      Einsteins in the 18th century
      Well, besides actual Einstein but yknow

    • @burieddagger8064
      @burieddagger8064 2 роки тому +16

      @@ASlickNamedPimpback Einstein wasn't born in the 18th century, he was born in 1879, which is the 19th Century. This conversion is from the 1920s, so the 20th century. It's actually from 1923, the same year Einstein gave his Nobel Lecture "Fundamental ideas and problems of the theory of relativity"

    • @H4FF
      @H4FF 2 роки тому +7

      I always find this intriguing. Does their ingenuity surprise us because it was a 100 years ago, and we don't see people as quite as advanced back then? They weren't less intelligent or resourceful, they simply did not advance quite as far technologically. I do get what you're saying, but when I catch myself thinking like that I sometimes wonder if there is some weird kind of "bias" going on. Similar to how it surprises us when ancient civilizations made very complex and sophisticated buildings and artwork, for example.

    • @yourlocalweebfriend3537
      @yourlocalweebfriend3537 2 роки тому +4

      Its merely a matter of ‘We do with what we have’ kind of mindset

    • @tomwoodrow5494
      @tomwoodrow5494 2 роки тому +3

      @@H4FF Man kind has had great knowledge for many centuries, engineering principles have not changed that much either. Devices like these are amazing not because of what they do, but rather how they were made. Modern tech could make this device easily, how it was made 100 years ago, mainly by hand, that is the amazing part. This device is no more complicated that most timing machines out there now, the challenge is timing needs precision. I might try to make one, does not look that hard.

  • @Dr._Nope
    @Dr._Nope 2 роки тому +82

    This gun needs to be put into video games, it's so ridiculously cool! This thing looks like it should be hunting vampires and werewolves in Victorian England or something! 😂❤

    • @animanera89
      @animanera89 2 роки тому +7

      If they ever make another Dishonored game with less stealth and more "boom" I NEED something inspired by this to be in it!

    • @theduckaholicgamer7976
      @theduckaholicgamer7976 2 роки тому +3

      Could even work as a Star Wars blaster or red dead redemption shotgun.

    • @axtondragunov1784
      @axtondragunov1784 2 роки тому +5

      Edwardian England because queen Victoria died in 1909

    • @Murzac
      @Murzac 2 роки тому +2

      @@axtondragunov1784 Eeeh you can bend those rules a bit for this. Especially if you're making something with a steampunky vibe in the first place. Like if you put this thing in a victorian era steampunk game, nobody would bat an eye.

    • @-John-Doe-
      @-John-Doe- 2 роки тому +1

      A little anachronistic but I don’t think it’s implausible for it to have been developed earlier.
      Of course virtually everything steampunk / fantasy is implausible anyway.

  • @Ki115witch
    @Ki115witch 2 роки тому +5

    Hunt Showdown community sends it's regards!

  • @_ArsNova
    @_ArsNova 2 роки тому +110

    This would be a fantastically cool device to fit on my old single-barrel 16-guage shotgun. Shame this Rube Goldberg of a device is long out of production.

    • @misanthropichumanist4782
      @misanthropichumanist4782 2 роки тому +10

      Wonder if a modern version could be 3D printed?

    • @Bramble20322
      @Bramble20322 2 роки тому +9

      @@misanthropichumanist4782 probably, 3d printed stuff is very fragile though.

    • @onpsxmember
      @onpsxmember 2 роки тому +7

      @@Bramble20322
      That highly depends on the base material mix.

    • @TheVexCortex
      @TheVexCortex 2 роки тому +8

      @@Bramble20322 3D printed parts are about 60% as strong as injection molded parts of the same material, so not as fragile as you think. The springs would need to be metal, and the pins would need to be metal, but I think everything else would be fine 3D printed.

    • @1101agaoj
      @1101agaoj 2 роки тому

      @@Bramble20322 proof-of-concept 3D printed AR receivers are a thing now

  • @NO_LOVE_LOST
    @NO_LOVE_LOST 2 роки тому +470

    I get the steampunk associations, but I think this also fits really well into the fallout universe (or any post-apocalyptic setting). I can totally picture some survivors building this out of scavenged parts and various break-action shotguns (imagine a double barrel one with this system! ;D) to get the upper hand against raiders because more advanced weapons are rare and hard to maintain

    • @caliber5302
      @caliber5302 2 роки тому +15

      It just works

    • @ledocteur7701
      @ledocteur7701 2 роки тому +14

      yeah, it would be awesome in a fallout game, especially since there already is a fairly advanced weapon upgrade system that allows aesthetic modifications.
      someone should totally make a mod for it.

    • @CNSninja
      @CNSninja 2 роки тому +3

      I would love if they put this in Fallout 5. We wouldn't get to see it until probably 2029, but still.

    • @dist0rted320
      @dist0rted320 2 роки тому +8

      Double barrelled with two mechanisms? DOOM guy approved.

    • @mcrwoell
      @mcrwoell 2 роки тому +4

      It was recently added into hunt showdown, as an upgrade to one of the early game guns, the romero (a standard break action shotgun.

  • @Ciel1820
    @Ciel1820 2 роки тому +82

    I'd love to develop a 3d print for one of these to modernize 'em a bit. It would take a bit of fiddling with the spring strength to get perfected. It's such a cool design yet it's a shame we don't have any modern continuations of this patent.

    • @gruntysskim4145
      @gruntysskim4145 Рік тому +21

      absolutely do it my man, that's what 3d printing is for.

    • @TylerLL2112
      @TylerLL2112 Рік тому +7

      I have seen many comments like this. Yet, nobody has done it. There must be some gotcha that we don't see until we work on it. I too intend on messing with this idea. Though, in .410 as that's the only break action I have.

    • @paddy2019
      @paddy2019 10 місяців тому

      You can get new ones in Canada. As far as I know, they work pretty well.

    • @ShitfazeMigee-cu1vt
      @ShitfazeMigee-cu1vt 9 місяців тому

      Don't fiddle with the design 😂 it's 100 years old and it most likely functioned perfectly out of the box. I'm sure you could improve it but don't fix an issue that doesn't exist

    • @ALWhite-ub1ye
      @ALWhite-ub1ye 9 місяців тому

      ​@@paddy2019are they sold under the same name? Did they ever produce one in .410?

  • @seifertak
    @seifertak 2 роки тому +1576

    Okay, I need this immediately in Hunt: Showdown! One of the coolest mechanism I've ever seen.
    EDIT: Well, it's in the game now but it turns out it's painfully slow and dogshit compare to Spectre. Shame.

    • @mattsmustang65
      @mattsmustang65 2 роки тому +61

      I was just thinking this looks like something that would be in that game 🤣

    • @nathanhammond3860
      @nathanhammond3860 2 роки тому +37

      It sounds like it would be a bit out of the time frame of the game but it would fit perfectly.

    • @seifertak
      @seifertak 2 роки тому +54

      @@nathanhammond3860 You maybe right but look at Avtomat. That is completely random meme weapon, also the Bomb lance. This is kinda steampunkish in the same way imo.

    • @nathanhammond3860
      @nathanhammond3860 2 роки тому +9

      @@seifertak yeah I see where you are coming from. The only other issue is balancing it.

    • @weaponizedautism3269
      @weaponizedautism3269 2 роки тому +34

      @@nathanhammond3860 There are zombies in this game
      I don't think slightly inaccurate weapons would be issue

  • @raygumm
    @raygumm 2 роки тому +102

    Love Ian's dedication to the shot hiding his terror over the guy seemingly breaking his Alofs loader! Great video as usual!

    • @matthaught4707
      @matthaught4707 2 роки тому +38

      I'm amazed he lets me shoot any of his guns anymore.

    • @raygumm
      @raygumm 2 роки тому +20

      @@matthaught4707 you handled it exceptionally well. I would have been mortified. Would love to see outtakes of this episode!

  • @schiz0phren1c
    @schiz0phren1c 2 роки тому +122

    Surprised we haven't seen this beauty in a movie/series yet,
    that is an iconic mechanism!,
    awesome!,
    thank you again for another great video Ian!

  • @maxanderson8872
    @maxanderson8872 2 роки тому +283

    This is exactly the kind of ahead of its time design that would work in a game like hunt showdown, especially since they already have a single shot break action gun

    • @Crow_Mauler_
      @Crow_Mauler_ 2 роки тому +10

      Very happy too see yet another hunt showdown player in the comments. I main the terminus, how about you?

    • @OverlordHD36
      @OverlordHD36 2 роки тому +3

      Oh no .. not a semi romero ... not like this ... :D I'd love it

    • @DoctorFrostbite1
      @DoctorFrostbite1 2 роки тому +8

      Congratulations, you just called it. Its in the upcoming update, basically a new variant of Romero 77 called Alamo

    • @blurpleshark
      @blurpleshark 2 роки тому +2

      CONGRATS 6 MONTHS LATER AND ITS HERE IN GAME

  • @sqeeye3102
    @sqeeye3102 2 роки тому +88

    I've wanted to see one of these actually run for a very long time, thank you for showing it off for us.
    Also, my heart skipped a beat at 16:24 when it looked like 100 years of mouse trapping was finally over.

    • @alifr4088
      @alifr4088 2 роки тому +7

      "Oh you broke my alofs!"

    • @8bitarmory846
      @8bitarmory846 2 роки тому +1

      I had no idea what to expect when I saw this comment

    • @matthaught4707
      @matthaught4707 2 роки тому +1

      Imagine how MY heart felt!

  • @_starlegion
    @_starlegion 2 роки тому +48

    I can’t believe it…. I’d never thought I’d see the day where this would get a review. Looks like Wednesday is the day of prayer for our love for Gun Jesus.

    • @thatmckenzie
      @thatmckenzie 2 роки тому

      m.ua-cam.com/video/hNIkca8k1UQ/v-deo.html

  • @mrjockt
    @mrjockt 2 роки тому +47

    I’m pretty sure Othias did a video showing how this contraption worked a couple of years ago, it was a pretty short video just to show that it did actually work.

    • @nymfan1990
      @nymfan1990 2 роки тому +7

      He did. I knew it looked familiar.

    • @cvmaniac7286
      @cvmaniac7286 2 роки тому +3

      Yea, it was one of their breakdown videos if i remember right.

    • @LadyAnuB
      @LadyAnuB 2 роки тому +3

      He did and here's the 2 videos on it:
      ua-cam.com/video/hNIkca8k1UQ/v-deo.html
      ua-cam.com/video/tbXOFkmKyiY/v-deo.html

    • @vicarus2728
      @vicarus2728 2 роки тому

      I bet this is the same gun

    • @mrjockt
      @mrjockt 2 роки тому +4

      Got to admit, it’s unusual to see what we in the U.K. would class as a “Heath Robinson” (or a “Rube Goldberg” if your American) device for a firearm that actually works as advertised.

  • @charles_wipman
    @charles_wipman 2 роки тому +55

    It's a really pimp device, i can't belive that after almost 100 years works so well; happy new year to you and your family too.