How Does COVID-19 Testing Actually Work?
Вставка
- Опубліковано 11 чер 2024
- Sars-Cov-2, the virus that causes Covid-19 is easily the most defining feature of 2020. In the last 8 months the world has changed radically and there have been plenty of fumbles as countries struggle to deal with the chaos. One of the most important issues has been testing for the virus. In this video, I aim to demystify how that testing actually works down to the chemical level and show exactly how it's done. We'll be covering the viruses anatomy, as well as three types of test: PCR, LAMP and Antibody.
Earlier videos:
PCR - • Everything You Could W...
Gel Electrophoresis - • Gel Electrophoresis: H...
___________________________________________________________________
Try tab for a cause today:
tab.gladly.io/thethoughtempor...
___________________________________________________________________
00:00 - Introduction
04:00 - Virus Anatomy Overview
09:45 - PCR Overview
13:30 - Performing PCR
20:37 - Testing at Scale and Robots (Opentrons)
23:30 - LAMP overview
27:50 - Performing LAMP (Biofoundry)
30:30 - Pros/Cons of Genetic Tests
31:30 - Antibody Overview
32:50 - Performing Antibody Test
34:00 - How Antibody Tests Work
38:00 - Summary
____________________________________________________________________
Support the show and future projects:
Patreon: / thethoughtemporium
Nebula: go.nebula.tv/thethoughtemporium
Ko-Fi: ko-fi.com/thoughtemporium
Become a member: / @thethoughtemporium
Store: thethoughtemporium.ca/
______________________________________________________
Our Social Media Pages:
Tiktok: / thethoughtemporium
Instagram: / thethoughtemporium
Facebook: / thethoughtemporium
Twitter: / emporiumthought
Website: thethoughtemporium.com/
_____________________________________________________
More resources, and citations:
Kurzgesagt Covid Overview: • The Coronavirus Explai...
A great writeup about the virus's anatomy: bit.ly/2FJq6G8
JOGL: app.jogl.io/program/opencovid19
Biofoundry: foundry.bio/
Student Outbreak: bit.ly/2Qa3vEq
Student Outbreak 2: bit.ly/34hQgdl
Strokes In heathy people: bit.ly/2QdQREK
Organ Damage: bit.ly/3aHONhy
Aptamer Tests: rsc.li/3j2Fb3I
Variations in Test Accuracy: bit.ly/2YlojNV
Faulty probes: bit.ly/3aIPlDJ
Contaminated Swabs: bit.ly/34fnVEt
False positives FDA: bit.ly/3gojBFv
E protein structure: bit.ly/3aN5Yyb
MERS fact sheet: bit.ly/2CLUaQn
Incidence of thromboembolism: bit.ly/2YgiBgc
Stroke study: bit.ly/2E59Pei
Stroke 2: bit.ly/2Yk8yql
Cardiac infection: bit.ly/3l5DaWo
Asymptomatic infection rate: bit.ly/2YgiOju
Asymptomatic infection study: go.nature.com/2CLO2rb
Organ damage in asymptomatic pateints: bit.ly/2YfaMHJ
Wisconsin LAMP trial: bit.ly/3aIQfA7
Healthy people stroke: bit.ly/2YmKEuB
LAMP Assay design: bit.ly/3aJnqUv
Mutation geneology: bit.ly/34hxqTs
Cardiac outcomes: bit.ly/3hjJBmo
False negative rate: bit.ly/3j47I95
ACE2 distribution: go.nature.com/3aJsMyR
Long Haulers article: bit.ly/2EgU9nP
Long haulers Video: • COVID-19 Antibodies: W...
Complete protein models: bit.ly/32akpIS
Antibody test: bit.ly/2CIXT0S
_________________________________________________________________________________
Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: binomicalabs.org/
SpikeF - AGGAATTTTTATGAACCACAAATCA
MembraneR - CGGTGATCCAATTTATTCTGTAAAC
NucleoF - AAATGAAAGATCTCAGTCCAAGATG
NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT
Original Primers:
N1F - GACCCCAAAATCAGCGAAAT
N2F - ttacaaacattggccgcaaa
N3F - GGGAGCCTTGAATACACCAAAA
N2R - GCGCGACATTCCGAAGAA
N2-LF - gggggcaaattgtgcaatttg
N2-B3 - gacttgatctttgaaatttggatct
N2-F3 - accaggaactaatcagacaag - Наука та технологія
Right after this video went up, one of my awesome friends Sebastian designed new primers which are much much better than the CDC or other primers used in this video. Here are their sequences for those interested and if you'd like, check out Sebastian's work here: binomicalabs.org/
SpikeF - AGGAATTTTTATGAACCACAAATCA
MembraneR - CGGTGATCCAATTTATTCTGTAAAC
NucleoF - AAATGAAAGATCTCAGTCCAAGATG
NucleoR - ACAGTTTGCTGTTTCTTCTGTCTCT
when is the next micro fluidic video ♡
Can you link to the Antibody test you used?
It's nifty taking those little primer sequences, doing the reverse complement, and putting it into a BLAST search, and seeing only SARS-CoV-2 come back in the results.
Very useful and informative! Valuable insight on this be-tweaked-st microbe toward its management.
Hi so my question is the is a math solution how to do any kind of testing more efficiently, so is it possible to mix 4 or more samples together so it triggers if only one of them is positive?
Luckily I've managed to avoid getting it so far by hiding out here in the deep forests
Username checks out
Second time I've seen u
@@tonk8735 are you saying you've spotted big foot twice?
Dude I see you everywhere
@@dismissing yes
I love how he casually use peas as coolant for his biological raw materials.
They're reusable!
@@MudakTheMultiplier and biodegradable
@@supernoodles908 also great for when you bang your head on the fume hood...
There's also a pea shortage. No joke, the demand for peas from the fake burger industry has caused a shortage.
@@RoboticusMusic They can contaminate those vegan burgers all they want. Campbell's stopped production of their split pea soup (my favorite) because of the pea shortage.
i should have watched this video before i tried
Nobody will know, it's fine
wooo i like your vids woo
Oof
Yes! 😂😂😂
Eh u shoud survive if u didnt die yet \○/
Meow Ludo Disco Gamma Meow Meow has to be the most cyberpunk name I've heard, at least for a real-life person
I’ve read the “Gamma” as Grandma at first lmao
I had to type that name into Google. That's his real name. He even ran for political office in Australia under the 'Science Party' and is a geneticist and entrepreneur. He is a serious guy with an unusual name.
Dude he's totally related to Catra Applesauce Meow Meow from She-Ra
@@pineapplesareyummy6352 did he change his name? I would assume he did
Neon Red kill Yup, apparently he made a funny name list with his friends and picked one he liked to change his name to
*L* (oop mediated isothermal) *AMP* (lification), I assume.
Either that or another language, like "SI" for SI units.
Nah it's that thing on your bedside table what shines light. It can detect the virus through... uhhh... science magic
@@GasparLewis Or UTC where the English and French couldn't agree so they decided on an order that's wrong in both languages.
Or maybe it just was developed by moths, who knows?
Just paused the video to comment this.
Im 26 and had covid. I had symptoms for about 16 days. It felt like a moderate cold but with severe soreness and pain in my joints, especially my legs. I have moderate asthma and my breathing was easily controlled with my inhaler. I’m also a microbiologist so this whole pandemic has been extremely interesting. This is a great video.
PCR= Pipette, Cry, Repeat. Never change! 😂😂
This needs to be a new T-shirt design
@@Queekusme Hahaha, thus needs to happen!
Shirt design on back:
PCR
Pipette (pipette logo)
Cry 😭
Repeat (uno reverse card)
I would get one like this. :D
Already working on it. Will have it out soon
I'd buy it
@@thethoughtemporium I need it
Anybody knows similiar channels about biology and chemistry? I only know this, and Nilered, and these topics are really interesting
NielBlue
Marcin Zdunek I’m more familiar with chemistry channels, there are channels like explosion & fire, nerdrage, nighthawk in light, if you are interested in lasers styropyro has some great content and does some chemistry at times as well, of and applied science does great stuff too.
@@soumyadipbiswas9074 Applied Science
ElementalMaker is a dude who does a lil bit of everything, from artificial rubies to sugar rocket builds, plus he is a pretty funny dude; reminds me of a pipeline worker but smarter /s
Explosion & Fire
it is INSANE how far you have come from the first videos I saw (the radio telescope/"wifi camera" adventures). the quality of science, recording, narrating, and overall production has jumped vastly; the scale and capability of your lap and tools have expanded as well; and perhaps most importantly, your passion for science and earnest pursuit of spreading knowledge has never yielded.
Keep up the good work, keep yourself safe, and don't forget to take breaks sometimes so you don't burn yourself out!
Great video but I kind of laughed at the end. Putting a "listen to the scientist" spiel at the end of a 40 minute technical video on covid testing is the definition of preaching to the choir.
Yeah, the sorts of people who would need to learn that aren’t going to watch a video like this.
@@KnakuanaRka They definitely watch videos like this, skipping through it to find bits that support their narrative and pull them out of context. Too bad this video doesnt say anything easily pulled out of context.
@@drkastenbrot Wish more videos could be like this one in that way.
Meow-Ludo Disco Gamma Meow-Meow is such an amazing name. Looking him up, I learned that he got in trouble for implanting his public transport card chip into his hand and was fined and summoned to court for traveling without a valid ticket (the judge dropped the case). Sounds like an interesting friend :-)
15:03 Ah yes, the most used refrigerant agent in biolabs : frozen peas! :D
I clicked as soon as I saw the patreon notification. Fantastic job on the animations. I can tell you really put your blood sweat and tears into this project. (sometimes literally) I also really appreciate that you didn't pull any punches for anti-maskers and conspiracy theorists. It's a bummer bad primers caused you so much trouble but I think the final product is some of your best work. I'm pretty hyped for the upcoming spider silk video. Keep up the good work Justin!
"Build a neat and better mask"
*becomes daftpunk*
at about 31:00 you state that people with past infections don't PCR test positive - actually, a surprising amount of people test positive weeks after a passed infection, due to "genetic garbage" still hanging around. These patients are, according to WHO standards, not considered infectious patients anymore.
Do you know what this "genetic garbage" actually is? How long can naked pieces of RNA just hang out on mucous membranes?
I know a guy that kept testing positive over and over. Finally somebody told him to rinse his sinuses out with saline. He did it three times a day for 8 days and finally tested negative.
I thought such garbage was automatically kind of broken down but maybe it only applies to waste products from the cell and not from outside
RNA is officially a proteïne so it can take a long time for it to break down under the temp it was meant to be in. (sorry i dont have a concrete number)
@@CodingCorvus RNA RUBBISH..as a Physicist it's obsolete rubbish.
As a healthcare professional I enjoyed your brief but scientific comprehension very much, to say it clear I love Your video! Thank you very much. (Of course I recommended it to many nerdy friends!)
But I've been a bit suspicious with the Immunglobulines: As far as I know IgA (which is not present in your diagrams) is the only dimer (in humans), and IgD, which you present as a dimer is a monomer like IgE and IgG, too. Correct me if I am wrong!
You're correct, that was my mistake. Good catch! That was meant to be IgA. Must've gotten it confused in my notes at some point
@@thethoughtemporium I appreciate your integrity
People are so caught up with deaths that they don't consider what happens to the survivors after - no matter if the illness was severe or mild.
I had a 'mild' case, and I still have abdominal discomfort, occasional shortness of breath, and fatigue. Symptoms started on july 14
I mention this near the end
@@savage101. Good for you, sadly that is not the case for many.
"Long-haulers" aren't unique to covid. A lot of people who are diagnosed with CFS/FM (chronic fatigue syndrome, fibromyalgia) likely started out with infections.
Okay if Meow's parents named him that just imagine the bullying he went through.
He named himself that later in life.
@@thethoughtemporium then he is super awesome
@@Ryan6.022 I'm imagining a hyper intelligent grad student that went on a psychedelic vision quest of a lifetime. From this he gained a sense of humor, a sense of purpose, and superhuman powers of chill. I've had friends attempt to rename themselves after a heavy trip, and none of them were this cool.
@@thethoughtemporium Is his first name Meow and his last name Meow Meow? Does his name follow the first, middle, last form?
@@thethoughtemporium He just got more awesome!
as a scientist like yourself, do you ever question the origins of COVID? do you think that there is anything you find uncertain or questionable about the virus?
I love the frozen peas used as cooling agent :DDD
And who knew, almost two years later and, well, we're still dealing with this crap. At least we've got some legit treatments now (you know, with actual scientific evidence in support of them) and a few vaccines. Though, despite getting the initial course and the first booster shot, I just recently got Covid myself (for anyone wondering, 0/10, would not recommend). I'm fine now, but it still sucked for about a week. And before you ask, I'm only in my 20s. Though, I at least don't seem to have any long term effects from it...one of my coworkers that got it really early on, relatively speaking at least (I believe it was in about November 2020) and she still can't smell or taste stuff. Which, I couldn't even imagine going through life like that.
Edit: Oh yeah, and even still, +1 on the wear a mask part from a healthcare professional here (I work in a hospital lab). They really can make a difference. Although, I'll also say that while the cleaning EVERYTHING before bringing it into your house was solid advice at the time this video went out, turns out, SARS-CoV-2 doesn't spread that great on surfaces, so that isn't as necessary as originally thought. Still not bad advice in general, just not a major factor in terms of Covid-19 spread.
Edit 2: oh yeah, and another thing, that is only relevant now that it's been a while since the video came out...The false negatives are far less common nowadays. They absolutely were a huge issue early on (i.e. back when the video was posted), but nowadays the tests are quite reliable, even for the newer variants.
Edit 3: Just one more thing I wanted to add regarding PCRs...if you've never been around a hospital lab style PCR, the thing I think that'll stick out the most is they are loud. Like, really, really loud. At least, the ones we use are absurdly loud. It's reminiscent of what a jet engine sounds like from inside the plane. So not loud enough to require earplugs, but loud enough that it's very clear something is happening. Of course, the PCRs at the hospital are more than just the block that heats and cools to specific temperatures. I mean, yeah, it has that part, but it also does all the measurements and detection internally. No gel electrophoresis or additional manipulation of the sample. It's literally just mix the UTM from the swab with the reagents, load, and await results. So it's possible the PCR like described in the video isn't quite as noisy, but I'm far from an expert on the stuff lol.
Oh, nice, he talks about the difference in the diagnostic PCRs vs the one he initially described. Should've just kept watching
Edit 4: and now I suddenly know why some samples we've tested consistently come out with an "inconclusive" result. None of us were quite sure the reason behind it, and after watching the video, well, I still don't know the underlying mechanism but at least I know the problem. One of the two primers came up positive, the other negative (and the human gene control part worked). Thus, the machine would've given an inconclusive result, despite multiple tests on the same sample. We always just give up and ask the nurse to recollect after it comes up inconclusive twice, and 999/1000 that solves the problem. So I still couldn't say why the initial sample was problematic, but at least I know the reason the machine insisted on giving a result of inconclusive.
Why are there so many dislikes wtf
You can use aquarium gravel instead of frozen peas! Can even use it to flash freeze stuff if you have access to a -80°C freezer.
Keep up the good work! Your videos are interesting to watch even for us who work in labs all day long.
aqua-rium gra-vel, okay noted, anything else? (to flash freeze throw some liquid nitrogen over it)
im guessing it has a higher energy desity right?
"We live in a cyberpunk dystopia" Video liked.
I can't find it but I want to
21:25 the googly eyes make your results more accurate.
didn't notice that before, thx.
great video, enough over my head to make me realize how complicated it all really is
It makes me happy to know that there’s 80,000 other people out there who are actually interested in how things in the world work
And then there are THOSE dumbasses
@@studioreep7449 dumbases ?
Dude calling them dumb is an insult to actually dumb people . You're giving those people way too much credit
I can't believe I sat through this looong video about a field of science that I knew nothing about and actually learned something. This is some high-quality content.
watch more of his videos, this guy is awesome
Actually kind of blown away that you just exploit the RNAs goal to self replicate but do it in a lab and look for the result that it’s duplicated exponentially 🤯
This is called "tricking the enemy"
@@wesleymays1931 So I guess we are testing for covid by tricking, backstabbing, and quite possibly bamboozling a virus. I love science.
Isnt it Loop mediated isothermal AMPlication?
AMPlification*
This dude's content is like the answer to my questions
Wow, I've used TLC a lot at the medicinal chemistry lab to monitor chemical reactions. Those anti-body tests are like ultra overdrive TLC, it's awesome
"I hope this will be enough of a wakeup call"
haha, god I wish.
the people watching these kinds of videos mostly are the people who already know it's bad. if there was a way to force this video's knowledge on everyone and force them to have a high enough IQ to comprehend it, then that would be a wakeup call.
But no, the only brainwashing technology we have is 5G and coronavir- wait...
Yeah at this point everyone has already formed their opinions on this whole situation, and that usually only changes when someone who downplays covid loses a family member.
@@StormBurnX The whole world is dying, ffs you guys
From what I have seen, I doubt the wakeup call will work either. I have seen plenty of people say "it'll all be over after the election" or similarly stupid nonsensical bullshit. All while having a friend or family member disappear to their home for a few weeks with COVID-19. They literally do not see or hear it happening right in front of them.
@@eideticex And you also have people like Herman Cain who die from it and tweet from the grave about how it wasn't that bad.
Do labs ever do batch testing? Like, combining samples from 10 patients in one test, and retesting positives?
Hey where did you get that antibody test that you did in the video? I’m immune compromised and I do monthly igg replacement therapy, and I would be interested to test myself to see if any covid antibodies have worked their way into my igg infusions. I would want so self administer because then I could avoid labs and potential exposure.
I have been looking for something like this for a long time, thanks. The only thing I disliked was the ”Don't be alarmed. But be alarmed, this is the new normal”-bit. In Finland we have a lot of new cases now, but zero people in intensive care for a month, and a just handful getting hospital treatment, even as very few bother with the masks. Is this because hand washing, distancing and protection of risk groups have been effective, or has something happened to the virus itself during summer? It is mutating, after all. I think the jury is still out on near future developments.
Stellar video, Justin. Good humor, too.
I’m going to have to watch it a couple more times and check out those papers.
"each tan you open gives you a heart" oh no. I can get like 600 hearts a day just from forgetting how to spell
Please be careful about recommending ubiquitous testing. At very low prevalence levels, (sub the "prevalence threshold" for the test), the precision (PPV) drops rapidly. In places like NYC, where the prevalence is 1% or less, a large majority of positives end up being false. Until tests get to ultra-high >99.9% specificity, the prevalence threshold, given their sensitivity, is >3%.
Getting a false positive is way less of an issue than missing a case, because the worst that can happen to you in that case is getting isolated, which you should be doing anyway
@@ukaszMarianszki pretending that isolation has no cost is ridiculous
The term Coronavirus comes from Spanish, corona is crown in Spanish, now does that crown on a bottle of corona beer make sense.
Instead of disliking the video, read the citation in the description and check the sources, and then compare that to the citation of sources that says otherwise, if said citation exists at all
You can't expect people to do work to debunk their own fallacies. It's a psychological disease
Great vid and great link collection in the description. Thank you.
so interesting I've watched it twice - good job
LAMP I would assume is them using the “L” from loop and the “AMP” from amplification but it is a far stretch lol
Hi Justin, I’ve been binging these videos since I found them. I’m very interested in this line of work but am a physics junior already, with plans for a masters in electrical engineering, so my time to branch into biology while in undergrad is limited. Do you have any suggestions on classes to take that would set me up well to combine engineering, physics, coding, and bio? Or suggestions on extracurriculars or diy stepping stones?
Thanks to you I’m looking into a magnet implant, depending on my future specialization, this could be super useful.
The easiest way to get started is probably on your own, but there's nothing stopping you from taking an intro to bio or biochem class. Though fair warning, they'll bombard you with an enormous amount of information. But if you just want to learn on your own, crash course has a bunch of great series on the topic. I also suggest the book "the manga guide to molecular biology". It's cute, well written, and covers a ton of stuff. Beyond that, look at places like amino.bio, biobits or carolina biological and get yourself one of their fantastic kits. You'll get some hands experience and get to see how some of this stuff works for yourself
What a coincidence I’m studying molecular biology at university but maybe want to stem out into physics. Maybe biophysics? There are similarities between biology and physics which may be surprising like molecular motors.
Anyway good luck with your journey !
I am doing EE at a uni and biochemistry and whatever else interests me on my own terms. Doing any biology at uni is very, very harsh.
Awesomely informative! Thanks!
Hum.. whats going on with the dislikes? Are bots auto-disliking covid related vídeos or something?
CovIDIOTs.
I don't consider the amount of dislikes high until it reaches 1000+.
Back when the death toll was only 700k 😢
at 32:08 : polyclonal antibodies are distinct antibodies and not one that binds to many epitopes.
39:12 I was almost as impressed by the fact that the auto-subtitles transcribed "Cheeto von Gropensnatcher" correctly as by the quality of the video ^^
I am currently a high school student and my school district decided from the start to not open up the schools in that district. This does suck as there is a major social aspect to school, but I`m becoming more grateful to the fact that they kept it to online school from the start as all of the other districts in the area are closing schools and are vastly underprepared for online school.
This is a really detailed and amazing video! This information is important for the public to know, and I'm glad you're putting it out there. I hope my videos become as well-explained as yours one day haha :D
with hard work and dedication you will one day.
this was a nice summary of what I needed to know and what is currently known
He really put his blood, sweat, and tears into this video. He pricked his finger, did some pipetting, crying and repeating, and worked on this video for months. Awesome video.
Awesome work! Thanks!
Where I live, we’ve only had 27 cases (all recovered with no deaths nor community spread) and it’s been almost two months without a case. Hearing about what’s happening in the rest of the world seems fake, though I know that it is, unfortunately, true. All we did was follow our public health guidelines. ITS NOT THAT HARD!
My county has 15 imported cases (that were detected) through people returning from their holidays. School starts again next week. This is gonna be great.
I’m not sure if I’m taking your final point the wrong way but I thought it was quite controversial. Yes this is a temporary “new normal” and it kind of is a new normal in the sense that once we get over this virus we will react like Asian populations have done for decades aka wear a mask if you are sick. I’m not sure if you were implying that you’ll have to wear a mask for the rest of our lives, constantly? Correct me if I’m wrong on that one. We will get back to normal without the constant need to wear masks. We will socialise in bars pubs and clubs again. We will go on holiday again. All without social distancing and masks. It should be a selective thing. We need to encounter disease for our bodies to protect against them (I won’t patronise you because you’re well qualified for this OBVIOUSLY🤣). Masks won’t be weird anymore, people will wear them when they deem fit (after this pandemic) and people will be more open minded about wearing them. I think the problem with this virus was the initial uptake of masks either because they felt embarrassed or they thought it was stupid which is a valid reason because yes it is weird, but now it’s a whole new kettle of Fish people will have a much much faster reaction to future pandemics (if that’s what you mean by new normal). We can’t and won’t constantly wear masks after this virus has been contained and defeated, it’s just not socially viable, we are very social species and masks hinder our ability to connect with people. I’ve not been outside in weeks and I’ve only been outside 5 times in the past 3 months and that’s terrible because I’m feeling a little depressed. I’m doing my chemistry lectures from my bed and I’d say I easily spend 23.5 hours in bed which is utterly dreadful. At the start of the pandemic I’d go on 125km cycles twice a week for about 6 months going 25km walks but now I’ve been broken I guess. I’m in the Royal Air Force and I’ve have not flown in 11 months I’ve missed hundreds of hours of flying and activities I’m so sad. What I’m trying to say is we cannot and will not continue living like this and we will go back to a full normal with added reactions. This is all about gaining a valid reaction to this so we are prepared in the future, whether that’s from governmental spending in science, social norms in the sense of masks and social distancing, we will be more prepared for future iterations of this generation killer.
I work on software for an automated processing platform (qPCR and microarray), and it is nice to understand a bit better about how the primers and fluorescence markers work. The only real understanding I had to have was: it grows a lot and glows in this specific way if you do "biology stuff" to it. But it is nice to know what the colleagues are actually up to.
that’s awesome!!!!!!
That moment when you realize how much more science you need to learn... and the moment persists throughout the video. Sadly, my rudimentary understanding of bioscience may have dampened the intended response to this information - but I am now taking this issue more seriously. Thank you for this extended content, good sir.
I have downloaded this video for future reference and dissemination.
❤️ it’s great you took time to learn! i don’t know much either even though i love this stuff.
I am so glad you made this video! You are educating so many people about such a serious problem and it is honestly people like you that are keeping this world alive. Keep up the amazing work man :)
Thank you for this incredibly informative video. Keep at it, your content is truly next-level
Thank you for this video!
I think it's interesting that at the beginning of your video you basically say that no political talk should be made in the comments, then you go on to make a lot of political statements for 5 minutes at the end of your video.
That being said, it's a great video, but I lost the ability to use this in my classroom when you went on a political rant at the end.
I love your videos, and I hope you'll make one about T-Cell immunity because it gets old explaining it to people who don't understand even the most basic parts of biology. Keep up the good work!
It is simply outdated at this point. The downside to such long videos is that you can't select for the information that withstood the test of time and set aside the parts that aged poorly.
man it is depressing to know that we used to think there was a chance wed do something about all this instead of just arbitrarily deciding it was over when it wasnt and refusing to do anything more
Finally a comprehensive video on this subject. Love your content in general, but this particular video needs to reach a wider audience. I hope that the algorithm picks this up.
A year after this video, still fantastic
Lol, i am proud of myself that i made it till the end of the video. If our biology classes were like this, they'd be more interesting to attend.
hentai ousama
If teachers could spend DAYS/weeks making a video about a single example of a single topic, that would be true, but then an undergrad degree would take about 2 decades to complete.
It's really funny watching this video after all the stuff came out from the CDC.
he watched to much t.v.
Specifically the masks bit. Masks were not very effective. 6 feet was an arbitrary decision. Totally avoiding people was the safest option.
@@WarningStrangerDanger Yes, 100%, but also the actual virus for everyone who isn't the age of 60 or has severe immune compromises, it has a 99.9% survival rate.
Amazingly well presented and well explained. Thank you for your hard work Justin!
@the thought emporium
off topic question.. Since your lactose intolerance modification wore off, it has me wondering. If you were to use a custom retrovirus to induce CIPA in yourself, would that also ware off?
I was expecting to see something on the PCR thresholds, but they weren't mentioned. What are your thoughts on the recommended threshold of up to 40 cycles? Also, would appreciate any insight on why breakthrough cases only get up to 28 cycles. Thanks!
Mr Meow Meow seems like a pretty chill dude
Implanted an Opal Card chip into his hand.
Nice, watching this while waiting for my test results. Will share the result and the test type when I find out, likely on saturday.
"It is like strapping a Corvette engine on your lawn mower"
I might not be dumb, but I might be dumb enough to try that for shits and giggles XD
Seeing that ending now... Oh boy, I sure love how we all got together and tried to solve every important problem we had!
In any case, thanks for your videos man. I am not in the biomedical field but I love watching your videos and hopefully learning something useful.
why not geting in it ?
I love your videos and learn so much from them, but i have a confession to make when I'm having a hard time sleeping ill play one of your videos and it knocks me right out.
Huge thanks for not over-simplifying this too much. Also, why are so many people down-voting this?
This is unique content on youtube, i have not found anything similiar to it. I love your channel, altough i dont understand anything. Guess i will stick with my area of expertise. Great work tho.
the dislikes are from antimaskers
It's unfortunate people still think for themselves.
How is there almost a 7:1 like to dislike ratio on this video? You would think the people subscribed to this channel would be the sort to know better than to subscribe to baseless conspiracies. Not to mention you clearly spent a lot of time thoroughly researching this and cited sources that they could check and see are reputable.
Probably because a lot of CovIdiots get it recommended who are not subscribers.
I disliked because I don't like politics in my scientific entertainment
People are eternally disappointing, and the number of comments alleging that the whole thing is a hoax should explain where it's all coming from. A vocal minority, but thankfully a minority none the less
In this day, where the right are blatant anti-intellectuals who dismiss any science that they don't "agree" with, science is inherently political
@@C2H5OHist Same here. The political digs undermine the credibility of the video. If I can spot fallacious reasoning/data on things I am well informed about, it makes me question whether I can trust him on things I am not and came to the video to learn more.
Such an amazing and instructive video
So very well done, thank you. I have a much better understanding of qPCR results
Ah the science side of this
I love your videos, they're informative and go into a satisfying depth of the topics
Please change your thumbnails, it's really hard to tell the difference between streams and normal content.
Your videos make me want to do what you do so much, even if I have only very basic understanding of what is going on. Thank you!
Edit: What studies did you follow?
Ok gonna save this video... For night time sleep...
(was watching during day... cause strong sleepiness)
You poor soul having to copy and paste like 200 links
1 Upquest Now imagine reading all of the sources, compiling the information and making it into a video
88botong Damn never thought of that
Most interesting part for me was when you were talking about building your own mask and I saw you guitar in the background! What do you like to play??
Thunderstruck and Hotline Bling - lol - TheDooo joke
Great video! I have a friend who's working on lamp tests and while she tried diligently I feel I just now understood the major differences to the pcr tests. Thank you!
Amazingly Awesome content. Loved it
Nice i was looking for an explenation of how testing works for a while!
I hate how the most common anti-mask argument is "It gives people a false sense of security and they stop social distancing". Because simply educating people is too hard.
thank you for this vid......Much love from the Netherlands...
I wish this was 2 hours long in a way, but very great info here. and good final points, Really agree with your summery
15:09 are those peas xD
yup! use them as my resuable ice bucket. they don't melt into a puddle, can be reused, and don't clump into a solid block when refrozen
@@thethoughtemporium That is actual genius.
@@thethoughtemporium just make sure to mark them for "NOT FOR HUMAN CONSUMPTION"
@@thethoughtemporium in another comment around here someone surgested aquarium gravel. is that good too?
@@CodingCorvus Ya it is. I may actually switch to that since I can autoclave gravel to make sure it's not a source of contam
Please explain why this is not a bio weapons, maybe explain what is the difference between a bio weapon and a normal pathogen.
One of the scientists in the research facility I work in told me they can tell it's not engineered from the spike protein. I don't see why the protein couldn't be engineered but I'm not a scientist, I just work on the instruments...
Bio weapon implies it was engineered, though does not specifically require it. Purposefully releasing it into a specific area also counts.
I know nothing about bioengineering, but that makes literally no sense. So China bioengineered this thing and then... released it onto their own populace? Why would they do that?
They say never attribute malice where incompetence will suffice - you manage to attribute *both* malice and incompetence for... what reason?
21:26 love that you gave the robot googly eyes
Great video! Love your channel :)