Pfizer is 'deeply sorry'
Вставка
- Опубліковано 10 кві 2024
- Pfizer, bringing discredit to pharmaceutical industry
www.pmcpa.org.uk/media/cwvkqv...
www.telegraph.co.uk/news/2024...
Senior executives used social media to promote an “unlicensed” Covid vaccine.
Pfizer found to have breached the regulatory code five times,
Prescription Medicines Code of Practice Authority (PMCPA)
Pharmaceutical watchdog,
relates to a complaint about a message posted on twitter
November 2020 by senior Pfizer employees.
COMPLAINT
the complainant alleged that it turned out that such misbehaviour was even more widespread than they had thought, extended right to the top of their UK operation and was apparently continuing to this very day.
PANEL RULING
The Panel noted Pfizer’s submission that on further investigation into this complaint four other Pfizer UK colleagues, including another senior colleague in the UK organisation, had re-tweeted the same post.
The Panel queried whether a social media platform, such as Twitter was the appropriate forum to share such information.
The Panel noted the tweet contained limited information regarding the efficacy of the vaccine candidate with no safety information provided.
On the balance of probabilities, it was likely that the Pfizer UK employee’s connections would include UK members of the public as well as UK health professionals.
The Panel noted that the tweet clearly referred to the outcome of the Pfizer and BioNTech’s vaccine being developed to protect against COVID-19.
The Panel noted that Clause 3.1 prohibited the promotion of a medicine prior to the grant of its marketing authorisation.
They must not mislead either directly or by implication, by distortion, exaggeration or undue emphasis. Material must be sufficiently complete to enable the recipient to form their own opinion of the therapeutic value of the medicine.
It must not be stated that a product has no adverse reactions, toxic hazards or risks of addiction or dependency. The Panel noted the tweet made no reference to adverse events and was therefore concerned that important safety information relating to the vaccine candidate was not provided and ruled a breach of Clause 7.9 of the 2019 Code as acknowledged by Pfizer.
The Panel noted Pfizer stated that the senior employee whose re-tweet was the subject of this complaint had completed the social media training module in October 2019.
Activity which was clearly outside of company policy had not been taken down or deleted.
‘Unlicensed medicine proactively disseminated’
“unlicensed medicine being proactively disseminated on Twitter to health professions and members of the public in the UK”.
Pfizer UK spokesman
“fully recognises and accepts the issues highlighted by this PMCPA ruling”,
“deeply sorry”.
Pfizer
‘Accidental and unintentional’
Sixth time Pfizer has been reprimanded by the regulator over its promotion of the Covid-19 vaccine.
Ben Kingsley, UsForThem
“It’s astonishing how many times Pfizer’s senior executives have been found guilty of serious regulatory offences - in this case including the most serious offence of all under the UK Code of Practice.
“Yet the consequences for Pfizer and the individuals concerned continue to be derisory. This hopeless system of regulation for a multi-billion dollar life and death industry has become a sham, in dire need of reform.”
Deeply guilty of mass murder
hear hear
But who ordered it? Adolf Schwaab?
My dad took the Pfizer boosters, subsequently got a heart attack, clotting in his feet, cellulitis and had multiple organ failure. A healthy man who walked more than athletes everyday, read libraries of books, did incredible real charity at the cost of his own wealth/meals at times, a guy who had salads daily, no stresses, did yoga and everyone thought would live to 100+.
He passed away last year, we were told by doctors he had a heart attack as the causative factor. We all believe IT IS THE PFIZER-BIONTECH vaccine to blame squarely.
@@Plisken65 One of that lot
They feel no guilt, fhey are evil
Deeply sorry, deeply sinister and they should be deeply in jail
🎯🎯🎯
AMEN.UNDER IT.❤❤
Absolutely
6 feet deeply :)
Amen. Pray for Nuremberg Trials.
Heard it like this; “Everybody take it” “Everybody shut up”
and “Nobody can Sue”
That's exactly how it was. They also said you can't work unless you take it.
Or can’t travel or visit hospital patients?
Or swim or go to the restaurants in Trumps hotels. Does everybody forget that he backed them right up?
Who is jailed for the crime against humanity???
Criminals
Love it, Dr C
Bog Pharma, Big Agra, Big Food - heck Big anything are all Criminal. matter of fact the largest Mobs on the planet ny anny account
On Pfizer's SSRI: Pfizer has faced multiple Zoloft lawsuits filed by patients or loved ones of those who took Zoloft and experienced serious injury, birth defects or death.
Deeply sorry, yeah after they were exposed. They should all be in jail.
that's anti-semitic
@@user-vs6xj2qe2g
Lol.
they supported pseudo-science while suppressing (with a lot of help) real evidence based science
🎯🎯🎯
worse. history hasn't been happy with them multiple times. they were expelled over 100 times from almost every nation for behaviour like this.
Thief is "deeply sorry" for robbing the bank, but won't give back the money. He's not THAT deeply sorry!
They are deeply sorry and he is deeply relevant..
Jabbed@@DonMcRon
Stock holders got the money Nancy pelosi . .who owns stock .our system is shareholders get everything that why CEO get stocks as pay don't pay taxes on because borrow against them
And now Astrazenica... not good at all
"Repentance requires action!"
Companies run by psychopaths don't actually feel remotely remorseful!
No, all they care about is the money they're making.
Until they have loved ones of their own.. even then I don’t think these corporate overlords are capable of sympathy.
Neither, do they face justice!
United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats??
Military created the poison. Depopulation !
@@joe9042they do. Karmic laws will destroy them. Maybe not in this life but it’s prepared and everybody’s gonna get the taste of their own shit + more.
Apology NOT accepted. Go directly to jail.. do not pass go.. do not collect another dime!
Why is this drug still being pushed on vulnerable patients then???? Government and NHS guilty of criminal acts
Very sad.
To withdraw it now after pushing it so heavily would be admitting culpability, and the claims will flood in, as pfizer is protected from liabilty, so the gov will have to renumerate people for lives destroyed. Money trumps human life.
see Hugo talks: Spanish Flu Bolshevik Revolution HISTORY REPEATING?
They push it period. Signs in "doctors'" offices, pharmacies. "Get your free covid shot here". They really think we're that stupid. INSULTING!
Slowly... the people starting to realize what the pharmaceutical industry and the governments ACTUALLY is about. In reality.
I'm glad that at least the UK media is mentioning this because the US media hasn't said a word.
The uk’s no better
Because in America they can't be held legally reliable. Obama made sure of that.
The Canadian government has UA-cam put a warning banner under the video telling us to go to Health Canada for accurate information.
@@GordieGiiyes I can confirm it’s true
Neither here in Canada - but then after the way Trudeau went vax yatzee on everyone they certainly don't want Canadians to know. No wonder they want to control all the media.
And people thought I was mad for questioning the vaccine
And the abuse and coercion I'll never forget, including from family.
I remember exchanging comments on Twitter with some vax fans who were talking complete rubbish. They were coming up with silly rules for people who refused to take the vax that we should be barred from going out so on and so forth. 4 years later they must be feeling so embarrassed
Same thing happened to me here in Australia
The societal pressure was unreal!
Thanks to trump, this was fast tracked! He even takes credit himself!
Don’t forget Bill Gate who funded, promoted and made Billions of dollars off of it!
And all your favourite celebrities
Yes NEVER forget.
Big money and deep state rule the Western world 😢😢😢
Juist
Dat is een grote schoft en geldwolf
NEVER forget willigoats. If it's anti-GOD's creation, if it's anti-human....Sauron, private bankers (you-know-who) & willigoats are somewhere close by pulling strings.
Crimes against humanity! Jail time!
Deeply sorry they were exposed !
corporations can hurt anyone they want, and nobody behind the company will be held accountable. this is what happens when you treat corporations as people. no body to imprison, and no soul to save.
Don't be anti-Semitic.
You've got to prove it in a court of law first. And remember the manufacturers have legal indemnity.
CEO of Pfizer is ✡️....CDC director is ✡️...COVID Czar was ✡️... coincidence 🤔???
So they should be seriously paying $$$$$$$$$$$$for their mistake, then put out of business
Like Europe. They have millions to pay ……
If they were truly sorry they wouldn’t exist anymore.
And deeply corrupt too.
And deeply grazy of money.
Deep pockets
the corrupt part is the one who's buying bro not pfizer
pfizer just bribe the decision maker to buy their product
Have we forgotten the statement “jab or sack” for health workers? Brow beating is an understatement.
you cant have health workers working unvaccinated as they are at a high risk of catching and spreading viruses and are therefore a danger to the patients and themselves. Its the same with any other vaccination, unless you're an anti-vaxxer who refuses to take any vaccination.
And teachers. All my covids were after the first and only time I vaccinated with Sputnik. I think it might be kinda similar to Pfizer though, from how our government treats its people. The first case may have happened before the vaccine, but the next 3 all happened as fterwards
YES!!!
They are only sorry they got caught
Exactly
The truth
Deeply untrustworthy, deeply lying, deeply greedy, deeply sorry they got caught.
ALL TRUST IN WEF POLITICIANS & BIG PHARMA IS FOREVER GONE..!!!
first its opiate crisis now this my daughter is a victim still alive thanks be to God!
As it should be
Well, I never really had trust n them at all
Plus NO trust in msm or medical people 🤢
I never had trust in them to begin with
"Reducing confidence in the pharmaceutical industry" what confidence? I never had any confidence in the pharma industry to begin with
Deeply sorry after years of gaslighting people and purposely poisoning us
Yes that's all they do is gaslight the people. It's a low down dirty shame
Deeply corrupt.
Ursula von der Pfizer is corrupt as well
Pure wickedness and evil ,the muddy waters run deep,all these so called reports and inquiries are nothing more than whitewashed softening and underplaying the real facts,making the masses feel empathetic and apathetic, top class psychological warfare
Jonathan Van Tam had a sturdy looking podium at one point in time.
CEO is ✡️...CDC director is ✡️... covid czar was ✡️.. coincidence?? 🤔
They are NOT sorry, they were laughing all the way to the bank !!
and still are. It is still being pushed.
Sorry they weren't able to swindle even more money.
NEVER FORGET WHAT THESE MONSTERS DID TO MANKIND AND OUR LIVELIHOODS!
they should be put in jail!
Yeah, they are sorry, ALL THE WAY TO THE BANK !!!!!!!
Wasn't about money, it was about infecting people with nanotechnology, mrna
@@josephallen8044 Yeah, the destruction of our healthh First, and after that also the money !!! ! !!!
Blood on their hands, billions in profit made on human suffering and unsafe trials on human. Apology not accepted, get fined and jail! They are criminals! Thank you for exposing these corrupted hypocrites.
Almost all governments were working with them. Who is to hold them accountable when the people that would do that are also in on it.
This wasnt just 1 company doing this..
Trillions. For those going through this, some extended fasting, low carb diet, taurine and methylene blue can help a great deal. Some benefits of occasional extended fasting and lowering carbs in the diet: High blood pressure is lowered to normal levels very quickly while fasting. Fibrosis/scarring is reversed over time, including in the heart and lungs.
Vitamin D plasma levels are increased as fasting improves metabolic health, and vitamin D in turn increases autophagy. When insulin is high, vit D stays locked in the blood cells.
Fasting stimulates phagocytosis, the ingestion plaques, growths and pathogens by the immune system. This will also remove spikes quicker, whether natural or unnatural in origin!
Your body recycles up to 1/3 of all immune bodies in a 72h fast, rejuvenating your entire immune system. This helps with autoimmune disease, cancers and cytokine storm.
Fasts from 36-96 h increase metabolic rate due to norepinephrine release!
Clots and plaques are removed over time due to accelerated phsocytosis.
Fasting improves your circadian rhythm to normal over time.
Blood sugar and insulin are lowered when fasting, reducing inflammation and allowing the immune bodies to move freely through the body.
T cells and T reg cells are vital in fighting cancer, autoimmune disease and infections. As we age, the thymus stops making as many of them but fasting releases stem cells, which then can become new T cells. It also releases growth hormone, which regenerates the thymus itself!
Fasting increases anti-aging Yamanaka factors and increases average telomere length in stem cell pools.
Fasting can help with MS, Depression, BPD, Autism and seizures.
When you move out of MTOR your body shuts down the building blocks of the cell required for viruses to replicate.
The hunger hormone ghrelin also lowers with extended fasting and rises from dieting.
What breaks a fast? Anything with protein or carbohydrates in it will break a fast but most teas and herbs are OK. Supplements and meds often break ketosis directly or contain a filler that will. Many meds are dangerous to take while fasting.
Does fasting lower testosterone? No, it raises it when the fast is broken by increasing lutenizing hormone. Fasting also increases insulin sensitivity, which helps with muscle building.
Fasting activates autophagy (literally self eating). This will cause cells to recycle damaged proteins and foreign matter such as viruses.
Lowering insulin via fasting virtually eliminates chronic inflammation in the body.
Weight loss from daily caloric restriction has 1/4 to 1/3 of the weight lost as lean tissue while many studies show fat loss from 36 h fasts without losing any lean tissue!
Fasts of 36-96 will not affect short term female fertility or affect menstrual cycle. They also may increase long term fertility for some women.
It increases mitochondrial function and repairs mitochondrial DNA, leading to improved ATP production and oxygen efficiency. Increased mitochondrial function also has the added benefit of increasing your metabolism, fighting infection and cancer prevention!
24h of fasting can cut your leptin levels in half! This reduces leptin resistance, which impairs immune function.
Fasting reduces pain and anxiety by stimulating the endocannabinoid system, just like the effect of CBD oil
Stomach acid is reduced over time while fasting and can allow for the healing of treatment resistant ulcers. Some patients may need continued acid reduction medication while fasting. When the fast is completed, your stomach acid levels will be normalized.
Your brain also prefers to burn ketones at a rate of around 2.5 to 1 when they are available in equal quantity to glucose. Except for brief periods of very intense exercise, your body mainly burns fats in the form of free fatty acids.
Fasting releases BDNF and NGF in the blood. This stimulates new nerve and brain cell growth, which can help a great deal with diseases like MS, peripheral neuropathy and Alzheimers.
When not in ketosis, the brain can only burn carbohydrate, which produces a great deal of damaging ROS the brain has to deal with.
Fasting increases telomere length, negating some of the effects of aging at a cellular level.
When you fast, this stimulates apoptosis in senescent or genetically damaged cells, destroying them. Senescent cells are responsible for many of the effects of aging and are a root cause of the development of cancer.
A fasting mimicking diet for 3-5 days in a row provides many of the same benefits as water fasting. FMD usually has 200-800 calories, under 18 g of protein and extremely low carbs.
Exogenous ketones can aid with fasting, making it easier in healthy people and allowing some people with specific issues to fast in spite of them without worrying as much about hypoglycemia. They also help with dementia and many other issues even if you take them while not fasting!
Glycine and trimethylglycine can also be useful supplements while fasting that won't break ketosis and have many benefits.
Children, pregnant or nursing women should not fast for periods longer than 16 hours. People with pancreatic tumors or certain forms of hypoglycemia generally cannot fast at all. Type 1 diabetics can also fast but it is more complicated and should be approached with caution as it could lead to ketoacidosis. If you experience extreme symptoms of some kind, especially dizziness or tremors, then simply break the fast and seek advice.
Resources:
www.ncbi.nlm.nih.gov/pmc/articles/PMC6141719/
www.ncbi.nlm.nih.gov/pmc/articles/PMC3017674/
www.sciencedirect.com/science/article/pii/S0005272806000223
www.clinicaltrials.gov/ct2/show/NCT04375657
www.nejm.org/doi/full/10.1056/NEJMc2001176
pubmed.ncbi.nlm.nih.gov/31877297/
www.ncbi.nlm.nih.gov/gene/25712
pubmed.ncbi.nlm.nih.gov/20921964/
pubmed.ncbi.nlm.nih.gov/29727683/
www.ncbi.nlm.nih.gov/pmc/articles/PMC5895342/
pubmed.ncbi.nlm.nih.gov/33530881/
www.arcjournals.org/pdfs/ijrsb/v3-i11/7.pdf
pubmed.ncbi.nlm.nih.gov/27569118/
www.cell.com/cell-metabolism/abstract/S1550-4131(15)00224-7
clinical.diabetesjournals.org/content/36/3/217
www.ncbi.nlm.nih.gov/pubmed/23876457
www.sciencedirect.com/science/article/pii/S1931312809002832
pubmed.ncbi.nlm.nih.gov/15522942/
www.ncbi.nlm.nih.gov/pmc/articles/PMC7607739/
www.ncbi.nlm.nih.gov/pmc/articles/PMC7093158/
www.ncbi.nlm.nih.gov/pubmed/10859646
www.ncbi.nlm.nih.gov/pmc/articles/PMC6407435/
www.cell.com/molecular-cell/fulltext/S1097-2765(18)30605-1?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1097276518306051%3Fshowall%3Dtrue
pubmed.ncbi.nlm.nih.gov/28235195/
www.ncbi.nlm.nih.gov/pmc/articles/PMC2815756/
www.nia.nih.gov/news/research-intermittent-fasting-shows-health-benefits
medicalxpress.com/news/2022-10-treatment-pulmonary-fibrosis-focus-telomeres.html
www.cell.com/cell/fulltext/S0092-8674(19)30849-9
onlinelibrary.wiley.com/doi/full/10.1111/j.1365-2265.2005.02288.x
pubmed.ncbi.nlm.nih.gov/25909219/
repository.upenn.edu/cgi/viewcontent.cgi?article=1537&context=edissertations
www.ncbi.nlm.nih.gov/pmc/articles/PMC1779438/
academic.oup.com/ajcn/article/81/1/69/4607679
www.amjmedsci.org/article/S0002-9629%2815%2900027-0/fulltext
www.collective-evolution.com/2017/05/16/study-shows-how-fasting-for-3-days-can-regenerate-your-entire-immune-system/
pubmed.ncbi.nlm.nih.gov/7714088/
www.nejm.org/doi/full/10.1056/NEJMoa012908
pubmed.ncbi.nlm.nih.gov/23707514/
pubmed.ncbi.nlm.nih.gov/23408502/
faseb.onlinelibrary.wiley.com/doi/abs/10.1096/fasebj.2019.33.1_supplement.819.10
www.biorxiv.org/node/93305.full
www.health.harvard.edu/heart-health/abundance-of-fructose-not-good-for-the-liver-heart
pubmed.ncbi.nlm.nih.gov/20102774/
n.neurology.org/content/88/16_Supplement/P3.090
pubmed.ncbi.nlm.nih.gov/6859089/
www.ncbi.nlm.nih.gov/pubmed/10232622
www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/
www.ncbi.nlm.nih.gov/pmc/articles/PMC1413655/
www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/www.ncbi.nlm.nih.gov/pmc/articles/PMC8470960/
europepmc.org/article/MED/22402737?javascript_support=no
pubmed.ncbi.nlm.nih.gov/2518860/
www.ncbi.nlm.nih.gov/pubmed/24905167
www.ncbi.nlm.nih.gov/pmc/articles/PMC6526871/
pubmed.ncbi.nlm.nih.gov/31890243/
www.ncbi.nlm.nih.gov/pubmed/25686106
pubmed.ncbi.nlm.nih.gov/21410865/
This list compiled over years of research by the user known as Pottenger's Human on youtube. Feel free to copy and paste this anywhere you like, no accreditation needed!
My community tab will always contain an updated version of this list of fasting benefits. I also have playlists on fasting and health topics.
Money, money, money
And not for the first time. Look at all the pharmacorporations that have already been sued. Pharma and chemics aren't the most trustworthy companies..
Absolutely.
They belong in jail!!
They are deepy sorry they have been found out.
All basic Tenets of the Nuremberg Code was disregarded! Especially informed consent.
Calling the vax an investigational agent instead of an experiment was to get consent without informing.
Biochemical warfare
That's not true. They didn't hide it and give it to you
1. Live a healthy life
2. Stop buying their junk
3. Put them out of business
join class action for opiate crisis
Whenever possible, I will ask for generic or alternative.
@@miguel-jesus what junk of theirs do you need?
@@botfantasies6229 For my prescribed meds, I am know choosing another store.
Cue the turbo cancer medication
This sound like attempted murder shame on them!
What would happen to anyone who produced anything that caused death or so ill they could work no longer?
"Safe and effective"? I guess that would depend on WHO is benefiting. This has been done frequently for years in several areas such as cribs that will keep babies inside them but no mention that baby might get their head stuck between poorly spaced (rails? I don't know the correct term).
What about the melamine added to pet food which caused the death to family pets? It was added to increase the protein level!
There's a long list. How many still think pesticides are 'safe and effective'?
My son is ill after second dose Pfizer since Feb 2022 !
Let's see if they end up in jail and how our so called justice system really works...
They do work... For us but not for them. For them the non-working is called working.
They had legal immunity before they even started. Don't be silly. Nobody will be held accountable in this life.
@@Phearsum Which is why the Indian Government refused to allow the Covid shot. Pfizer and the rest demanded immunity and the Indian Government refused YET our gutless politicians in the Western World gave them immunity and forced the Covid shot on those who didn't want it---take it or lose your job. Our joke MSM won't talk about that either where the Indian Government didn't allow the shot. Tried posting that comment on MSN and was immediately CENSORED. I was breaking "Community Guidelines"! For what, telling the truth about what the Indian Government did, protecting their own people from Pfizer and their ilk who demanded immunity from prosecution? The leftie Mainstream Media are corrupt to the core.
The only people who go to jail when the crony capitalist system is unveiled are the whistleblowers that make it public.
United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats??
Military created the poison. Depopulation !
Deeply dishonest and deceitful in the name of profits and moral bankruptcy.
In the name of the devil.
"Safe and Effective" !!!!! What a load of bollocks!!!
Criminal is what it is. Start the prosecutions NOW!!
who is going to run the courts and be the judges
@@eisbeinGermanyexactly! Can't trust the judicial system....in any country 😡
Definitely effective but not safe
The WHO still parrots that claim. Still on their website.
YEAH-- A TOTAL LOAD of stinkin' Bee Ess!!!
No apologies will fix the lives lost and jobs lost.
im from the usa, and im hearing nothing of this! thank u even tho im 4 weeks late
Same here. It's because we have different laws about this stuff and sadly allow more than the uk does from pharmaceutical companies.
@@rachelgr8584we're the only country that I know of where sick people are traded as commodities for profit, with pretty much all related companies being publicly traded in our stock market. Our elected officials callously allow sickness and death to provide value to shareholders, who receive political donations from them.
Our news media lies about things many of us are doing to stay out of the claws of the medical profession, by using studies that are anecdotal, not clinical at all, to scare people into stopping them from taking control of their own health, and use prescription drugs. Of course, there are lots of drug ads funding large news media companies.
Not being able to afford basic healthcare and dying means absolutely nothing to them. Those in power are literally willing to allow us to die for their unsatisfiable lust for money.
I haven't followed American news in a long while, because they hide stuff from the public that will help us thrive. Thriving will keep us out of the clutches out of the powerful, which stops the monetary windfall from flowing to the very rich.
They are guilty and should go to jail !!
They MURDERED MILLIONS OF PEOPLE... LIFE IN A MAXIMUM SECURITY PRISON at a minimum
The governments are just as guilty they knew
I suspect the deceased don't give a ratsass about your apology, Pfizer. Nor do I. Everyone involved, including the politicians that pushed this nightmare should be prosecuted. I tried to warn friends and family, but unfortunately they, "trusted the science".
Exactly
Thousands of Doctors are guilty of crimes against humanity too.
Most people expect others to take accountability, while avoiding it themselves personally
This was teason! We all know it! They should be put in jail!!!
Teason ??
Teason?
I bet they are wiping their tears with dollar bills ..
So sorry for committing crimes against humanity. Safe and effective….lying words.
Who used Parliament recently (where he cannot be prosecuted) to say 'safe and effective' in regard to Covid vaccine? Would say it outside his safety walls?
Yes, but how much that "sorry" is now good 4 the dead ones ?
This my first time watching this guy & I really like what he's about! 👌
"Sorry" doesn't cut it I'm afraid.
All criminals regret AFTER being caught.
Criminals! The evil they did for profit is mind boggling! 😡
you sound surprised
and domination.
I think of them as taking the highest refinement of stomach robbing capitalist ideology to the extreme of application of sub-humanizing mass exploitation, but where I live in the American Bible Belt criticizing capitalism is a no go for most people, so I comment on electronic social media mostly. I don't know how I got here.
Not just for money but for world depopulation.
Tribunals
They are not sorry at all, the only thing they are sorry for being caught poisoning people.
Guilty of premeditated murder 🤬
After they committed crimes against humanity, they're deeply sorry . They covered up all the all the trials.
Russel Brand recent expose very unsettling..
You are quite deluded.
@@papat7435please please get your booster
Even the animal trial of 30 ferrets in 2014 . they all died within 3 years . thats when they knew the vaccine was a success .
They are stil on poisoning duty.
They are sorry for not given the bribe to this agency.
We lost a 15 year old girl in our church to miocarditis. Sad too see medicine being forced on nations of people that could cause the ends of our young. When they were actually a low risk. Frustrates me.
They should give back all the money they made in the last 4 years, especially the CEOs at the time
Deeply sorry WTF seriously this is crimes against humanity!🤦🏾♀️
it's the great reset.
@@tripzincluded8087supposedly it happens every 138 years according to this man whose channel is called Archaix I have not gone through all his videos but he has a mountain of data to back up his claims...but from what i have seen it is worth checking out.
Deeply guilty.
Paid well by the corrupt federal governments.
Highly Profitable $ MANDATED SALES & Government funded...
Are you interested in which USA NIH & CDC leaders owned Rich amounts of extremely profitable stocks $ ?
……and the whole entire time they were genuinely laughing at us…and still laughing at us.
RIGHT ALONG WITH THE GOVERMENT WHO ALLOWED IT
NO SORRY!
They will do it again. It’s jail time
Why would ANYONE trust the Pharmaceutical Industry. Seriously- wake up.
@@TORY-BLUEbye bye bot!!!
@TORY-BLUE prove it, or it never happened........
@@TORY-BLUE you are so 2020 lol
@@TORY-BLUEGo get more boosters. You can have my share.
@@TORY-BLUE What number you on? 8? 9? Yeah they work so well, it’s not a vaccination either, yr a liar 🤥
I think UA-cam should be sued also for abetting the fraud!
Facebook also
YT also provided good information. TalkRadio was presenting a balanced view throughout, so after a short while it became obvious that jabs simply were not beneficial or necessary for most of us.
Indian people have power in UA-cam band all information I see CEO being asked she get away at list now!
@@RedRupert64No, UA-cam have actively taken down or banned literally anyone who said a negative word about the vaccines even when it was evidence based and left videos online containing absolute garbage mainstream propaganda
People don’t realise how ‘leaky’ UA-cam is. Without it large a proportion of awake people would still be asleep. I think there’s enough evidence to suggest there’s a white hat at play, suing yt would be a grave mistake imo.
Deeply sorry? For what has happened as a result of their abuse of drugs, they should be banned from ever distributing drugs again!
They also need to stop brainwashing doctors who end up prescribing these drugs and regurgitating whatever they're told. "Oh, well, yes, there are risks with these medications, but they're on the market so they must have benefits." Sure, thought-sayers!
Can we assume the same applies to the US and the rest of the world???
Not just distributing, but developing!
The problem is, some medication can only be gotten from this company. If we ban them, lots of people will suffer or even die.
Should be deeply in jail.
Anyone that took the Pfizer jabs is owed REPARATIONS - BIGTIME !!!
Omg. I have been always sick after pzeifer
In my country (Canada), they've already successfully been sued by claimants of vaccine injuries since they started accepting claims in June 2021. They've already paid out almost $2.8 million, and the maximum payout is $250,000. Here are some of the people who have won compensation:
1. Paul Wightman from Lake Country, British Columbia who developed Guillan-Barré syndrome.
2. Carrie Sakamoto from Lethbridge, Alberta who developed Bell's Palsy.
3. Julian Scholefield from Summerland, British Columbia who became paralyzed from the waist down and now requires a wheelchair.
In my country (Canada), they've already successfully been sued by claimants of vaccine injuries since they started accepting claims in June 2021. They've already paid out almost $2.8 million, and the maximum payout is $250,000. Here are some of the people who have won compensation:
1. Paul Wightman from Lake Country, British Columbia who developed Guillan-Barré syndrome.
2. Carrie Sakamoto from Lethbridge, Alberta who developed Bell's Palsy.
3. Julian Scholefield from Summerland, British Columbia who became paralyzed from the waist down and now requires a wheelchair.
As much as I hate that people have suffered, the information and evidence against the vaccines was clear as day and such individuals made their own decision.
“Anti-vaxers” were right all along and yet were given death threats, violence, blackmail, manipulation, isolation… You name it.
Me two I've been in and out of hospital for biological things on my face which has been removed thing I've been 3 times now got two more growing back in the same place were I had them cut out I now don't trust the government at all now what do you thing any one else hava the same problem
Whenever I write down 3 things I am grateful for, before bed each night, my NOT taking "it" is often on the list. I never came close to taking it. It's one of the things I'm most proud of in my lifetime and proud of myself for. I'm very impressed with myself. Friends and family succumbed. My confidence has gone up so much because of that. I realized I can trust myself and hold the line against immense pressure and I am very strong.
Loved seeing you ride the Honda motorbike!! 😊
Me too, I’m with you on that! ❤️😊
Sorry my arse!! The NHS are still offering it to pregnant women!! 🤬🤬
It's madness, isn't it!
Pregnant women advised not to drink, not to smoke, not to eat raw eggs or soft cheeses, caution with certain medications, but hey, queue up for your covid jab.
It's maddening!!!!
Same in the states.
And to patients about to undergo major surgery. lung removed, diaphragm taken out, spleen removed and the lining of the heart replaced. Why would you worry about getting the v I r u s and yes had the jabs to save sick parents.
@@VL-qy4fcyep, but ok to vape
I will never Forget or Forgive those involved
No absolution. No amnesty! Not for the makers of, or the governments that forced this poison.
100%
Punishment is due
"Deeply sorry. Purposely lying is just second nature to me" 😢
They are only sorry because they have been exposed!
Their work is done. Apologising after the event does not change the event 😊xx
For all the people harmed by the covid vaccine i feel for you and hope oneday justice will be served to Pfizer
yea yea hopium thats all that is
I vividly remember how l was treated. I don’t feel nothing for anyone harmed by the clot shot.
@@purebloodnordicroamer7955fear is the top human motivator, as well as being a logic killer.
I'm glad I'm not as stupid as they, but I feel for anyone hurt because they tried to do what they thought was correct.
It's a huge mental leap to realise that not only do governments not care about you, but they actively want you dead.
It's too much for many.
There are other Pharmaceutical companies that pedaled their goodies as well, but the main thing is no one is saying the drug is dangerous.
😷 There will be NO accountability and NO punishment. Remember that governments worldwide granted covid vaccine suppliers Pfizer and BioNTech indemnity from any claims that may arise from use of the vaccine.
It shows who the govt answer to despite the threat to the population. Sickening.
Sorry is not an excuse. Cheap n meaningless. Get ready to compensate n face criminal charges
Their vaccine always mentioned they do not assume liability people just can't read, reason I never took it
Same for this guy...
@@MorgMorg-uf6ps lol drone go back to your three letter agency you puppet
That won’t happen, EVER
@@goelat2267 you guys won't even let me leave a single comment on this, crooks the lot of you.
Fined £13,700!! Imagine the laughter in the Pfizer boardroom 😂🤣🤣🤣😂
WHAT?
One second of profits!
😂😂😂😂😂😂😂😂😂😂😂😂😂
Should be at least £13 999.99.
The infraction is a very minor one, you have to admit.
Sue them into bankruptcy!!
Class action against Pfizer for, say, $5tn just for starters.
Deeply sorry for beeing caught...
God bless you Dr Campbell.
I’m deeply sorry I listened to the So called experts and got the jab so I could keep my job. I’m deeply sorry that I had to tell my daughter that I have stage 4 lymphoma. I’m deeply sorry for the hell my family went through because of my cancer when i spent 43 days in hospital 12 of them in ICU on a ventalator. But all is ok because Pfizer is sorry
So sorry, Kevin. I tried to warn everyone, for 6-9 months on this podcast. Finally, Dr Campbell decided to do the research and was shocked with his findings!! Many were duped by governments and big pharma!!!!!!
So sorry Kevin! I tried to warn all on this podcast, until Dr Campbell did the research...
So sorry Kevin! My reply keeps getting deleted??
I am so sorry to hear your story.
So many people are in your situation and it's so unfair.
I will pray for you and your family.
As much as I'm relieved that I never had the 'Jab', I still worry about the people who fell for the lie. (especially family members)
Eeeeeeexxxxxxxaaaaaaaccccccctttttttlllllllyyyyyyy !!! ! !!!
I don't I have no sympathy whatsoever
Yes everybody who took the Pokie is somebody's family member
Me too, family and friends
Same here, 68 yrs young and have never had any kind of jab in my adult life, when this vaxx hit here I warned all family and friends, most listened but my 61 yr young brother let the fear get to him, he did the dirty deed and is dead now,his heart was " shredded"!
NEVER forget and NEVER forgive!!
We must forgive others. Remember, our Creator said "Vengeance is Mine, I will repay."
@@AliciaLovesYAHUSHA I hope this kind phrase will not be used in courts as an escape goats for the hardened criminals in the future.
Well did you forget the other lawsuits in their shady past? Must have.
@@Mouse73 You're clearly haven't been paying attentions lol
They responsible for my mums death.Suffered a stroke on the same day after 1st dose.Stopped walking.I am battling unexplained fatigue.
Thought I was the only one
So sorry for yr loss. I’m very fatigued also. I wonder if it’s because I had Pfizer then. X
@@donnawileman9586Depends on how much sleep you're getting and how much water you're drinking. Also could be underlying health conditions that were never addressed. You could be overworking yourself. Your diet has a massive role in it. I'm not trying to outright deny Pfizer having negative effects but you guys are literally blaming everything on the vaccine. It's like that one thing that happened where everyone would blame literally anything that happened on Obama like stepping on a Lego or something. If your fatigued it is probably because of your lifestyle
My wife and I also have unexplained fatigue... I also had a heart attack three weeks after the first pfizer jab all they could find was a blood clot.
I've also been having debilitating unexplainable fatigue that started after the vaccine. Can't believe I fell for it. Hang in there we'll get through this
We are deeply sorry for the mass murder and the 80 billion profit, now can we just draw a line under it and move on!
It didn't effect everyone the same....I'm still wondering what's different
He's only 60+
Not too old
THIS
@@kathleenking47 Really, saying some intervention isn't universally lethal doesn't make it worth taking.
actually 600 billion.
We have yet to see how it affects future generations.
They need to give back all the profits they made, then fine them.
They are deeply richer.
I’m deeply happy I listened to my intuition
Pfrizer lied, And yet we still have the Covid-19 vaccine information from the NHS tag on this video!
…and the cdc, which by the way is a private company
Boycott any Pfizzer product
That's a stiff ask 😂
I take no drugs at all.
Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.
Sue them first.
🤬 There will be NO accountability and NO punishment. Remember that governments worldwide granted covid vaccine suppliers Pfizer and BioNTech indemnity from any claims that may arise from use of the vaccine.
Profit from pushing poison to children is unforgivable. Never forgive, never forget. TRUST IS GONE!
it was the parents. i know parents who give it to the kids so they could go on holiday. unforgivable
@@kjeksklaus7944true they had to in order to travel/ work … it was made as a mandatory thing which is a violation! you cannot force people to inject shit in themselves if they don’t want to. so these kids they always need their shot like the flu and etc… so they think nothing of it cus they are children’s and don’t really grasped what it is they are putting in their bodies.
@@kjeksklaus7944 The parents were fooled. My parents vaccinated me when I was a child and I'm healthy. Don't blame the parents.
@@crazyfakar1what is your CRP, HbA1c as a starter?
@@kjeksklaus7944 Not every parent knows what you know. Don't try to use my ignorance of diabetic levels against parents who wanted to protect their children and assumed that vaccines were still trustworthy like they were when I was young. I have no children and no plans to make any. I am just not willing to blame the parents like you are, you think you are smart, but you don't know that vaccines were trustworthy and worked for a long time.
I used to bike 13 klm one way at 30 to 40 klm a hour in the summer at least. Winter not so much. Three months after I got the jab I started having problems breathing. After six months I was biking at 10 to 15 klm a hour. Now after one year I am on oxygen. Governments need to be held accountable.
If they are deeply sorry.. then they are admitting that their vaccines were unsafe.
There should now be a class action lawsuit launched against them.
Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.
no they are only sorry they promoted the jab before it was allowed to be promoted
It was about misleading on social media, that's probably as good as we're going to get.
Janine Small admitted it publicly in front of the EU Parliament.
😷 There will be NO accountability and NO punishment. Remember that governments worldwide granted covid vaccine suppliers Pfizer and BioNTech indemnity from any claims that may arise from use of the vaccine.
Reduce carbon and the carbon is you Bill Gates.
Love it. What a great way of saying it.
Is that a song?
Novak Djokovic I continue to applaud you.
Novaxx Djokovic is a great example of a free thinking man who listens to his own gut to decide what is right and wrong for himself. I think next time more people will follow in that example...
Thank you for speaking out.
Boycott pfizer and moderna
@@TORY-BLUEBot
@@lisac1619 he is in survival mode.... probably spent his career in the sciences or pharmaceutical fields. his belief is crashing down but his arrogance and stubbornness is all he has left to cling to.... hopefully they will get a vaccine soon to help people like him/her ;)
our governments certainly don't want to, unless a tony blaire figure pops out, demanding lawsuits for those who have gotten hurt or worst.
It is almost impossible to boycott them. They produce chemicals used by almost every industry.
@@kylegrace4718 They made one. It's not helping him but its helping us getting rid of him. Not many left like him so its working quite fine.
I will never forget or trust our government for they did to us ever again.
Our government is handing over it's power to the WHO. you ain't seen nothing yet.
Same
They were terrible but Labour would have been even worse.
Same here. I've always been a big supporter of my country's government. Military brat here. But now, I will NEVER trust them again.
You have done an INCREDIBLE SERVICE by making these videos , may God bless you and your family 🧡🧡🧡 thank you
They're only sorry that they're getting successfully sued, not that they've hurt anybody. They've already had to pay out almost $2.8 million in my country (Canada) since they started accepting claims in June 2021. 😒
Where is Johnson where is Hancock and Blair ? They constantly pushed this junk
The drug companies will be the fall guys. My research has shown me that it was made to order..
@@joetodd4351 it was made pre covid
But so did John , even urging pregnant women to take it
It matches their brains 🧠
Money can make people do anything. When they have no conscious
Not deeply sorry enough to return the billions in ill-gotten gains.
Eeexxxaaaccctttlllyyy !!! ! !!! Their hidden evilness is clearly showing on the outside !!! ! !!!
HEAR, HEAR!!
Good on you Dr Campbell
They don't give a flying shit, just like du-pont
Millions of Dead
Billions of Wounded
Trillions of Profit
Well said & spot on holiday.
Met all the goals.
@@thominaduncanson7596billions is the goal
Where is Gates, Tech execs, Mockingbird media, and WHO loud mouths!
And that’s just the result of Johns misinformation and anti vax grifting, Lol