To withdraw it now after pushing it so heavily would be admitting culpability, and the claims will flood in, as pfizer is protected from liabilty, so the gov will have to renumerate people for lives destroyed. Money trumps human life.
I was saying the entire time. Vaccine testing takes 10+ years for a real approval. So it coming out 7 months after we discovered the virus already told me it wasn't tested properly... but they didn't even do short term testing on it lol. The smart people didn't even take the vaccine. I will take the 0.02% death rate of covid over an untested vaccine any day. As I have no immune difficiencies I'm not going to die from covid... hopefully these liberals screaming about being woke actually wake up one day. Because we are literally devolving at this point
So sorry you can't get an organ transplant unless you're "current ". So sorry it's part of the childhood immunization series. So sorry they're developing a self-replicating version for future " pandemics." So sorry they are now profiting off of the people who are now seriously ill. When are all madantes revoked?
That's the problem. The dopes didn't make billions. The blew it. All of it. Their stock is in the tank (been there for over a year) and have NO promising drugs in the pipeline. Disgraceful. In a normal capitalist market they would be bankrupt.
I totally agree! They were totally CRIMINAL along with the Gvts, all media outlets, Celebrities etc who all promoted this poison for a kickback! Talk about a new age HOLOCAUST!
United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats?? Military created the poison. Depopulation !
@@joe9042they do. Karmic laws will destroy them. Maybe not in this life but it’s prepared and everybody’s gonna get the taste of their own shit + more.
NEVER forget willigoats. If it's anti-GOD's creation, if it's anti-human....Sauron, private bankers (you-know-who) & willigoats are somewhere close by pulling strings.
Deeply sorry means nothing to those that have had their lives destroyed and the families that lost loved ones. Pfizer should be paying reparations to all those affected.
7 місяців тому+33
Deeply sorry means nothing to the pharmaceutical group either.
Davo here from sunny beautiful Australia. I want more people to become aware of the three words I learnt during the covid fiasco. PERFIDIOUS. ASSININE. Non SEQUITUR. Check the definitions,and lock them in ready for the next bit of BS you hear from government,the media,big pharma or your "doctor" 😊.
Blood on their hands, billions in profit made on human suffering and unsafe trials on human. Apology not accepted, get fined and jail! They are criminals! Thank you for exposing these corrupted hypocrites.
Almost all governments were working with them. Who is to hold them accountable when the people that would do that are also in on it. This wasnt just 1 company doing this..
Trillions. For those going through this, some extended fasting, low carb diet, taurine and methylene blue can help a great deal. Some benefits of occasional extended fasting and lowering carbs in the diet: High blood pressure is lowered to normal levels very quickly while fasting. Fibrosis/scarring is reversed over time, including in the heart and lungs. Vitamin D plasma levels are increased as fasting improves metabolic health, and vitamin D in turn increases autophagy. When insulin is high, vit D stays locked in the blood cells. Fasting stimulates phagocytosis, the ingestion plaques, growths and pathogens by the immune system. This will also remove spikes quicker, whether natural or unnatural in origin! Your body recycles up to 1/3 of all immune bodies in a 72h fast, rejuvenating your entire immune system. This helps with autoimmune disease, cancers and cytokine storm. Fasts from 36-96 h increase metabolic rate due to norepinephrine release! Clots and plaques are removed over time due to accelerated phsocytosis. Fasting improves your circadian rhythm to normal over time. Blood sugar and insulin are lowered when fasting, reducing inflammation and allowing the immune bodies to move freely through the body. T cells and T reg cells are vital in fighting cancer, autoimmune disease and infections. As we age, the thymus stops making as many of them but fasting releases stem cells, which then can become new T cells. It also releases growth hormone, which regenerates the thymus itself! Fasting increases anti-aging Yamanaka factors and increases average telomere length in stem cell pools. Fasting can help with MS, Depression, BPD, Autism and seizures. When you move out of MTOR your body shuts down the building blocks of the cell required for viruses to replicate. The hunger hormone ghrelin also lowers with extended fasting and rises from dieting. What breaks a fast? Anything with protein or carbohydrates in it will break a fast but most teas and herbs are OK. Supplements and meds often break ketosis directly or contain a filler that will. Many meds are dangerous to take while fasting. Does fasting lower testosterone? No, it raises it when the fast is broken by increasing lutenizing hormone. Fasting also increases insulin sensitivity, which helps with muscle building. Fasting activates autophagy (literally self eating). This will cause cells to recycle damaged proteins and foreign matter such as viruses. Lowering insulin via fasting virtually eliminates chronic inflammation in the body. Weight loss from daily caloric restriction has 1/4 to 1/3 of the weight lost as lean tissue while many studies show fat loss from 36 h fasts without losing any lean tissue! Fasts of 36-96 will not affect short term female fertility or affect menstrual cycle. They also may increase long term fertility for some women. It increases mitochondrial function and repairs mitochondrial DNA, leading to improved ATP production and oxygen efficiency. Increased mitochondrial function also has the added benefit of increasing your metabolism, fighting infection and cancer prevention! 24h of fasting can cut your leptin levels in half! This reduces leptin resistance, which impairs immune function. Fasting reduces pain and anxiety by stimulating the endocannabinoid system, just like the effect of CBD oil Stomach acid is reduced over time while fasting and can allow for the healing of treatment resistant ulcers. Some patients may need continued acid reduction medication while fasting. When the fast is completed, your stomach acid levels will be normalized. Your brain also prefers to burn ketones at a rate of around 2.5 to 1 when they are available in equal quantity to glucose. Except for brief periods of very intense exercise, your body mainly burns fats in the form of free fatty acids. Fasting releases BDNF and NGF in the blood. This stimulates new nerve and brain cell growth, which can help a great deal with diseases like MS, peripheral neuropathy and Alzheimers. When not in ketosis, the brain can only burn carbohydrate, which produces a great deal of damaging ROS the brain has to deal with. Fasting increases telomere length, negating some of the effects of aging at a cellular level. When you fast, this stimulates apoptosis in senescent or genetically damaged cells, destroying them. Senescent cells are responsible for many of the effects of aging and are a root cause of the development of cancer. A fasting mimicking diet for 3-5 days in a row provides many of the same benefits as water fasting. FMD usually has 200-800 calories, under 18 g of protein and extremely low carbs. Exogenous ketones can aid with fasting, making it easier in healthy people and allowing some people with specific issues to fast in spite of them without worrying as much about hypoglycemia. They also help with dementia and many other issues even if you take them while not fasting! Glycine and trimethylglycine can also be useful supplements while fasting that won't break ketosis and have many benefits. Children, pregnant or nursing women should not fast for periods longer than 16 hours. People with pancreatic tumors or certain forms of hypoglycemia generally cannot fast at all. Type 1 diabetics can also fast but it is more complicated and should be approached with caution as it could lead to ketoacidosis. If you experience extreme symptoms of some kind, especially dizziness or tremors, then simply break the fast and seek advice. Resources: www.ncbi.nlm.nih.gov/pmc/articles/PMC6141719/ www.ncbi.nlm.nih.gov/pmc/articles/PMC3017674/ www.sciencedirect.com/science/article/pii/S0005272806000223 www.clinicaltrials.gov/ct2/show/NCT04375657 www.nejm.org/doi/full/10.1056/NEJMc2001176 pubmed.ncbi.nlm.nih.gov/31877297/ www.ncbi.nlm.nih.gov/gene/25712 pubmed.ncbi.nlm.nih.gov/20921964/ pubmed.ncbi.nlm.nih.gov/29727683/ www.ncbi.nlm.nih.gov/pmc/articles/PMC5895342/ pubmed.ncbi.nlm.nih.gov/33530881/ www.arcjournals.org/pdfs/ijrsb/v3-i11/7.pdf pubmed.ncbi.nlm.nih.gov/27569118/ www.cell.com/cell-metabolism/abstract/S1550-4131(15)00224-7 clinical.diabetesjournals.org/content/36/3/217 www.ncbi.nlm.nih.gov/pubmed/23876457 www.sciencedirect.com/science/article/pii/S1931312809002832 pubmed.ncbi.nlm.nih.gov/15522942/ www.ncbi.nlm.nih.gov/pmc/articles/PMC7607739/ www.ncbi.nlm.nih.gov/pmc/articles/PMC7093158/ www.ncbi.nlm.nih.gov/pubmed/10859646 www.ncbi.nlm.nih.gov/pmc/articles/PMC6407435/ www.cell.com/molecular-cell/fulltext/S1097-2765(18)30605-1?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1097276518306051%3Fshowall%3Dtrue pubmed.ncbi.nlm.nih.gov/28235195/ www.ncbi.nlm.nih.gov/pmc/articles/PMC2815756/ www.nia.nih.gov/news/research-intermittent-fasting-shows-health-benefits medicalxpress.com/news/2022-10-treatment-pulmonary-fibrosis-focus-telomeres.html www.cell.com/cell/fulltext/S0092-8674(19)30849-9 onlinelibrary.wiley.com/doi/full/10.1111/j.1365-2265.2005.02288.x pubmed.ncbi.nlm.nih.gov/25909219/ repository.upenn.edu/cgi/viewcontent.cgi?article=1537&context=edissertations www.ncbi.nlm.nih.gov/pmc/articles/PMC1779438/ academic.oup.com/ajcn/article/81/1/69/4607679 www.amjmedsci.org/article/S0002-9629%2815%2900027-0/fulltext www.collective-evolution.com/2017/05/16/study-shows-how-fasting-for-3-days-can-regenerate-your-entire-immune-system/ pubmed.ncbi.nlm.nih.gov/7714088/ www.nejm.org/doi/full/10.1056/NEJMoa012908 pubmed.ncbi.nlm.nih.gov/23707514/ pubmed.ncbi.nlm.nih.gov/23408502/ faseb.onlinelibrary.wiley.com/doi/abs/10.1096/fasebj.2019.33.1_supplement.819.10 www.biorxiv.org/node/93305.full www.health.harvard.edu/heart-health/abundance-of-fructose-not-good-for-the-liver-heart pubmed.ncbi.nlm.nih.gov/20102774/ n.neurology.org/content/88/16_Supplement/P3.090 pubmed.ncbi.nlm.nih.gov/6859089/ www.ncbi.nlm.nih.gov/pubmed/10232622 www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/ www.ncbi.nlm.nih.gov/pmc/articles/PMC1413655/ www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/www.ncbi.nlm.nih.gov/pmc/articles/PMC8470960/ europepmc.org/article/MED/22402737?javascript_support=no pubmed.ncbi.nlm.nih.gov/2518860/ www.ncbi.nlm.nih.gov/pubmed/24905167 www.ncbi.nlm.nih.gov/pmc/articles/PMC6526871/ pubmed.ncbi.nlm.nih.gov/31890243/ www.ncbi.nlm.nih.gov/pubmed/25686106 pubmed.ncbi.nlm.nih.gov/21410865/ This list compiled over years of research by the user known as Pottenger's Human on youtube. Feel free to copy and paste this anywhere you like, no accreditation needed! My community tab will always contain an updated version of this list of fasting benefits. I also have playlists on fasting and health topics.
corporations can hurt anyone they want, and nobody behind the company will be held accountable. this is what happens when you treat corporations as people. no body to imprison, and no soul to save.
Dr.Burke was executed by firing squad at gitmo and replaced by a clone..The Dems.needed Dr.fauci more that's why he's wearing 10,000 suits and has more security than the president..His time will come..
My dad took the Pfizer boosters, subsequently got a heart attack, clotting in his feet, cellulitis and had multiple organ failure. A healthy man who walked more than athletes everyday, read libraries of books, did incredible real charity at the cost of his own wealth/meals at times, a guy who had salads daily, no stresses, did yoga and everyone thought would live to 100+. He passed away last year, we were told by doctors he had a heart attack as the causative factor. We all believe IT IS THE PFIZER-BIONTECH vaccine to blame squarely.
And why now, after they all entered in a Faustian bargain, they will do everything to cover all their arses. Not one of them has a shred of moral responsibility left.
Nobody will be held accountable. Nobody in the Epstein/maxwell case. She’s probably in a mansion off a lavish coast. Diddy won’t be held accountable. Pfizer will not be held accountable and neither will Fauci. We’re merely tax paying slaves. Voting isn’t real.
United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats?? Military created the poison. Depopulation !
So grateful my intuition was spot on once again! I refused the jab, I refused the mask, and I refused to be bullied by anyone! I am very proud of myself that I stood my ground. This has proved to me how strong I really am! I will never Ever comply, NEVER!
All or nothing is almost never a good position to take. The jab did not live up to the word vaccine. In limiting severity of disease, to include fewer deaths, it was helpful. Side effects worth considering? Yes, of course. It did not slow or stop disease transmission in humans or at laboratories in Wu Han. That goes contrary to all previous vaccines.
Highly Profitable $ MANDATED SALES & Government funded... Are you interested in which USA NIH & CDC leaders owned Rich amounts of extremely profitable stocks $ ?
I used to bike 13 klm one way at 30 to 40 klm a hour in the summer at least. Winter not so much. Three months after I got the jab I started having problems breathing. After six months I was biking at 10 to 15 klm a hour. Now after one year I am on oxygen. Governments need to be held accountable.
I lost everything, career of 23 years in health and social care, sacked after working through it all and not given a s**t about, everyone had a choice, you either had a backbone and said ‘no’ v simple or succumbed to the absolutely ridiculous amount of pressures and propaganda and brainwashing from every angle, I was even called a murderer after looking after the most vulnerable in society for over 2 decades, trust in any government or medical industry and many others infact are dead, done, over, as if they weren’t to be trusted in the first place……….yr health and wellbeing and morals and integrity are priceless, obviously many live in the controlled society built around them, that’s on them……
I was told that I wouldn't be able to get my suprapubic catheter changed if I didn't have the vaccines. They had already erased my care plan once and left me with no care at all.. I have to have a potent bladder washout every week and my catheter changed every 6wks, sometimes sooner if I have an infection, all at home by district nurse. For the first 3 months I was left with nothing. I cannot do it myself due to the after effects of a small stroke in Dec 2019. That and Neuropathy (due to over 20 years of Ciprofloxacin use for kidney infections as I have complex kidney and bladder issues). The combination makes it hard to use my hands and I physically cannot do it myself. Since the vaccines I have had 2 more small or mini strokes and the Neuropathy has caused a torn rotator cuff tendon in my shoulder, affecting my hand. I already had high BP and intermittent arrhythmias, since the vaccines these have got considerably worse with exhaustion, repeated arrhythmias going on for much longer episodes, breathlessness when talking, my sats go down to 70/75 when talking so big difference. This then leads to dizziness and falls etc due to lack of blood oxygen... I wish I had never had these damn vaccines, but I would have lost all my NHS care yet again if I had. Luckily we refused them for our daughter as by then the side effects were becoming known.
They also need to stop brainwashing doctors who end up prescribing these drugs and regurgitating whatever they're told. "Oh, well, yes, there are risks with these medications, but they're on the market so they must have benefits." Sure, thought-sayers!
I’m still waiting for my “deeply sorry” by my former employer for firing me for not getting the jab and labelling as misconduct 😡 I hope everyone involved is deeply punished and held accountable. Very deeply.
Me too , but I do keep an ear on them through good people who remained and they are suffering today , shipbuilders don't fall from trees . Loosing 35 Tradesmen from a workforce of 60 tradesmen on 2nd Feb 2021 hurt deeply and today they are unable to fill those roll's ,, Ha blardy Ha ,, Karma is a birtch aye ? . The remaining workforce are conastanly sick , day's/week's off at a time , yes they are struggling and deserve it all !
Both. The underlying nexus between the WHO (not the band), Gates, Fauci, Pfizerman and his squeeze, the Biden Crime Syndicate and the Pfizer funded media,needs total reconsideration in the light of recent events. It boils down to: Drugs for what? For health? Or for profit?
@lsmith495 if you left your job, but still have a clean bloodstream, then you can rest easy. You will be a survivor, while the righteously indignant will all be gone soon, if not already.
Whenever I write down 3 things I am grateful for, before bed each night, my NOT taking "it" is often on the list. I never came close to taking it. It's one of the things I'm most proud of in my lifetime and proud of myself for. I'm very impressed with myself. Friends and family succumbed. My confidence has gone up so much because of that. I realized I can trust myself and hold the line against immense pressure and I am very strong. Loved seeing you ride the Honda motorbike!! 😊
YT also provided good information. TalkRadio was presenting a balanced view throughout, so after a short while it became obvious that jabs simply were not beneficial or necessary for most of us.
@@RedRupert64No, UA-cam have actively taken down or banned literally anyone who said a negative word about the vaccines even when it was evidence based and left videos online containing absolute garbage mainstream propaganda
People don’t realise how ‘leaky’ UA-cam is. Without it large a proportion of awake people would still be asleep. I think there’s enough evidence to suggest there’s a white hat at play, suing yt would be a grave mistake imo.
The senior executives are probably people with business degrees. With little understanding or no backgrounds in epidemiology, vaccines, human biology, statistics, clinical and non-clinical trials, etc. You let people like that run a high-tech, scientific or engineering company, you would get bad outcomes. Just ask Boeing.
It's madness, isn't it! Pregnant women advised not to drink, not to smoke, not to eat raw eggs or soft cheeses, caution with certain medications, but hey, queue up for your covid jab.
And to patients about to undergo major surgery. lung removed, diaphragm taken out, spleen removed and the lining of the heart replaced. Why would you worry about getting the v I r u s and yes had the jabs to save sick parents.
Sorry! Many have to suffer living with brain fog for the rest of their lives. A married man with three children is having his businesses collapse because of it. Almost a fate worse than death.
Sorry for your loss Kathy; don't get sad, get angry; get very very very angry and direct that energy in a positive constructive way. Lobby for jail time for those responsible for starters.
Yep, and my father’s and 40 other people that I know who either died like he did after taking them or were hospitalized and severely harmed. Evil incarnate.
@@tripzincluded8087supposedly it happens every 138 years according to this man whose channel is called Archaix I have not gone through all his videos but he has a mountain of data to back up his claims...but from what i have seen it is worth checking out.
My dad and some elements of our family died to this. Dad took Pfizer, then started manifesting symptoms, got a heart attack then clotting and multiple organ failure. He was a very healthy man!
Dr Campbell - I have followed you since the early days of COVID19. What struck me of you, is your objectivity and scientific method in your reviews. Love your sense of humour. Thank you for your views in dark times.
I’m deeply sorry I listened to the So called experts and got the jab so I could keep my job. I’m deeply sorry that I had to tell my daughter that I have stage 4 lymphoma. I’m deeply sorry for the hell my family went through because of my cancer when i spent 43 days in hospital 12 of them in ICU on a ventalator. But all is ok because Pfizer is sorry
So sorry, Kevin. I tried to warn everyone, for 6-9 months on this podcast. Finally, Dr Campbell decided to do the research and was shocked with his findings!! Many were duped by governments and big pharma!!!!!!
United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats?? Military created the poison. Depopulation !
Yes , when it`s just a fine for killing people and they made billions + . they just look the other way , cost of doing business. Criminals for sure but if we the people don`t make some new rules it WILL continue . Very sad .
When does YT stop to act as an agent provocateur keeping promoting this not legal medical product. I am referring to the text from the WHO in the information panel just beneath the video.
Who used Parliament recently (where he cannot be prosecuted) to say 'safe and effective' in regard to Covid vaccine? Would say it outside his safety walls?
“Deeply Sorry” for me having to quit my nursing job because of horrific adverse side effects from 2 jabs that were mandated. I had to have a major surgery from the damage. “Sorry” doesn’t cut it for all of us that were damaged and all the families dealing with losses and illness from something that was supposed to protect us!!!! I have zero faith in pharmaceutical companies! Absolute crimes against humanity!!! This plandemic and all the criminals need to be exposed!
I left my nursing profession of 20 years rather than take something my clinical judgement could not possibly endorse or allow. Thank god I had a plan B. I view my complying colleagues as a collective of cowards though. Their clinical judgement would have been no different from mine, and had we as a collective stood our ground the madness would have been stopped in its tracks. That day. So yes I feel for you ... but there must be some acceptance of complicity ... like it or not ... 🌹🌹
I'm 65 and nothing in my life comes close to the criminality (throughout all facets of the establishment) that was involved with the cupid Pokie. My Harrowed heart cannot comprehend forgiveness for those who separated the dying from their families causing them to die alone as their loved ones tears stained the glass that separated them.
@@rozalynanderson8387 yeah ..its a common theme,,,you wonder who would be that callous? he chosen ones... we don't matter other than a resource to be managed controlled and exploited.... rewind repeat.
Especially that weedy Chris Whitty. A man was jailed for merely jostling him in the street yet Whitty received a knighthood. Where is the odious creep hiding these days?
Jobs… don’t forget lives and health and peace of mind for all those who now understand it was a mistake to comply and they don’t know when they will be affected.
Well said. Somehow, the 'ones with the power' get off scott-free. They make sure that those lower down are left to carry the responsibility for their greed and corruption. It's sickening. "Sorry" isn't good enough!
The fines are shareholder money. So my bonus is not what it was last year. In 18 months he is being interviewed on the business channel of how he steered the ship through rocky times. What a hero!
Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.
Theyve done it before, with a medicine for haemophiliacs, a batch was tainted with HIV, they knew it, it was banned from sale by in America by an American judge. So they sold it to countries outside of America, with the exact consequences that youd expect. They knew, they just preferred causing death, misery and suffering over taking a loss. Im sure youll find many more cases if the internet hasnt been scrubbed, I havent looked in a long while, google search is worse now.
I guessed Perth straight away; black boys and sandy hills and sun. I can't believe John was just a few k's from home. Thankyou John. You were a single candle of reason in a sea of darkness for the last 3 bloody years. I lived through the world's longest lockdown in Melbourne. I watched you daily. The moment the border opened I got straight to Perth. Never looked back. signed, a devotee of reason, and a wagirl, Perth Australia.
Same here, 68 yrs young and have never had any kind of jab in my adult life, when this vaxx hit here I warned all family and friends, most listened but my 61 yr young brother let the fear get to him, he did the dirty deed and is dead now,his heart was " shredded"!
And people in power with double interests. Ursula Vander Leyen's husband is in gentech. And she ordered 1,8 billion vaccines from Pfizer without a debate in the EU parliament or its approval.
tbh no medical company should be listed on the stock exchange. Profits shouldnt be associated with health. Not saying the business can't make a profit but shouldn't involve the pressure of pleasing shareholders.
@@Truthseeker-iz3dj Total reform is obviously needed. Unfortunately some very cowardly and immoral people would rather die of ignorance and lose their freedom, than admit that they made a mistake. that is how deeply embedded the sat£nic cu$lt has driven narcissism in the world. It is extremely biblical!
Unless an example is made this will happen again ! People died due to government propaganda and poor medical advice. Covid was a scam on an epic scale that killed l a lot of loved ones ! man made hell !
Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.
😷 There will be NO accountability and NO punishment. Remember that governments worldwide granted covid vaccine suppliers Pfizer and BioNTech indemnity from any claims that may arise from use of the vaccine.
One of the very few Brits who makes me feel proud to be English. Delicious low key style, a true doctor who can lift your spirits just listening to him! Deeply humorous with a straight face. The world needs more people like you Dr. Campbell. From Jenny James, 5 decades since I headed for the Andean mountains, leaving England in disgust. So glad you exist, a voice of sanity midst the cacophony of lies.
I am trying to tell you that there is a internet page with protocols. Done by frontF lineL covidC criticalC careC doctors. Keeps getting scrubbed off. Wonder why Dr John Campbell is not talking about it?
They should be brought to justice. My ex wife's life is on their hands. She passed in August of stage 4 cancer, no family history and non hereditary. Figure that one out
Deeply sorry, yeah after they were exposed. They should all be in jail.
that's anti-semitic
@@AddisTime
Lol.
they supported pseudo-science while suppressing (with a lot of help) real evidence based science
🎯🎯🎯
worse. history hasn't been happy with them multiple times. they were expelled over 100 times from almost every nation for behaviour like this.
Deeply sorry, deeply sinister and they should be deeply in jail
🎯🎯🎯
AMEN.UNDER IT.❤❤
Absolutely
6 feet deeply :)
Amen. Pray for Nuremberg Trials.
Why is this drug still being pushed on vulnerable patients then???? Government and NHS guilty of criminal acts
Very sad.
To withdraw it now after pushing it so heavily would be admitting culpability, and the claims will flood in, as pfizer is protected from liabilty, so the gov will have to renumerate people for lives destroyed. Money trumps human life.
see Hugo talks: Spanish Flu Bolshevik Revolution HISTORY REPEATING?
They push it period. Signs in "doctors'" offices, pharmacies. "Get your free covid shot here". They really think we're that stupid. INSULTING!
Slowly... the people starting to realize what the pharmaceutical industry and the governments ACTUALLY is about. In reality.
NEVER FORGET WHAT THESE MONSTERS DID TO MANKIND AND OUR LIVELIHOODS!
I'm not going to Forget THAT OUR GOVERNMENTS.....ALLOWED THEM TO PULL THE WOOL OVER OUR EYES...... THEY'REJUST AS MUCHTOBLAME!.
then there's that part too
I was saying the entire time. Vaccine testing takes 10+ years for a real approval. So it coming out 7 months after we discovered the virus already told me it wasn't tested properly... but they didn't even do short term testing on it lol. The smart people didn't even take the vaccine. I will take the 0.02% death rate of covid over an untested vaccine any day. As I have no immune difficiencies I'm not going to die from covid... hopefully these liberals screaming about being woke actually wake up one day. Because we are literally devolving at this point
The only thing they're "deeply sorry for is they got caught. 😡
Exactly!
ABSOLUTELY!!!!!
Precisely.
Fortunately truth catches up sometimes it just takes a bit of time
Absolutely Correct!
Pfizer is "deeply sorry". Not yet... Let's not forget that virtually every western government was complicit in this.
Australia certainly was a lot of crooks here.
Canada 🇨🇦 too.
All should be held responsible.
WHO
Because they were paid
@StirlingLighthouse You mean Post National Canada comrade
Sorry for making billions of $ while ruining millions of lifes.
This is just routine for them...
I thought making money is always supposed to be more important than saving lives right …?
So sorry you can't get an organ transplant unless you're "current ".
So sorry it's part of the childhood immunization series.
So sorry they're developing a self-replicating version for future " pandemics."
So sorry they are now profiting off of the people who are now seriously ill.
When are all madantes revoked?
That's the problem. The dopes didn't make billions. The blew it. All of it. Their stock is in the tank (been there for over a year) and have NO promising drugs in the pipeline. Disgraceful. In a normal capitalist market they would be bankrupt.
Unfortunately I think this is true
I totally agree!
They were totally CRIMINAL along with the Gvts, all media outlets, Celebrities etc who all promoted this poison for a kickback!
Talk about a new age HOLOCAUST!
Companies run by psychopaths don't actually feel remotely remorseful!
No, all they care about is the money they're making.
Until they have loved ones of their own.. even then I don’t think these corporate overlords are capable of sympathy.
Neither, do they face justice!
United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats??
Military created the poison. Depopulation !
@@joe9042they do. Karmic laws will destroy them. Maybe not in this life but it’s prepared and everybody’s gonna get the taste of their own shit + more.
Don’t forget Bill Gate who funded, promoted and made Billions of dollars off of it!
And all your favourite celebrities
Yes NEVER forget.
Big money and deep state rule the Western world 😢😢😢
Juist
Dat is een grote schoft en geldwolf
NEVER forget willigoats. If it's anti-GOD's creation, if it's anti-human....Sauron, private bankers (you-know-who) & willigoats are somewhere close by pulling strings.
Deeply sorry means nothing to those that have had their lives destroyed and the families that lost loved ones. Pfizer should be paying reparations to all those affected.
Deeply sorry means nothing to the pharmaceutical group either.
Davo here from sunny beautiful Australia.
I want more people to become aware of the three words I learnt during the covid fiasco.
PERFIDIOUS.
ASSININE.
Non SEQUITUR.
Check the definitions,and lock them in ready for the next bit of BS you hear from government,the media,big pharma or your "doctor" 😊.
Pfizer can't be sued the Governments of the World gave them immunity. People en mass who got jabbed should be suing the Government.
@@royferguson2297
You are correct! But , sue the government? Good luck with that .😬
Words r cheap especially words of liars n thieves
They are not sorry at all. They should be behind bars for what they've done. Thank you, Dr. John.
Yes, you are correct. The ugly truth is that it's all about money for them. They will do anything, murder, cheat, lie etc for money!
It's Nurse John
I bet they are sorry that they've been caught.
@@jodiknight2820 What do you think this apology is for?
@@happytwolaffs6454 is a doctor though...
Has a docrate..
Heard it like this; “Everybody take it” “Everybody shut up”
and “Nobody can Sue”
That's exactly how it was. They also said you can't work unless you take it.
Or can’t travel or visit hospital patients?
Or swim or go to the restaurants in Trumps hotels. Does everybody forget that he backed them right up?
@@katesun2957 dont care about your politics, this is crime against humanity
Everybody can sue. Their exemption is not valid since they knew what they were doing.
"An apology without a change in behaviour is just manipulation "
Well said.
🎯🎯🎯
Financial change behavior to those who took it
How sorry is Campbell?
....While they prepare for disease X. Yup, Yup Yup!
Blood on their hands, billions in profit made on human suffering and unsafe trials on human. Apology not accepted, get fined and jail! They are criminals! Thank you for exposing these corrupted hypocrites.
Almost all governments were working with them. Who is to hold them accountable when the people that would do that are also in on it.
This wasnt just 1 company doing this..
Trillions. For those going through this, some extended fasting, low carb diet, taurine and methylene blue can help a great deal. Some benefits of occasional extended fasting and lowering carbs in the diet: High blood pressure is lowered to normal levels very quickly while fasting. Fibrosis/scarring is reversed over time, including in the heart and lungs.
Vitamin D plasma levels are increased as fasting improves metabolic health, and vitamin D in turn increases autophagy. When insulin is high, vit D stays locked in the blood cells.
Fasting stimulates phagocytosis, the ingestion plaques, growths and pathogens by the immune system. This will also remove spikes quicker, whether natural or unnatural in origin!
Your body recycles up to 1/3 of all immune bodies in a 72h fast, rejuvenating your entire immune system. This helps with autoimmune disease, cancers and cytokine storm.
Fasts from 36-96 h increase metabolic rate due to norepinephrine release!
Clots and plaques are removed over time due to accelerated phsocytosis.
Fasting improves your circadian rhythm to normal over time.
Blood sugar and insulin are lowered when fasting, reducing inflammation and allowing the immune bodies to move freely through the body.
T cells and T reg cells are vital in fighting cancer, autoimmune disease and infections. As we age, the thymus stops making as many of them but fasting releases stem cells, which then can become new T cells. It also releases growth hormone, which regenerates the thymus itself!
Fasting increases anti-aging Yamanaka factors and increases average telomere length in stem cell pools.
Fasting can help with MS, Depression, BPD, Autism and seizures.
When you move out of MTOR your body shuts down the building blocks of the cell required for viruses to replicate.
The hunger hormone ghrelin also lowers with extended fasting and rises from dieting.
What breaks a fast? Anything with protein or carbohydrates in it will break a fast but most teas and herbs are OK. Supplements and meds often break ketosis directly or contain a filler that will. Many meds are dangerous to take while fasting.
Does fasting lower testosterone? No, it raises it when the fast is broken by increasing lutenizing hormone. Fasting also increases insulin sensitivity, which helps with muscle building.
Fasting activates autophagy (literally self eating). This will cause cells to recycle damaged proteins and foreign matter such as viruses.
Lowering insulin via fasting virtually eliminates chronic inflammation in the body.
Weight loss from daily caloric restriction has 1/4 to 1/3 of the weight lost as lean tissue while many studies show fat loss from 36 h fasts without losing any lean tissue!
Fasts of 36-96 will not affect short term female fertility or affect menstrual cycle. They also may increase long term fertility for some women.
It increases mitochondrial function and repairs mitochondrial DNA, leading to improved ATP production and oxygen efficiency. Increased mitochondrial function also has the added benefit of increasing your metabolism, fighting infection and cancer prevention!
24h of fasting can cut your leptin levels in half! This reduces leptin resistance, which impairs immune function.
Fasting reduces pain and anxiety by stimulating the endocannabinoid system, just like the effect of CBD oil
Stomach acid is reduced over time while fasting and can allow for the healing of treatment resistant ulcers. Some patients may need continued acid reduction medication while fasting. When the fast is completed, your stomach acid levels will be normalized.
Your brain also prefers to burn ketones at a rate of around 2.5 to 1 when they are available in equal quantity to glucose. Except for brief periods of very intense exercise, your body mainly burns fats in the form of free fatty acids.
Fasting releases BDNF and NGF in the blood. This stimulates new nerve and brain cell growth, which can help a great deal with diseases like MS, peripheral neuropathy and Alzheimers.
When not in ketosis, the brain can only burn carbohydrate, which produces a great deal of damaging ROS the brain has to deal with.
Fasting increases telomere length, negating some of the effects of aging at a cellular level.
When you fast, this stimulates apoptosis in senescent or genetically damaged cells, destroying them. Senescent cells are responsible for many of the effects of aging and are a root cause of the development of cancer.
A fasting mimicking diet for 3-5 days in a row provides many of the same benefits as water fasting. FMD usually has 200-800 calories, under 18 g of protein and extremely low carbs.
Exogenous ketones can aid with fasting, making it easier in healthy people and allowing some people with specific issues to fast in spite of them without worrying as much about hypoglycemia. They also help with dementia and many other issues even if you take them while not fasting!
Glycine and trimethylglycine can also be useful supplements while fasting that won't break ketosis and have many benefits.
Children, pregnant or nursing women should not fast for periods longer than 16 hours. People with pancreatic tumors or certain forms of hypoglycemia generally cannot fast at all. Type 1 diabetics can also fast but it is more complicated and should be approached with caution as it could lead to ketoacidosis. If you experience extreme symptoms of some kind, especially dizziness or tremors, then simply break the fast and seek advice.
Resources:
www.ncbi.nlm.nih.gov/pmc/articles/PMC6141719/
www.ncbi.nlm.nih.gov/pmc/articles/PMC3017674/
www.sciencedirect.com/science/article/pii/S0005272806000223
www.clinicaltrials.gov/ct2/show/NCT04375657
www.nejm.org/doi/full/10.1056/NEJMc2001176
pubmed.ncbi.nlm.nih.gov/31877297/
www.ncbi.nlm.nih.gov/gene/25712
pubmed.ncbi.nlm.nih.gov/20921964/
pubmed.ncbi.nlm.nih.gov/29727683/
www.ncbi.nlm.nih.gov/pmc/articles/PMC5895342/
pubmed.ncbi.nlm.nih.gov/33530881/
www.arcjournals.org/pdfs/ijrsb/v3-i11/7.pdf
pubmed.ncbi.nlm.nih.gov/27569118/
www.cell.com/cell-metabolism/abstract/S1550-4131(15)00224-7
clinical.diabetesjournals.org/content/36/3/217
www.ncbi.nlm.nih.gov/pubmed/23876457
www.sciencedirect.com/science/article/pii/S1931312809002832
pubmed.ncbi.nlm.nih.gov/15522942/
www.ncbi.nlm.nih.gov/pmc/articles/PMC7607739/
www.ncbi.nlm.nih.gov/pmc/articles/PMC7093158/
www.ncbi.nlm.nih.gov/pubmed/10859646
www.ncbi.nlm.nih.gov/pmc/articles/PMC6407435/
www.cell.com/molecular-cell/fulltext/S1097-2765(18)30605-1?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1097276518306051%3Fshowall%3Dtrue
pubmed.ncbi.nlm.nih.gov/28235195/
www.ncbi.nlm.nih.gov/pmc/articles/PMC2815756/
www.nia.nih.gov/news/research-intermittent-fasting-shows-health-benefits
medicalxpress.com/news/2022-10-treatment-pulmonary-fibrosis-focus-telomeres.html
www.cell.com/cell/fulltext/S0092-8674(19)30849-9
onlinelibrary.wiley.com/doi/full/10.1111/j.1365-2265.2005.02288.x
pubmed.ncbi.nlm.nih.gov/25909219/
repository.upenn.edu/cgi/viewcontent.cgi?article=1537&context=edissertations
www.ncbi.nlm.nih.gov/pmc/articles/PMC1779438/
academic.oup.com/ajcn/article/81/1/69/4607679
www.amjmedsci.org/article/S0002-9629%2815%2900027-0/fulltext
www.collective-evolution.com/2017/05/16/study-shows-how-fasting-for-3-days-can-regenerate-your-entire-immune-system/
pubmed.ncbi.nlm.nih.gov/7714088/
www.nejm.org/doi/full/10.1056/NEJMoa012908
pubmed.ncbi.nlm.nih.gov/23707514/
pubmed.ncbi.nlm.nih.gov/23408502/
faseb.onlinelibrary.wiley.com/doi/abs/10.1096/fasebj.2019.33.1_supplement.819.10
www.biorxiv.org/node/93305.full
www.health.harvard.edu/heart-health/abundance-of-fructose-not-good-for-the-liver-heart
pubmed.ncbi.nlm.nih.gov/20102774/
n.neurology.org/content/88/16_Supplement/P3.090
pubmed.ncbi.nlm.nih.gov/6859089/
www.ncbi.nlm.nih.gov/pubmed/10232622
www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/
www.ncbi.nlm.nih.gov/pmc/articles/PMC1413655/
www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/www.ncbi.nlm.nih.gov/pmc/articles/PMC8470960/
europepmc.org/article/MED/22402737?javascript_support=no
pubmed.ncbi.nlm.nih.gov/2518860/
www.ncbi.nlm.nih.gov/pubmed/24905167
www.ncbi.nlm.nih.gov/pmc/articles/PMC6526871/
pubmed.ncbi.nlm.nih.gov/31890243/
www.ncbi.nlm.nih.gov/pubmed/25686106
pubmed.ncbi.nlm.nih.gov/21410865/
This list compiled over years of research by the user known as Pottenger's Human on youtube. Feel free to copy and paste this anywhere you like, no accreditation needed!
My community tab will always contain an updated version of this list of fasting benefits. I also have playlists on fasting and health topics.
Money, money, money
And not for the first time. Look at all the pharmacorporations that have already been sued. Pharma and chemics aren't the most trustworthy companies..
Absolutely.
Crimes against humanity! Jail time!
Deeply sorry they were exposed !
corporations can hurt anyone they want, and nobody behind the company will be held accountable. this is what happens when you treat corporations as people. no body to imprison, and no soul to save.
Don't be anti-Semitic.
You've got to prove it in a court of law first. And remember the manufacturers have legal indemnity.
CEO of Pfizer is ✡️....CDC director is ✡️...COVID Czar was ✡️... coincidence 🤔???
Who is jailed for the crime against humanity???
Probably not enough jail space
Dr.Burke was executed by firing squad at gitmo and replaced by a clone..The Dems.needed Dr.fauci more that's why he's wearing 10,000 suits and has more security than the president..His time will come..
@@Msagstar UK government needs to pay compensation to victims..
The anti vaccine nuts who committed crimes against humanity by spreading misinformation that kills people.
No one... Just some under the table payoffs as they're "punished" with probably a few tax increases... Which they can just find a loophole around...
Not promoting unlicensed medicine. MANDATING unlicensed medicine.
That is absolutely right!!!
And here in Chanada we have the persecuted Convoy Truckers to prove it.
Yes!
Yup. I was mandated.
I agree with you but they didn’t actually mandate- our government did. And they need to be held as complicit in this.
Deeply guilty of mass murder
hear hear
But who ordered it? Adolf Schwaab?
My dad took the Pfizer boosters, subsequently got a heart attack, clotting in his feet, cellulitis and had multiple organ failure. A healthy man who walked more than athletes everyday, read libraries of books, did incredible real charity at the cost of his own wealth/meals at times, a guy who had salads daily, no stresses, did yoga and everyone thought would live to 100+.
He passed away last year, we were told by doctors he had a heart attack as the causative factor. We all believe IT IS THE PFIZER-BIONTECH vaccine to blame squarely.
@@Plisken65 One of that lot
They feel no guilt, fhey are evil
Don't forget all the politicians and bureaucrats who participated in this. They are equally guilty.
And the media!
They were all in it for benefits in one way or another. Shocking where is for the goodness of our fellow man.
And why now, after they all entered in a Faustian bargain, they will do everything to cover all their arses. Not one of them has a shred of moral responsibility left.
Nobody will be held accountable. Nobody in the Epstein/maxwell case. She’s probably in a mansion off a lavish coast. Diddy won’t be held accountable. Pfizer will not be held accountable and neither will Fauci. We’re merely tax paying slaves. Voting isn’t real.
They all probably had stock in big pharma
If they were truly sorry they wouldn’t exist anymore.
The politicians who forced us to jab and quarantine or face jail time must also be punished.
Gallows
Don't forget to include the businesses and bosses who coerced employees into getting it or they were fired. They need to be put on trial as well.
Give them all the vaccine and every booster. They’re safe, right? Why not?
Nobody was forced in the Uk. However if you’re elsewhere you have my deepest sympathy.
And employers
Deeply evil. They are literally only sorry they got caught/exposed.
👏
Them outlaws are not sorry at all
United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats??
Military created the poison. Depopulation !
They are NOT sorry.
Sorry, as in wiping their tears with dollar bills ?
Not sorry enough. They can be sorry, but unless they are held accountable they will do it again and 'feel sorry' while being richer.
"And they would not repent of their pharmakea"
Fake wars, fake vaccines, fake sugar, fake people - it´s everywhere....
Of course not. They knew this would happen, but you know, you can't just say "Haha in your ass" to the public
So grateful my intuition was spot on once again! I refused the jab, I refused the mask, and I refused to be bullied by anyone! I am very proud of myself that I stood my ground. This has proved to me how strong I really am! I will never Ever comply, NEVER!
good one you i refused the jab too.. yet seen my friends have blood clots and die after having the jab..
My husband and I refused the masks and the jab too pure bloods baby!!!no sheeple in our house
"Safe and Effective" !!!!! What a load of bollocks!!!
Criminal is what it is. Start the prosecutions NOW!!
who is going to run the courts and be the judges
@@Palmstreet-u7xexactly! Can't trust the judicial system....in any country 😡
Definitely effective but not safe
The WHO still parrots that claim. Still on their website.
YEAH-- A TOTAL LOAD of stinkin' Bee Ess!!!
Deeply dishonest and deceitful in the name of profits and moral bankruptcy.
In the name of the devil.
Jail would be far too good for the likes of Gates and Bourla.
bourla is a reptile
And all those poor 'Gates sterilised' ladies in Africa. How disgusting.
This is why I will never ever get any form of vaccine.
The rest of us thank you for exiting early.
so that means you have never got the polio vacine either.
All or nothing is almost never a good position to take. The jab did not live up to the word vaccine. In limiting severity of disease, to include fewer deaths, it was helpful. Side effects worth considering? Yes, of course. It did not slow or stop disease transmission in humans or at laboratories in Wu Han. That goes contrary to all previous vaccines.
Never again!
After 2020 I am suspicious of drugs too not just vacs
Deeply guilty.
Paid well by the corrupt federal governments.
Highly Profitable $ MANDATED SALES & Government funded...
Are you interested in which USA NIH & CDC leaders owned Rich amounts of extremely profitable stocks $ ?
Stuff your apology, I want justice.
Yes!
Same. With deaths in the family and Pfizer directly to blame, it is deeply personal and sorry isn't good enough.
I would just like my 2 best lifelong friends of which I now only have one left to admit they were wrong.
Thats right crimes against humanity
Sociopaths are never sorry
Only for getting caught. That's it.
And greedy sociopaths are the worst...
Nor are NARCASSISTS , or psychopaths .
Everyone that works there must be a sociopath, everyone except the janitor and door man.
Donald Trump.
I used to bike 13 klm one way at 30 to 40 klm a hour in the summer at least. Winter not so much. Three months after I got the jab I started having problems breathing. After six months I was biking at 10 to 15 klm a hour. Now after one year I am on oxygen. Governments need to be held accountable.
@MarkenstineGreen
Now what did you call those people saying to not take it? You got what you deserved.
@@OIllllOdamn… you took the words right out of my mouth 💯
If they're so deeply sorry, the mRNA crap should be pulled from the shelves. Stop pushing it on people. 😡
AND CHILDREN 🤬
Still mandated in USA for medical staffs!
@@jared1512insanity at its finest
@@Freedom-8910 it's in all the chdhood vaccines..all mrna
What? And waste even more of the taxpayer's money? On top of all the backhanded to Boris's mates for out of date PPE.
We weren't just advised to take it. We were threatened and shamed into taking it.
People lost jobs, bank accounts and more.
Others were not vaccinated but were still poisoned.
It seems like the flu but it is not.
Those of us who wanted or needed to trade were FORCED to take it.
I lost everything, career of 23 years in health and social care, sacked after working through it all and not given a s**t about, everyone had a choice, you either had a backbone and said ‘no’ v simple or succumbed to the absolutely ridiculous amount of pressures and propaganda and brainwashing from every angle, I was even called a murderer after looking after the most vulnerable in society for over 2 decades, trust in any government or medical industry and many others infact are dead, done, over, as if they weren’t to be trusted in the first place……….yr health and wellbeing and morals and integrity are priceless, obviously many live in the controlled society built around them, that’s on them……
I was told that I wouldn't be able to get my suprapubic catheter changed if I didn't have the vaccines. They had already erased my care plan once and left me with no care at all.. I have to have a potent bladder washout every week and my catheter changed every 6wks, sometimes sooner if I have an infection, all at home by district nurse. For the first 3 months I was left with nothing. I cannot do it myself due to the after effects of a small stroke in Dec 2019. That and Neuropathy (due to over 20 years of Ciprofloxacin use for kidney infections as I have complex kidney and bladder issues). The combination makes it hard to use my hands and I physically cannot do it myself. Since the vaccines I have had 2 more small or mini strokes and the Neuropathy has caused a torn rotator cuff tendon in my shoulder, affecting my hand. I already had high BP and intermittent arrhythmias, since the vaccines these have got considerably worse with exhaustion, repeated arrhythmias going on for much longer episodes, breathlessness when talking, my sats go down to 70/75 when talking so big difference. This then leads to dizziness and falls etc due to lack of blood oxygen... I wish I had never had these damn vaccines, but I would have lost all my NHS care yet again if I had. Luckily we refused them for our daughter as by then the side effects were becoming known.
Deeply sorry? For what has happened as a result of their abuse of drugs, they should be banned from ever distributing drugs again!
They also need to stop brainwashing doctors who end up prescribing these drugs and regurgitating whatever they're told. "Oh, well, yes, there are risks with these medications, but they're on the market so they must have benefits." Sure, thought-sayers!
Can we assume the same applies to the US and the rest of the world???
Not just distributing, but developing!
The problem is, some medication can only be gotten from this company. If we ban them, lots of people will suffer or even die.
Should be deeply in jail.
It's Not Safe and Not Effective!
I’m still waiting for my “deeply sorry” by my former employer for firing me for not getting the jab and labelling as misconduct 😡 I hope everyone involved is deeply punished and held accountable. Very deeply.
Sue your employer
Agree. One day you sue. Only then will they be deeply sorry.
@@howard1beale Network, right? The movie?
Me too , but I do keep an ear on them through good people who remained and they are suffering today , shipbuilders don't fall from trees .
Loosing 35 Tradesmen from a workforce of 60 tradesmen on 2nd Feb 2021 hurt deeply and today they are unable to fill those roll's ,, Ha blardy Ha ,, Karma is a birtch aye ? .
The remaining workforce are conastanly sick , day's/week's off at a time , yes they are struggling and deserve it all !
I waiting for deeply sorry everything was not gonna be OK. My work closed on st paddy 2020 and I haven't worked since...
Where is Johnson where is Hancock and Blair ? They constantly pushed this junk
The drug companies will be the fall guys. My research has shown me that it was made to order..
@@joetodd4351 it was made pre covid
But so did John , even urging pregnant women to take it
It matches their brains 🧠
Money can make people do anything. When they have no conscious
Dont forget the doctors who were fired for not complying with their criminal acts.
Don't forget the doctors who promoted it and pushed it onto people
Both. The underlying nexus between the WHO (not the band), Gates, Fauci, Pfizerman and his squeeze, the Biden Crime Syndicate and the Pfizer funded media,needs total reconsideration in the light of recent events. It boils down to:
Drugs for what?
For health? Or for profit?
I hope the doctors sue them
I was forced to leave my job of 22 years 😡
@lsmith495 if you left your job, but still have a clean bloodstream, then you can rest easy. You will be a survivor, while the righteously indignant will all be gone soon, if not already.
Whenever I write down 3 things I am grateful for, before bed each night, my NOT taking "it" is often on the list. I never came close to taking it. It's one of the things I'm most proud of in my lifetime and proud of myself for. I'm very impressed with myself. Friends and family succumbed. My confidence has gone up so much because of that. I realized I can trust myself and hold the line against immense pressure and I am very strong.
Loved seeing you ride the Honda motorbike!! 😊
Me too, I’m with you on that! ❤️😊
same, the pressure was huge. lost some family membrrs along the way but hey, fuck em.
they say there sorry while the WHO WEF and the UN is pushing for a global health treaty
And make it all compulsory.
According to Dr Campbell, the west has signed over it's sovereignty to the WHO since March 2024.
@@elizabethfermor344getting injected while being restrained
PHE > UKHSA
May 25th it is the date. God have mercy on us 🙏
1. Live a healthy life
2. Stop buying their junk
3. Put them out of business
join class action for opiate crisis
Whenever possible, I will ask for generic or alternative.
@@miguel-jesus what junk of theirs do you need?
@@botfantasies6229 For my prescribed meds, I am know choosing another store.
Cue the turbo cancer medication
In Australia the phrase was (Use it or be fired, can't travel, can't see family.) Time for a lawsuit.
Never fell for it 10% er Aussie.
❤ love Canada Merci Québec M.T.L Merci 😊
I think UA-cam should be sued also for abetting the fraud!
Facebook also
YT also provided good information. TalkRadio was presenting a balanced view throughout, so after a short while it became obvious that jabs simply were not beneficial or necessary for most of us.
Indian people have power in UA-cam band all information I see CEO being asked she get away at list now!
@@RedRupert64No, UA-cam have actively taken down or banned literally anyone who said a negative word about the vaccines even when it was evidence based and left videos online containing absolute garbage mainstream propaganda
People don’t realise how ‘leaky’ UA-cam is. Without it large a proportion of awake people would still be asleep. I think there’s enough evidence to suggest there’s a white hat at play, suing yt would be a grave mistake imo.
All involved should be sent to prison for 6 billion years
That means they will get out , Sorry no Amnesty this time!
@@karlg2950 they will...just not in this realm of their existence..
Probably somewhere around 1/3 of humanity
The senior executives are probably people with business degrees. With little understanding or no backgrounds in epidemiology, vaccines, human biology, statistics, clinical and non-clinical trials, etc.
You let people like that run a high-tech, scientific or engineering company, you would get bad outcomes. Just ask Boeing.
Including the government and scientists who were on tv every evening.
Sorry my arse!! The NHS are still offering it to pregnant women!! 🤬🤬
It's madness, isn't it!
Pregnant women advised not to drink, not to smoke, not to eat raw eggs or soft cheeses, caution with certain medications, but hey, queue up for your covid jab.
It's maddening!!!!
Same in the states.
And to patients about to undergo major surgery. lung removed, diaphragm taken out, spleen removed and the lining of the heart replaced. Why would you worry about getting the v I r u s and yes had the jabs to save sick parents.
@@VL-qy4fcyep, but ok to vape
How sorry 😔 are they for making 180 Billion profit for their share holders?
Fauci and ppl like Anderson Cooper were paid millions to push the vaccine
Exactly.
These people are guilty of my Mom's death and many others.
Sorry! Many have to suffer living with brain fog for the rest of their lives. A married man with three children is having his businesses collapse because of it. Almost a fate worse than death.
I’m so sorry 🌷❤️🕊️
I'm sorry for your loss 😢.. I worry about my mom constantly.
Sorry for your loss Kathy; don't get sad, get angry; get very very very angry and direct that energy in a positive constructive way. Lobby for jail time for those responsible for starters.
Yep, and my father’s and 40 other people that I know who either died like he did after taking them or were hospitalized and severely harmed. Evil incarnate.
Deeply sorry WTF seriously this is crimes against humanity!🤦🏾♀️
it's the great reset.
@@tripzincluded8087supposedly it happens every 138 years according to this man whose channel is called Archaix I have not gone through all his videos but he has a mountain of data to back up his claims...but from what i have seen it is worth checking out.
Millions dead, millions more possibly injured, no single person yet held accountable.
17 million an climbing 😢
My dad and some elements of our family died to this. Dad took Pfizer, then started manifesting symptoms, got a heart attack then clotting and multiple organ failure. He was a very healthy man!
not yet anyway. I will weep with joy on that day of accountability or public apology.
@@1cyanideghost
Sorry to hear about your Dad. 🙏🏼 Most of us won’t forgive or forget the crime against humanity.
@@1cyanideghostsorry to hear it. My husband was diagnosed with cancer after the Pfizer booster. He is still around though.
Dr Campbell - I have followed you since the early days of COVID19. What struck me of you, is your objectivity and scientific method in your reviews. Love your sense of humour. Thank you for your views in dark times.
I’m deeply sorry I listened to the So called experts and got the jab so I could keep my job. I’m deeply sorry that I had to tell my daughter that I have stage 4 lymphoma. I’m deeply sorry for the hell my family went through because of my cancer when i spent 43 days in hospital 12 of them in ICU on a ventalator. But all is ok because Pfizer is sorry
So sorry, Kevin. I tried to warn everyone, for 6-9 months on this podcast. Finally, Dr Campbell decided to do the research and was shocked with his findings!! Many were duped by governments and big pharma!!!!!!
So sorry Kevin! I tried to warn all on this podcast, until Dr Campbell did the research...
So sorry Kevin! My reply keeps getting deleted??
I am so sorry to hear your story.
So many people are in your situation and it's so unfair.
I will pray for you and your family.
The deeply dripping sarcasm from Dr. Campbell should be saluted!!❤
Albert Bourla, Fauci, Peter Daszak are surely all sorry. In actuality, they should all be tried and prosecuted.
United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats??
Military created the poison. Depopulation !
Yes. I agree with you.
They are not sorry at all, the only thing they are sorry for being caught poisoning people.
Deeply sorry. All the way to the bank.
Yes , when it`s just a fine for killing people and they made billions + . they just look the other way , cost of doing business. Criminals for sure but if we the people don`t make some new rules it WILL continue . Very sad .
When does YT stop to act as an agent provocateur keeping promoting this not legal medical product. I am referring to the text from the WHO in the information panel just beneath the video.
@@carlmagnussen7773 When YT stops being funded by the pharmaceutical industry through advertising and lobbying.
So sorry for committing crimes against humanity. Safe and effective….lying words.
Who used Parliament recently (where he cannot be prosecuted) to say 'safe and effective' in regard to Covid vaccine? Would say it outside his safety walls?
Yes, but how much that "sorry" is now good 4 the dead ones ?
“Deeply Sorry” for me having to quit my nursing job because of horrific adverse side effects from 2 jabs that were mandated. I had to have a major surgery from the damage. “Sorry” doesn’t cut it for all of us that were damaged and all the families dealing with losses and illness from something that was supposed to protect us!!!! I have zero faith in pharmaceutical companies! Absolute crimes against humanity!!! This plandemic and all the criminals need to be exposed!
So sorry for all you suffered due to this mandate, and I wish you well from this point forward. May we all be healed from this madness.
Nurse and doctors guilty plus anyone had power boss in factory leader in hospital bla bla
I left my nursing profession of 20 years rather than take something my clinical judgement could not possibly endorse or allow. Thank god I had a plan B. I view my complying colleagues as a collective of cowards though. Their clinical judgement would have been no different from mine, and had we as a collective stood our ground the madness would have been stopped in its tracks. That day. So yes I feel for you ... but there must be some acceptance of complicity ... like it or not ... 🌹🌹
What kind of surgery did you have, if you don't mind me asking?
I hope that you can recover.
they should be put in jail!
I'm 65 and nothing in my life comes close to the criminality (throughout all facets of the establishment) that was involved with the cupid Pokie. My Harrowed heart cannot comprehend forgiveness for those who separated the dying from their families causing them to die alone as their loved ones tears stained the glass that separated them.
😭❤✝️🙏
Sad and necessary post. Well said. There will never be forgiveness here.
Cupid Pokie 😉
Most of that was completely OUR EXTREMELY CRUEL GOVERNMENTS and HEALTH AUTHORITIES FAULT!
To forgive might be divine but right now it would feel inhuman. Perhaps we need consequence and contrition first.
Prior to 1997 it was illegal to advertise prescription drugs in the US. It still should be!
Same in NZ
In Canada, advertising of pharmaceutical drugs is limited to make, price and quantity. Advertising of indications for use is prohibited.
I bet they are wiping their tears with dollar bills ..
Allllll about money. These people have no souls.
Souls aren't real.
@@maishagrinn4681 Thanks for contributing absolutely nothing to the comments. 👍🏻
@@antagenvictim And women contribute nothing to the world at all but bs.
@@antagenvictimit's your fault for that guy's comment, next time do not mention the unreal
@@haurg7418It’s a figure of speech, dork.
Deeply sorry, after making billions of dollars of profit.
Im sure I read somewhere that the owners of the 'shop' were all Isnotreali?
Bingo!
@@rozalynanderson8387 yeah ..its a common theme,,,you wonder who would be that callous? he chosen ones... we don't matter other than a resource to be managed controlled and exploited.... rewind repeat.
They will be sorry when they stand before their maker. Wouldn’t want to be in their shoes.
Exactly
Chief Medical officers in England need to be bought justice !
In the states too.
Whitty and Valance need to be fined and jailed for their complicity in the harms against humanity.
The Health Secretary, Mat Hancock.
Especially that weedy Chris Whitty. A man was jailed for merely jostling him in the street yet Whitty received a knighthood. Where is the odious creep hiding these days?
Australia too!
Say you’re sorry to all the folks who lost their jobs for not taking your product.
Yep and, sorry for the millions of people now killed by their criminal psychopathy!
@@Jana-om4bbnow I'm convinced your a troll
Or the nurses that were mandated, got vacc1ne injured and lost their job ANYWAY BECAUSE THEY TOOK TOO LONG WHILE OUT IN FMLA FROM the 💉 💉 💉
Jobs… don’t forget lives and health and peace of mind for all those who now understand it was a mistake to comply and they don’t know when they will be affected.
That's the governments fault. Let jabbers get jabs and leave other people alone. There should have been no threats toward people's livelihoods.
Thank you for the continuous insights into medical care.
No more money fines, they don't work. Lifetime Jail sentences for the people in charge, not lower level management.
Well said. Somehow, the 'ones with the power' get off scott-free. They make sure that those lower down are left to carry the responsibility for their greed and corruption. It's sickening. "Sorry" isn't good enough!
Yup they pay the fines and are still in massive profit. Jail time would work better
The fines are shareholder money.
So my bonus is not what it was last year.
In 18 months he is being interviewed on the business channel of how he steered the ship through rocky times.
What a hero!
Boycott the stocks of Pfizer and Co.
Stop investing in companies that try to eliminate the working class.
When will Google apologize for the 'Covid 19' information under these kind of videos.
Guilty als hell.
Good one. I've gotten so used to these i'm not even noticing anymore..
I had to double check but mine says information from the Australian gubberment. They were still pushing the jab on me a few months ago.
Accomplices must also be held accountable
So WHY are they still pushing it?!
@@Dubya-i3v Bot or paid troll? 🤪
@@Dubya-i3v WRONG
Who is
Thank you for speaking out.
All basic Tenets of the Nuremberg Code was disregarded! Especially informed consent.
Calling the vax an investigational agent instead of an experiment was to get consent without informing.
Biochemical warfare
That's not true. They didn't hide it and give it to you
I will never forget or trust our government for they did to us ever again.
Our government is handing over it's power to the WHO. you ain't seen nothing yet.
Same
They were terrible but Labour would have been even worse.
Same here. I've always been a big supporter of my country's government. Military brat here. But now, I will NEVER trust them again.
They are terribly sorry for ruining millions of lives, and probably won't do it again.... probably.
Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.
Theyve done it before, with a medicine for haemophiliacs, a batch was tainted with HIV, they knew it, it was banned from sale by in America by an American judge. So they sold it to countries outside of America, with the exact consequences that youd expect. They knew, they just preferred causing death, misery and suffering over taking a loss. Im sure youll find many more cases if the internet hasnt been scrubbed, I havent looked in a long while, google search is worse now.
I guessed Perth straight away; black boys and sandy hills and sun. I can't believe John was just a few k's from home. Thankyou John. You were a single candle of reason in a sea of darkness for the last 3 bloody years. I lived through the world's longest lockdown in Melbourne. I watched you daily. The moment the border opened I got straight to Perth. Never looked back.
signed, a devotee of reason, and a wagirl, Perth Australia.
Dr.Campbell you are so good,I am glad I came across you on U tube.Factual, extremely intelligent keep up the honest and awesome job.
I'm deeply sorry too
🌹condolences🌹to all the losses from 2019 2020 2021 2022 - 2023 and 2024
6 million people died due to a lethal and contagious virus. The vaccine saved more millions of lives. You were saying?
Well DONE Dr. John, you are a true gift to all of us.
As much as I'm relieved that I never had the 'Jab', I still worry about the people who fell for the lie. (especially family members)
Eeeeeeexxxxxxxaaaaaaaccccccctttttttlllllllyyyyyyy !!! ! !!!
I don't I have no sympathy whatsoever
Yes everybody who took the Pokie is somebody's family member
Me too, family and friends
Same here, 68 yrs young and have never had any kind of jab in my adult life, when this vaxx hit here I warned all family and friends, most listened but my 61 yr young brother let the fear get to him, he did the dirty deed and is dead now,his heart was " shredded"!
This was teason! We all know it! They should be put in jail!!!
Teason?
Another reason lobbying should be illegal.
legalised bribery & corruption
It is corruption.
And people in power with double interests. Ursula Vander Leyen's husband is in gentech. And she ordered 1,8 billion vaccines from Pfizer without a debate in the EU parliament or its approval.
tbh no medical company should be listed on the stock exchange. Profits shouldnt be associated with health. Not saying the business can't make a profit but shouldn't involve the pressure of pleasing shareholders.
@@Truthseeker-iz3dj Total reform is obviously needed. Unfortunately some very cowardly and immoral people would rather die of ignorance and lose their freedom, than admit that they made a mistake. that is how deeply embedded the sat£nic cu$lt has driven narcissism in the world. It is extremely biblical!
After they committed crimes against humanity, they're deeply sorry . They covered up all the all the trials.
Russel Brand recent expose very unsettling..
You are quite deluded.
@@papat7435please please get your booster
Even the animal trial of 30 ferrets in 2014 . they all died within 3 years . thats when they knew the vaccine was a success .
They are stil on poisoning duty.
They are sorry for not given the bribe to this agency.
Pfrizer lied, And yet we still have the Covid-19 vaccine information from the NHS tag on this video!
…and the cdc, which by the way is a private company
God bless you Dr Campbell.
Of course they’re sorry while laughing all the way to the bank with their billions.
i just got my first song put together check it out guys. thank you! it's anti-v country music
They need to be closed down and the top people need to be jailed
If we get the politicians on our side it might happen, if we want the politicians to go down with them, nobody will be going to prison.
Yup let’s just shut down drug companies who, you know, make life saving drugs.
Unless an example is made this will happen again ! People died due to government propaganda and poor medical advice. Covid was a scam on an epic scale that killed l a lot of loved ones ! man made hell !
If politicians weren't involved, this would happen but they are joined by the hip.
But the top people are part of the global elite, so that's not likely.
If they are deeply sorry.. then they are admitting that their vaccines were unsafe.
There should now be a class action lawsuit launched against them.
Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.
no they are only sorry they promoted the jab before it was allowed to be promoted
It was about misleading on social media, that's probably as good as we're going to get.
Janine Small admitted it publicly in front of the EU Parliament.
😷 There will be NO accountability and NO punishment. Remember that governments worldwide granted covid vaccine suppliers Pfizer and BioNTech indemnity from any claims that may arise from use of the vaccine.
Deeply sorry for beeing caught...
cheap talk. Their actions speak louder than words.
Millions of Dead
Billions of Wounded
Trillions of Profit
Well said & spot on holiday.
Met all the goals.
@@thominaduncanson7596billions is the goal
Where is Gates, Tech execs, Mockingbird media, and WHO loud mouths!
And that’s just the result of Johns misinformation and anti vax grifting, Lol
ALL TRUST IN WEF POLITICIANS & BIG PHARMA IS FOREVER GONE..!!!
first its opiate crisis now this my daughter is a victim still alive thanks be to God!
As it should be
Well, I never really had trust n them at all
Plus NO trust in msm or medical people 🤢
I never had trust in them to begin with
Hello Dr John and thanks 🙏 for all that you do 💙🤙….fantastic country Australia 🇦🇺🤙😎
A hell of a lot of good saying sorry does!!!! The damage has been done
Why would ANYONE trust the Pharmaceutical Industry. Seriously- wake up.
@@Dubya-i3vbye bye bot!!!
@TORY-BLUE prove it, or it never happened........
@@Dubya-i3vGo get more boosters. You can have my share.
@@Dubya-i3v What number you on? 8? 9? Yeah they work so well, it’s not a vaccination either, yr a liar 🤥
It is mind -boggling.
"Two weeks to flatten the population."
Talk of flat earthers...
Ppl are still taking these damn shots🤬
Isn't that the truth! They flattened it pretty easily with so many voluntarily lining up. I still can't believe how many did without any thought.
@@cynthiarice7438 😳🙄😬 wow what the f*** is wrong with people???
@@MsMickey541 I know eh??it’s like they can’t use their own brain to think ummmm something isn’t right here ?! 😬🙄
One of the very few Brits who makes me feel proud to be English. Delicious low key style, a true doctor who can lift your spirits just listening to him! Deeply humorous with a straight face. The world needs more people like you Dr. Campbell. From Jenny James, 5 decades since I headed for the Andean mountains, leaving England in disgust. So glad you exist, a voice of sanity midst the cacophony of lies.
He's not a medical doctor
He was instrumental in the mass poisoning.
@@LBStewNot being a practicing "medical" doctor is an advantage. But his degrees are entirely normal and mainstream. Are you a PhD?
He has an honorary phd for services to nursing@@carnation_cat. Really not a doctor
Speaking as a German, I've actually never met a British person I didn't get along with. They always seemed very well mannered with great humor.
Than you Mr Campbell
I am deeply sorry I took the Jab. Pfizer should not only be sorry, but they should be in jail.
I feel bad for you too. You might escape the consequences though. There are those who do, for sure.
Me too!
SAME
Yes. Like who's the boss? The CEO CFO Chief in Charge all shd be more than hand slapped. But we know money talks & they will walk.
I am trying to tell you that there is a internet page with protocols. Done by frontF lineL covidC criticalC careC doctors. Keeps getting scrubbed off. Wonder why Dr John Campbell is not talking about it?
They should be brought to justice. My ex wife's life is on their hands. She passed in August of stage 4 cancer, no family history and non hereditary. Figure that one out
You don't need family history to get cancer. You didn't even say what kind
We are deeply sorry for the mass murder and the 80 billion profit, now can we just draw a line under it and move on!
It didn't effect everyone the same....I'm still wondering what's different
He's only 60+
Not too old
THIS
@@kathleenking47 Really, saying some intervention isn't universally lethal doesn't make it worth taking.
actually 600 billion.
We have yet to see how it affects future generations.
We need more doctors like you who do their own research 🔬 ❤