Pfizer is 'deeply sorry'

Поділитися
Вставка
  • Опубліковано 22 лис 2024

КОМЕНТАРІ • 14 тис.

  • @jharvey9898
    @jharvey9898 7 місяців тому +9818

    Deeply sorry, yeah after they were exposed. They should all be in jail.

    • @AddisTime
      @AddisTime 7 місяців тому +155

      that's anti-semitic

    • @mimikhan9546
      @mimikhan9546 7 місяців тому

      @@AddisTime
      Lol.

    • @colty7764
      @colty7764 7 місяців тому

      they supported pseudo-science while suppressing (with a lot of help) real evidence based science

    • @kehreyannedean6315
      @kehreyannedean6315 7 місяців тому +67

      🎯🎯🎯

    • @moeiscool
      @moeiscool 7 місяців тому +189

      worse. history hasn't been happy with them multiple times. they were expelled over 100 times from almost every nation for behaviour like this.

  • @antheablackmore5838
    @antheablackmore5838 7 місяців тому +9244

    Deeply sorry, deeply sinister and they should be deeply in jail

  • @sylviaduffin4812
    @sylviaduffin4812 7 місяців тому +5720

    Why is this drug still being pushed on vulnerable patients then???? Government and NHS guilty of criminal acts

    • @debpratt52
      @debpratt52 7 місяців тому +76

      Very sad.

    • @kitoharveywill5766
      @kitoharveywill5766 7 місяців тому +314

      To withdraw it now after pushing it so heavily would be admitting culpability, and the claims will flood in, as pfizer is protected from liabilty, so the gov will have to renumerate people for lives destroyed. Money trumps human life.

    • @phillipsmiley5930
      @phillipsmiley5930 7 місяців тому +69

      see Hugo talks: Spanish Flu Bolshevik Revolution HISTORY REPEATING?

    • @7owlfthr
      @7owlfthr 7 місяців тому

      They push it period. Signs in "doctors'" offices, pharmacies. "Get your free covid shot here". They really think we're that stupid. INSULTING!

    • @whojanson6751
      @whojanson6751 7 місяців тому +157

      Slowly... the people starting to realize what the pharmaceutical industry and the governments ACTUALLY is about. In reality.

  • @terrifiorelli9819
    @terrifiorelli9819 6 місяців тому +267

    NEVER FORGET WHAT THESE MONSTERS DID TO MANKIND AND OUR LIVELIHOODS!

    • @gerardguida7727
      @gerardguida7727 3 місяці тому +1

      I'm not going to Forget THAT OUR GOVERNMENTS.....ALLOWED THEM TO PULL THE WOOL OVER OUR EYES...... THEY'REJUST AS MUCHTOBLAME!.

    • @ardenpeters4386
      @ardenpeters4386 2 місяці тому +2

      then there's that part too

    • @charlesreed4327
      @charlesreed4327 Місяць тому

      I was saying the entire time. Vaccine testing takes 10+ years for a real approval. So it coming out 7 months after we discovered the virus already told me it wasn't tested properly... but they didn't even do short term testing on it lol. The smart people didn't even take the vaccine. I will take the 0.02% death rate of covid over an untested vaccine any day. As I have no immune difficiencies I'm not going to die from covid... hopefully these liberals screaming about being woke actually wake up one day. Because we are literally devolving at this point

  • @veronicat6031
    @veronicat6031 7 місяців тому +1757

    The only thing they're "deeply sorry for is they got caught. 😡

  • @workaholic5318
    @workaholic5318 7 місяців тому +4276

    Pfizer is "deeply sorry". Not yet... Let's not forget that virtually every western government was complicit in this.

    • @marleneholloway7775
      @marleneholloway7775 7 місяців тому +139

      Australia certainly was a lot of crooks here.

    • @StirlingLighthouse
      @StirlingLighthouse 7 місяців тому +123

      Canada 🇨🇦 too.
      All should be held responsible.

    • @sneezyfido
      @sneezyfido 7 місяців тому +94

      WHO

    • @sargentpepper8931
      @sargentpepper8931 7 місяців тому +65

      Because they were paid

    • @laurafulton7023
      @laurafulton7023 7 місяців тому +25

      @StirlingLighthouse You mean Post National Canada comrade

  • @TheGoul29
    @TheGoul29 7 місяців тому +658

    Sorry for making billions of $ while ruining millions of lifes.
    This is just routine for them...

    • @virginiacreager4331
      @virginiacreager4331 7 місяців тому +8

      I thought making money is always supposed to be more important than saving lives right …?

    • @sherylpayne5851
      @sherylpayne5851 7 місяців тому +15

      So sorry you can't get an organ transplant unless you're "current ".
      So sorry it's part of the childhood immunization series.
      So sorry they're developing a self-replicating version for future " pandemics."
      So sorry they are now profiting off of the people who are now seriously ill.
      When are all madantes revoked?

    • @BlackMan614
      @BlackMan614 7 місяців тому

      That's the problem. The dopes didn't make billions. The blew it. All of it. Their stock is in the tank (been there for over a year) and have NO promising drugs in the pipeline. Disgraceful. In a normal capitalist market they would be bankrupt.

    • @helentc
      @helentc 7 місяців тому +4

      Unfortunately I think this is true

    • @cathyeast5517
      @cathyeast5517 6 місяців тому +1

      I totally agree!
      They were totally CRIMINAL along with the Gvts, all media outlets, Celebrities etc who all promoted this poison for a kickback!
      Talk about a new age HOLOCAUST!

  • @user-gu4lg4ch1x
    @user-gu4lg4ch1x 6 місяців тому +729

    Companies run by psychopaths don't actually feel remotely remorseful!

    • @cherylparry8032
      @cherylparry8032 6 місяців тому +14

      No, all they care about is the money they're making.

    • @aarongibbs2260
      @aarongibbs2260 6 місяців тому +8

      Until they have loved ones of their own.. even then I don’t think these corporate overlords are capable of sympathy.

    • @joe9042
      @joe9042 6 місяців тому +6

      Neither, do they face justice!

    • @fairchild1737
      @fairchild1737 6 місяців тому

      United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats??
      Military created the poison. Depopulation !

    • @rajnazemi
      @rajnazemi 6 місяців тому +3

      @@joe9042they do. Karmic laws will destroy them. Maybe not in this life but it’s prepared and everybody’s gonna get the taste of their own shit + more.

  • @positivityleads2success
    @positivityleads2success 7 місяців тому +8022

    Don’t forget Bill Gate who funded, promoted and made Billions of dollars off of it!

    • @darrelltregear756
      @darrelltregear756 7 місяців тому +381

      And all your favourite celebrities

    • @tobywinter1
      @tobywinter1 7 місяців тому +242

      Yes NEVER forget.

    • @tolukayode9487
      @tolukayode9487 7 місяців тому

      Big money and deep state rule the Western world 😢😢😢

    • @AnAn-xp8xu
      @AnAn-xp8xu 7 місяців тому

      Juist
      Dat is een grote schoft en geldwolf

    • @7owlfthr
      @7owlfthr 7 місяців тому

      NEVER forget willigoats. If it's anti-GOD's creation, if it's anti-human....Sauron, private bankers (you-know-who) & willigoats are somewhere close by pulling strings.

  • @haileysmom2358
    @haileysmom2358 7 місяців тому +675

    Deeply sorry means nothing to those that have had their lives destroyed and the families that lost loved ones. Pfizer should be paying reparations to all those affected.

    •  7 місяців тому +33

      Deeply sorry means nothing to the pharmaceutical group either.

    • @davidslater9297
      @davidslater9297 7 місяців тому

      Davo here from sunny beautiful Australia.
      I want more people to become aware of the three words I learnt during the covid fiasco.
      PERFIDIOUS.
      ASSININE.
      Non SEQUITUR.
      Check the definitions,and lock them in ready for the next bit of BS you hear from government,the media,big pharma or your "doctor" 😊.

    • @royferguson2297
      @royferguson2297 7 місяців тому

      Pfizer can't be sued the Governments of the World gave them immunity. People en mass who got jabbed should be suing the Government.

    • @ralphp3057
      @ralphp3057 7 місяців тому +14

      @@royferguson2297
      You are correct! But , sue the government? Good luck with that .😬

    • @LadyBug1967
      @LadyBug1967 7 місяців тому +19

      Words r cheap especially words of liars n thieves

  • @ThomasKing19933
    @ThomasKing19933 7 місяців тому +691

    They are not sorry at all. They should be behind bars for what they've done. Thank you, Dr. John.

    • @janiekrig5232
      @janiekrig5232 7 місяців тому +1

      Yes, you are correct. The ugly truth is that it's all about money for them. They will do anything, murder, cheat, lie etc for money!

    • @happytwolaffs6454
      @happytwolaffs6454 7 місяців тому

      It's Nurse John

    • @jodiknight2820
      @jodiknight2820 7 місяців тому +1

      I bet they are sorry that they've been caught.

    • @happytwolaffs6454
      @happytwolaffs6454 7 місяців тому

      @@jodiknight2820 What do you think this apology is for?

    • @Freedomfortruth90
      @Freedomfortruth90 7 місяців тому +1

      ​@@happytwolaffs6454 is a doctor though...
      Has a docrate..

  • @A.Krispy
    @A.Krispy 6 місяців тому +345

    Heard it like this; “Everybody take it” “Everybody shut up”
    and “Nobody can Sue”

    • @YAHsKid
      @YAHsKid 6 місяців тому +35

      That's exactly how it was. They also said you can't work unless you take it.

    • @rosemarykennedy5430
      @rosemarykennedy5430 6 місяців тому +27

      Or can’t travel or visit hospital patients?

    • @katesun2957
      @katesun2957 6 місяців тому +8

      Or swim or go to the restaurants in Trumps hotels. Does everybody forget that he backed them right up?

    • @AJD-od9nq
      @AJD-od9nq 6 місяців тому +28

      @@katesun2957 dont care about your politics, this is crime against humanity

    • @elisabethdemoreaudandoy478
      @elisabethdemoreaudandoy478 6 місяців тому +9

      Everybody can sue. Their exemption is not valid since they knew what they were doing.

  • @itsrudiano
    @itsrudiano 7 місяців тому +985

    "An apology without a change in behaviour is just manipulation "

  • @TheDextermat
    @TheDextermat 7 місяців тому +2344

    Blood on their hands, billions in profit made on human suffering and unsafe trials on human. Apology not accepted, get fined and jail! They are criminals! Thank you for exposing these corrupted hypocrites.

    • @soulwarrior7721
      @soulwarrior7721 7 місяців тому +96

      Almost all governments were working with them. Who is to hold them accountable when the people that would do that are also in on it.
      This wasnt just 1 company doing this..

    • @LTPottenger
      @LTPottenger 7 місяців тому +2

      Trillions. For those going through this, some extended fasting, low carb diet, taurine and methylene blue can help a great deal. Some benefits of occasional extended fasting and lowering carbs in the diet: High blood pressure is lowered to normal levels very quickly while fasting. Fibrosis/scarring is reversed over time, including in the heart and lungs.
      Vitamin D plasma levels are increased as fasting improves metabolic health, and vitamin D in turn increases autophagy. When insulin is high, vit D stays locked in the blood cells.
      Fasting stimulates phagocytosis, the ingestion plaques, growths and pathogens by the immune system. This will also remove spikes quicker, whether natural or unnatural in origin!
      Your body recycles up to 1/3 of all immune bodies in a 72h fast, rejuvenating your entire immune system. This helps with autoimmune disease, cancers and cytokine storm.
      Fasts from 36-96 h increase metabolic rate due to norepinephrine release!
      Clots and plaques are removed over time due to accelerated phsocytosis.
      Fasting improves your circadian rhythm to normal over time.
      Blood sugar and insulin are lowered when fasting, reducing inflammation and allowing the immune bodies to move freely through the body.
      T cells and T reg cells are vital in fighting cancer, autoimmune disease and infections. As we age, the thymus stops making as many of them but fasting releases stem cells, which then can become new T cells. It also releases growth hormone, which regenerates the thymus itself!
      Fasting increases anti-aging Yamanaka factors and increases average telomere length in stem cell pools.
      Fasting can help with MS, Depression, BPD, Autism and seizures.
      When you move out of MTOR your body shuts down the building blocks of the cell required for viruses to replicate.
      The hunger hormone ghrelin also lowers with extended fasting and rises from dieting.
      What breaks a fast? Anything with protein or carbohydrates in it will break a fast but most teas and herbs are OK. Supplements and meds often break ketosis directly or contain a filler that will. Many meds are dangerous to take while fasting.
      Does fasting lower testosterone? No, it raises it when the fast is broken by increasing lutenizing hormone. Fasting also increases insulin sensitivity, which helps with muscle building.
      Fasting activates autophagy (literally self eating). This will cause cells to recycle damaged proteins and foreign matter such as viruses.
      Lowering insulin via fasting virtually eliminates chronic inflammation in the body.
      Weight loss from daily caloric restriction has 1/4 to 1/3 of the weight lost as lean tissue while many studies show fat loss from 36 h fasts without losing any lean tissue!
      Fasts of 36-96 will not affect short term female fertility or affect menstrual cycle. They also may increase long term fertility for some women.
      It increases mitochondrial function and repairs mitochondrial DNA, leading to improved ATP production and oxygen efficiency. Increased mitochondrial function also has the added benefit of increasing your metabolism, fighting infection and cancer prevention!
      24h of fasting can cut your leptin levels in half! This reduces leptin resistance, which impairs immune function.
      Fasting reduces pain and anxiety by stimulating the endocannabinoid system, just like the effect of CBD oil
      Stomach acid is reduced over time while fasting and can allow for the healing of treatment resistant ulcers. Some patients may need continued acid reduction medication while fasting. When the fast is completed, your stomach acid levels will be normalized.
      Your brain also prefers to burn ketones at a rate of around 2.5 to 1 when they are available in equal quantity to glucose. Except for brief periods of very intense exercise, your body mainly burns fats in the form of free fatty acids.
      Fasting releases BDNF and NGF in the blood. This stimulates new nerve and brain cell growth, which can help a great deal with diseases like MS, peripheral neuropathy and Alzheimers.
      When not in ketosis, the brain can only burn carbohydrate, which produces a great deal of damaging ROS the brain has to deal with.
      Fasting increases telomere length, negating some of the effects of aging at a cellular level.
      When you fast, this stimulates apoptosis in senescent or genetically damaged cells, destroying them. Senescent cells are responsible for many of the effects of aging and are a root cause of the development of cancer.
      A fasting mimicking diet for 3-5 days in a row provides many of the same benefits as water fasting. FMD usually has 200-800 calories, under 18 g of protein and extremely low carbs.
      Exogenous ketones can aid with fasting, making it easier in healthy people and allowing some people with specific issues to fast in spite of them without worrying as much about hypoglycemia. They also help with dementia and many other issues even if you take them while not fasting!
      Glycine and trimethylglycine can also be useful supplements while fasting that won't break ketosis and have many benefits.
      Children, pregnant or nursing women should not fast for periods longer than 16 hours. People with pancreatic tumors or certain forms of hypoglycemia generally cannot fast at all. Type 1 diabetics can also fast but it is more complicated and should be approached with caution as it could lead to ketoacidosis. If you experience extreme symptoms of some kind, especially dizziness or tremors, then simply break the fast and seek advice.
      Resources:
      www.ncbi.nlm.nih.gov/pmc/articles/PMC6141719/
      www.ncbi.nlm.nih.gov/pmc/articles/PMC3017674/
      www.sciencedirect.com/science/article/pii/S0005272806000223
      www.clinicaltrials.gov/ct2/show/NCT04375657
      www.nejm.org/doi/full/10.1056/NEJMc2001176
      pubmed.ncbi.nlm.nih.gov/31877297/
      www.ncbi.nlm.nih.gov/gene/25712
      pubmed.ncbi.nlm.nih.gov/20921964/
      pubmed.ncbi.nlm.nih.gov/29727683/
      www.ncbi.nlm.nih.gov/pmc/articles/PMC5895342/
      pubmed.ncbi.nlm.nih.gov/33530881/
      www.arcjournals.org/pdfs/ijrsb/v3-i11/7.pdf
      pubmed.ncbi.nlm.nih.gov/27569118/
      www.cell.com/cell-metabolism/abstract/S1550-4131(15)00224-7
      clinical.diabetesjournals.org/content/36/3/217
      www.ncbi.nlm.nih.gov/pubmed/23876457
      www.sciencedirect.com/science/article/pii/S1931312809002832
      pubmed.ncbi.nlm.nih.gov/15522942/
      www.ncbi.nlm.nih.gov/pmc/articles/PMC7607739/
      www.ncbi.nlm.nih.gov/pmc/articles/PMC7093158/
      www.ncbi.nlm.nih.gov/pubmed/10859646
      www.ncbi.nlm.nih.gov/pmc/articles/PMC6407435/
      www.cell.com/molecular-cell/fulltext/S1097-2765(18)30605-1?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS1097276518306051%3Fshowall%3Dtrue
      pubmed.ncbi.nlm.nih.gov/28235195/
      www.ncbi.nlm.nih.gov/pmc/articles/PMC2815756/
      www.nia.nih.gov/news/research-intermittent-fasting-shows-health-benefits
      medicalxpress.com/news/2022-10-treatment-pulmonary-fibrosis-focus-telomeres.html
      www.cell.com/cell/fulltext/S0092-8674(19)30849-9
      onlinelibrary.wiley.com/doi/full/10.1111/j.1365-2265.2005.02288.x
      pubmed.ncbi.nlm.nih.gov/25909219/
      repository.upenn.edu/cgi/viewcontent.cgi?article=1537&context=edissertations
      www.ncbi.nlm.nih.gov/pmc/articles/PMC1779438/
      academic.oup.com/ajcn/article/81/1/69/4607679
      www.amjmedsci.org/article/S0002-9629%2815%2900027-0/fulltext
      www.collective-evolution.com/2017/05/16/study-shows-how-fasting-for-3-days-can-regenerate-your-entire-immune-system/
      pubmed.ncbi.nlm.nih.gov/7714088/
      www.nejm.org/doi/full/10.1056/NEJMoa012908
      pubmed.ncbi.nlm.nih.gov/23707514/
      pubmed.ncbi.nlm.nih.gov/23408502/
      faseb.onlinelibrary.wiley.com/doi/abs/10.1096/fasebj.2019.33.1_supplement.819.10
      www.biorxiv.org/node/93305.full
      www.health.harvard.edu/heart-health/abundance-of-fructose-not-good-for-the-liver-heart
      pubmed.ncbi.nlm.nih.gov/20102774/
      n.neurology.org/content/88/16_Supplement/P3.090
      pubmed.ncbi.nlm.nih.gov/6859089/
      www.ncbi.nlm.nih.gov/pubmed/10232622
      www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/
      www.ncbi.nlm.nih.gov/pmc/articles/PMC1413655/
      www.ncbi.nlm.nih.gov/pmc/articles/PMC5783752/www.ncbi.nlm.nih.gov/pmc/articles/PMC8470960/
      europepmc.org/article/MED/22402737?javascript_support=no
      pubmed.ncbi.nlm.nih.gov/2518860/
      www.ncbi.nlm.nih.gov/pubmed/24905167
      www.ncbi.nlm.nih.gov/pmc/articles/PMC6526871/
      pubmed.ncbi.nlm.nih.gov/31890243/
      www.ncbi.nlm.nih.gov/pubmed/25686106
      pubmed.ncbi.nlm.nih.gov/21410865/
      This list compiled over years of research by the user known as Pottenger's Human on youtube. Feel free to copy and paste this anywhere you like, no accreditation needed!
      My community tab will always contain an updated version of this list of fasting benefits. I also have playlists on fasting and health topics.

    • @saraandivanevans6881
      @saraandivanevans6881 7 місяців тому +44

      Money, money, money

    • @bonsense7004
      @bonsense7004 7 місяців тому +32

      And not for the first time. Look at all the pharmacorporations that have already been sued. Pharma and chemics aren't the most trustworthy companies..

    • @runee60
      @runee60 7 місяців тому +8

      Absolutely.

  • @johnd9024
    @johnd9024 7 місяців тому +4859

    Crimes against humanity! Jail time!

    • @sosogreen345
      @sosogreen345 7 місяців тому +70

      Deeply sorry they were exposed !

    • @shioq.
      @shioq. 7 місяців тому +54

      corporations can hurt anyone they want, and nobody behind the company will be held accountable. this is what happens when you treat corporations as people. no body to imprison, and no soul to save.

    • @gunt-her
      @gunt-her 7 місяців тому +24

      Don't be anti-Semitic.

    •  7 місяців тому +11

      You've got to prove it in a court of law first. And remember the manufacturers have legal indemnity.

    • @mariocooldude9092
      @mariocooldude9092 7 місяців тому

      CEO of Pfizer is ✡️....CDC director is ✡️...COVID Czar was ✡️... coincidence 🤔???

  • @ElenaShishkanova
    @ElenaShishkanova 6 місяців тому +218

    Who is jailed for the crime against humanity???

    • @Msagstar
      @Msagstar 5 місяців тому +6

      Probably not enough jail space

    • @melbourne-heat.69-71
      @melbourne-heat.69-71 5 місяців тому

      Dr.Burke was executed by firing squad at gitmo and replaced by a clone..The Dems.needed Dr.fauci more that's why he's wearing 10,000 suits and has more security than the president..His time will come..

    • @iawarenow658
      @iawarenow658 4 місяці тому +3

      @@Msagstar UK government needs to pay compensation to victims..

    • @sagefox6141
      @sagefox6141 4 місяці тому

      The anti vaccine nuts who committed crimes against humanity by spreading misinformation that kills people.

    • @moonknight5743
      @moonknight5743 4 місяці тому +1

      No one... Just some under the table payoffs as they're "punished" with probably a few tax increases... Which they can just find a loophole around...

  • @davidhamtaro
    @davidhamtaro 7 місяців тому +2197

    Not promoting unlicensed medicine. MANDATING unlicensed medicine.

    • @marjengle1150
      @marjengle1150 7 місяців тому +52

      That is absolutely right!!!

    • @happyrecluse2849
      @happyrecluse2849 7 місяців тому +91

      And here in Chanada we have the persecuted Convoy Truckers to prove it.

    • @j_3.16
      @j_3.16 7 місяців тому +14

      Yes!

    • @Nursebakr
      @Nursebakr 7 місяців тому +25

      Yup. I was mandated.

    • @CK-vp6hh
      @CK-vp6hh 7 місяців тому +94

      I agree with you but they didn’t actually mandate- our government did. And they need to be held as complicit in this.

  • @laurenced2916
    @laurenced2916 7 місяців тому +11930

    Deeply guilty of mass murder

    • @dicktracy3787
      @dicktracy3787 7 місяців тому

      hear hear

    • @Plisken65
      @Plisken65 7 місяців тому +221

      But who ordered it? Adolf Schwaab?

    • @1cyanideghost
      @1cyanideghost 7 місяців тому

      My dad took the Pfizer boosters, subsequently got a heart attack, clotting in his feet, cellulitis and had multiple organ failure. A healthy man who walked more than athletes everyday, read libraries of books, did incredible real charity at the cost of his own wealth/meals at times, a guy who had salads daily, no stresses, did yoga and everyone thought would live to 100+.
      He passed away last year, we were told by doctors he had a heart attack as the causative factor. We all believe IT IS THE PFIZER-BIONTECH vaccine to blame squarely.

    • @laurenced2916
      @laurenced2916 7 місяців тому +86

      @@Plisken65 One of that lot

    • @Virginie-a
      @Virginie-a 7 місяців тому

      They feel no guilt, fhey are evil

  • @saxmusicmail
    @saxmusicmail 7 місяців тому +876

    Don't forget all the politicians and bureaucrats who participated in this. They are equally guilty.

    • @LoveZelda3
      @LoveZelda3 7 місяців тому +40

      And the media!

    • @cherrybouris845
      @cherrybouris845 7 місяців тому

      They were all in it for benefits in one way or another. Shocking where is for the goodness of our fellow man.

    • @cosmokramer3107
      @cosmokramer3107 7 місяців тому +11

      And why now, after they all entered in a Faustian bargain, they will do everything to cover all their arses. Not one of them has a shred of moral responsibility left.

    • @Redfeather80
      @Redfeather80 7 місяців тому

      Nobody will be held accountable. Nobody in the Epstein/maxwell case. She’s probably in a mansion off a lavish coast. Diddy won’t be held accountable. Pfizer will not be held accountable and neither will Fauci. We’re merely tax paying slaves. Voting isn’t real.

    • @classicrocklover5615
      @classicrocklover5615 7 місяців тому +9

      They all probably had stock in big pharma

  • @AskMeWhen
    @AskMeWhen 6 місяців тому +137

    If they were truly sorry they wouldn’t exist anymore.

  • @Milestonemonger
    @Milestonemonger 7 місяців тому +1787

    The politicians who forced us to jab and quarantine or face jail time must also be punished.

    • @mickzed6746
      @mickzed6746 7 місяців тому +52

      Gallows

    • @johnpenguinthe3rd13
      @johnpenguinthe3rd13 7 місяців тому +109

      Don't forget to include the businesses and bosses who coerced employees into getting it or they were fired. They need to be put on trial as well.

    • @michellefernandez6920
      @michellefernandez6920 7 місяців тому +46

      Give them all the vaccine and every booster. They’re safe, right? Why not?

    • @carouselcakes6237
      @carouselcakes6237 7 місяців тому +14

      Nobody was forced in the Uk. However if you’re elsewhere you have my deepest sympathy.

    • @jodiekohut9443
      @jodiekohut9443 7 місяців тому +9

      And employers

  • @pumpkinspicewife
    @pumpkinspicewife 7 місяців тому +430

    Deeply evil. They are literally only sorry they got caught/exposed.

    • @FernandoScrenci-s9t
      @FernandoScrenci-s9t 7 місяців тому +4

      👏

    • @thepreacher5934
      @thepreacher5934 7 місяців тому +4

      Them outlaws are not sorry at all

    • @fairchild1737
      @fairchild1737 6 місяців тому

      United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats??
      Military created the poison. Depopulation !

  • @PB4U
    @PB4U 7 місяців тому +1891

    They are NOT sorry.

    • @reneschellevis7897
      @reneschellevis7897 7 місяців тому +58

      Sorry, as in wiping their tears with dollar bills ?

    • @SALTYCOMBATDIVER-ExInstructor
      @SALTYCOMBATDIVER-ExInstructor 7 місяців тому +33

      Not sorry enough. They can be sorry, but unless they are held accountable they will do it again and 'feel sorry' while being richer.

    • @pinoygal6232
      @pinoygal6232 7 місяців тому +21

      "And they would not repent of their pharmakea"

    • @jbartmontage6737
      @jbartmontage6737 7 місяців тому

      Fake wars, fake vaccines, fake sugar, fake people - it´s everywhere....

    • @ruspagamer7248
      @ruspagamer7248 7 місяців тому +16

      Of course not. They knew this would happen, but you know, you can't just say "Haha in your ass" to the public

  • @piscesrising6533
    @piscesrising6533 6 місяців тому +53

    So grateful my intuition was spot on once again! I refused the jab, I refused the mask, and I refused to be bullied by anyone! I am very proud of myself that I stood my ground. This has proved to me how strong I really am! I will never Ever comply, NEVER!

    • @iawarenow658
      @iawarenow658 4 місяці тому +2

      good one you i refused the jab too.. yet seen my friends have blood clots and die after having the jab..

    • @00loudog
      @00loudog 4 місяці тому

      My husband and I refused the masks and the jab too pure bloods baby!!!no sheeple in our house

  • @paulhewitt5198
    @paulhewitt5198 7 місяців тому +556

    "Safe and Effective" !!!!! What a load of bollocks!!!
    Criminal is what it is. Start the prosecutions NOW!!

    • @Palmstreet-u7x
      @Palmstreet-u7x 7 місяців тому +5

      who is going to run the courts and be the judges

    • @jenmason472
      @jenmason472 7 місяців тому

      ​@@Palmstreet-u7xexactly! Can't trust the judicial system....in any country 😡

    • @mikeswallow1694
      @mikeswallow1694 7 місяців тому +1

      Definitely effective but not safe

    • @carenfeldman8854
      @carenfeldman8854 7 місяців тому +2

      The WHO still parrots that claim. Still on their website.

    • @percybyssheshelley8573
      @percybyssheshelley8573 7 місяців тому +1

      YEAH-- A TOTAL LOAD of stinkin' Bee Ess!!!

  • @63sgjunior
    @63sgjunior 7 місяців тому +535

    Deeply dishonest and deceitful in the name of profits and moral bankruptcy.

    • @Virginie-a
      @Virginie-a 7 місяців тому +12

      In the name of the devil.

  • @timsmith1278
    @timsmith1278 7 місяців тому +319

    Jail would be far too good for the likes of Gates and Bourla.

    • @richards933
      @richards933 7 місяців тому

      bourla is a reptile

    • @Bryt25
      @Bryt25 7 місяців тому

      And all those poor 'Gates sterilised' ladies in Africa. How disgusting.

  • @bombet1230
    @bombet1230 5 місяців тому +100

    This is why I will never ever get any form of vaccine.

    • @maishagrinn4681
      @maishagrinn4681 5 місяців тому +10

      The rest of us thank you for exiting early.

    • @supersaiyaman11589
      @supersaiyaman11589 5 місяців тому +6

      so that means you have never got the polio vacine either.

    • @WilliamMurphy-uv9pm
      @WilliamMurphy-uv9pm 4 місяці тому

      All or nothing is almost never a good position to take. The jab did not live up to the word vaccine. In limiting severity of disease, to include fewer deaths, it was helpful. Side effects worth considering? Yes, of course. It did not slow or stop disease transmission in humans or at laboratories in Wu Han. That goes contrary to all previous vaccines.

    • @douglasnewman4163
      @douglasnewman4163 4 місяці тому +3

      Never again!

    • @kostapapa1989
      @kostapapa1989 3 місяці тому +3

      After 2020 I am suspicious of drugs too not just vacs

  • @Bill-n2p
    @Bill-n2p 7 місяців тому +1005

    Deeply guilty.

    • @sharonbeck3087
      @sharonbeck3087 7 місяців тому

      Paid well by the corrupt federal governments.

    • @SeaJay_Oceans
      @SeaJay_Oceans 7 місяців тому

      Highly Profitable $ MANDATED SALES & Government funded...
      Are you interested in which USA NIH & CDC leaders owned Rich amounts of extremely profitable stocks $ ?

  • @georgemather9082
    @georgemather9082 7 місяців тому +325

    Stuff your apology, I want justice.

    • @laveraparato258
      @laveraparato258 7 місяців тому +9

      Yes!

    • @1cyanideghost
      @1cyanideghost 7 місяців тому +2

      Same. With deaths in the family and Pfizer directly to blame, it is deeply personal and sorry isn't good enough.

    • @paulnewton3059
      @paulnewton3059 7 місяців тому +1

      I would just like my 2 best lifelong friends of which I now only have one left to admit they were wrong.

    • @christineevans1787
      @christineevans1787 7 місяців тому +1

      Thats right crimes against humanity

  • @RichardPhillips1066
    @RichardPhillips1066 7 місяців тому +302

    Sociopaths are never sorry

    • @sharonjensen3016
      @sharonjensen3016 7 місяців тому +7

      Only for getting caught. That's it.

    • @BWolf00
      @BWolf00 7 місяців тому +7

      And greedy sociopaths are the worst...

    • @davidarundel6187
      @davidarundel6187 7 місяців тому +4

      Nor are NARCASSISTS , or psychopaths .

    • @kevinkurtz9889
      @kevinkurtz9889 6 місяців тому

      Everyone that works there must be a sociopath, everyone except the janitor and door man.

    • @hootowl6354
      @hootowl6354 3 місяці тому

      Donald Trump.

  • @MarkenstineGreen
    @MarkenstineGreen 6 місяців тому +28

    I used to bike 13 klm one way at 30 to 40 klm a hour in the summer at least. Winter not so much. Three months after I got the jab I started having problems breathing. After six months I was biking at 10 to 15 klm a hour. Now after one year I am on oxygen. Governments need to be held accountable.

    • @OIllllO
      @OIllllO 5 місяців тому +3

      @MarkenstineGreen
      Now what did you call those people saying to not take it? You got what you deserved.

    • @shadk2460
      @shadk2460 4 місяці тому +1

      @@OIllllOdamn… you took the words right out of my mouth 💯

  • @leegary3941
    @leegary3941 7 місяців тому +2254

    If they're so deeply sorry, the mRNA crap should be pulled from the shelves. Stop pushing it on people. 😡

    • @Freedom-8910
      @Freedom-8910 7 місяців тому +122

      AND CHILDREN 🤬

    • @jared1512
      @jared1512 7 місяців тому +83

      Still mandated in USA for medical staffs!

    • @whorn9295
      @whorn9295 7 місяців тому +58

      ​@@jared1512insanity at its finest

    • @Claire-sj9mp
      @Claire-sj9mp 7 місяців тому

      @@Freedom-8910 it's in all the chdhood vaccines..all mrna

    • @maryhall3722
      @maryhall3722 7 місяців тому +28

      What? And waste even more of the taxpayer's money? On top of all the backhanded to Boris's mates for out of date PPE.

  • @geoffroberts1131
    @geoffroberts1131 7 місяців тому +822

    We weren't just advised to take it. We were threatened and shamed into taking it.

    • @1cyanideghost
      @1cyanideghost 7 місяців тому +61

      People lost jobs, bank accounts and more.

    • @laino_a
      @laino_a 7 місяців тому

      Others were not vaccinated but were still poisoned.
      It seems like the flu but it is not.

    • @tobywinter1
      @tobywinter1 7 місяців тому +35

      Those of us who wanted or needed to trade were FORCED to take it.

    • @EyesWideOpen...3.16
      @EyesWideOpen...3.16 7 місяців тому +58

      I lost everything, career of 23 years in health and social care, sacked after working through it all and not given a s**t about, everyone had a choice, you either had a backbone and said ‘no’ v simple or succumbed to the absolutely ridiculous amount of pressures and propaganda and brainwashing from every angle, I was even called a murderer after looking after the most vulnerable in society for over 2 decades, trust in any government or medical industry and many others infact are dead, done, over, as if they weren’t to be trusted in the first place……….yr health and wellbeing and morals and integrity are priceless, obviously many live in the controlled society built around them, that’s on them……

    • @lizbuckland4163
      @lizbuckland4163 7 місяців тому +25

      I was told that I wouldn't be able to get my suprapubic catheter changed if I didn't have the vaccines. They had already erased my care plan once and left me with no care at all.. I have to have a potent bladder washout every week and my catheter changed every 6wks, sometimes sooner if I have an infection, all at home by district nurse. For the first 3 months I was left with nothing. I cannot do it myself due to the after effects of a small stroke in Dec 2019. That and Neuropathy (due to over 20 years of Ciprofloxacin use for kidney infections as I have complex kidney and bladder issues). The combination makes it hard to use my hands and I physically cannot do it myself. Since the vaccines I have had 2 more small or mini strokes and the Neuropathy has caused a torn rotator cuff tendon in my shoulder, affecting my hand. I already had high BP and intermittent arrhythmias, since the vaccines these have got considerably worse with exhaustion, repeated arrhythmias going on for much longer episodes, breathlessness when talking, my sats go down to 70/75 when talking so big difference. This then leads to dizziness and falls etc due to lack of blood oxygen... I wish I had never had these damn vaccines, but I would have lost all my NHS care yet again if I had. Luckily we refused them for our daughter as by then the side effects were becoming known.

  • @yvonneiversen8749
    @yvonneiversen8749 7 місяців тому +558

    Deeply sorry? For what has happened as a result of their abuse of drugs, they should be banned from ever distributing drugs again!

    • @sharonjensen3016
      @sharonjensen3016 7 місяців тому

      They also need to stop brainwashing doctors who end up prescribing these drugs and regurgitating whatever they're told. "Oh, well, yes, there are risks with these medications, but they're on the market so they must have benefits." Sure, thought-sayers!

    • @lindathompson4770
      @lindathompson4770 7 місяців тому +8

      Can we assume the same applies to the US and the rest of the world???

    • @terrywereb7639
      @terrywereb7639 7 місяців тому +10

      Not just distributing, but developing!

    • @iSheree
      @iSheree 7 місяців тому

      The problem is, some medication can only be gotten from this company. If we ban them, lots of people will suffer or even die.

    • @James-gf9jl
      @James-gf9jl 7 місяців тому +4

      Should be deeply in jail.

  • @MartinPerry-j8g
    @MartinPerry-j8g 6 місяців тому +64

    It's Not Safe and Not Effective!

  • @LizzGee1111
    @LizzGee1111 7 місяців тому +544

    I’m still waiting for my “deeply sorry” by my former employer for firing me for not getting the jab and labelling as misconduct 😡 I hope everyone involved is deeply punished and held accountable. Very deeply.

    • @howard1beale
      @howard1beale 7 місяців тому +36

      Sue your employer

    • @christine4939
      @christine4939 7 місяців тому +20

      Agree. One day you sue. Only then will they be deeply sorry.

    • @tarico4436
      @tarico4436 7 місяців тому

      @@howard1beale Network, right? The movie?

    • @Beanerds
      @Beanerds 7 місяців тому +18

      Me too , but I do keep an ear on them through good people who remained and they are suffering today , shipbuilders don't fall from trees .
      Loosing 35 Tradesmen from a workforce of 60 tradesmen on 2nd Feb 2021 hurt deeply and today they are unable to fill those roll's ,, Ha blardy Ha ,, Karma is a birtch aye ? .
      The remaining workforce are conastanly sick , day's/week's off at a time , yes they are struggling and deserve it all !

    • @manuelferreira4345
      @manuelferreira4345 7 місяців тому +5

      I waiting for deeply sorry everything was not gonna be OK. My work closed on st paddy 2020 and I haven't worked since...

  • @David-uf8ex
    @David-uf8ex 7 місяців тому +2126

    Where is Johnson where is Hancock and Blair ? They constantly pushed this junk

    • @joetodd4351
      @joetodd4351 7 місяців тому +64

      The drug companies will be the fall guys. My research has shown me that it was made to order..

    • @cremvirus
      @cremvirus 7 місяців тому

      ​@@joetodd4351 it was made pre covid

    • @laurapearson3370
      @laurapearson3370 7 місяців тому +54

      But so did John , even urging pregnant women to take it

    • @robbeales5516
      @robbeales5516 7 місяців тому +4

      It matches their brains 🧠

    • @DevineOne
      @DevineOne 7 місяців тому +34

      Money can make people do anything. When they have no conscious

  • @britt6579
    @britt6579 7 місяців тому +1517

    Dont forget the doctors who were fired for not complying with their criminal acts.

    • @Opinlinz
      @Opinlinz 7 місяців тому +93

      Don't forget the doctors who promoted it and pushed it onto people

    • @grantperkins368
      @grantperkins368 7 місяців тому

      Both. The underlying nexus between the WHO (not the band), Gates, Fauci, Pfizerman and his squeeze, the Biden Crime Syndicate and the Pfizer funded media,needs total reconsideration in the light of recent events. It boils down to:
      Drugs for what?
      For health? Or for profit?

    • @gailny
      @gailny 7 місяців тому +18

      I hope the doctors sue them

    • @lsmith495
      @lsmith495 7 місяців тому +50

      I was forced to leave my job of 22 years 😡

    • @pugsymalone6539
      @pugsymalone6539 7 місяців тому +28

      ​@lsmith495 if you left your job, but still have a clean bloodstream, then you can rest easy. You will be a survivor, while the righteously indignant will all be gone soon, if not already.

  • @dig1272
    @dig1272 6 місяців тому +22

    Whenever I write down 3 things I am grateful for, before bed each night, my NOT taking "it" is often on the list. I never came close to taking it. It's one of the things I'm most proud of in my lifetime and proud of myself for. I'm very impressed with myself. Friends and family succumbed. My confidence has gone up so much because of that. I realized I can trust myself and hold the line against immense pressure and I am very strong.
    Loved seeing you ride the Honda motorbike!! 😊

    • @piscesrising6533
      @piscesrising6533 6 місяців тому +4

      Me too, I’m with you on that! ❤️😊

    • @zegikniet9999
      @zegikniet9999 5 місяців тому +1

      same, the pressure was huge. lost some family membrrs along the way but hey, fuck em.

  • @oldbiker9739
    @oldbiker9739 7 місяців тому +395

    they say there sorry while the WHO WEF and the UN is pushing for a global health treaty

    • @elizabethfermor344
      @elizabethfermor344 7 місяців тому +35

      And make it all compulsory.

    • @josephvanwie6706
      @josephvanwie6706 7 місяців тому

      According to Dr Campbell, the west has signed over it's sovereignty to the WHO since March 2024.

    • @holmesgormerley308
      @holmesgormerley308 7 місяців тому +12

      @@elizabethfermor344getting injected while being restrained

    • @lw1zfog
      @lw1zfog 7 місяців тому

      PHE > UKHSA

    • @annatonino7331
      @annatonino7331 7 місяців тому +4

      May 25th it is the date. God have mercy on us 🙏

  • @botfantasies6229
    @botfantasies6229 7 місяців тому +411

    1. Live a healthy life
    2. Stop buying their junk
    3. Put them out of business

    • @deborahp-q3w
      @deborahp-q3w 7 місяців тому +2

      join class action for opiate crisis

    • @miguel-jesus
      @miguel-jesus 7 місяців тому +1

      Whenever possible, I will ask for generic or alternative.

    • @botfantasies6229
      @botfantasies6229 7 місяців тому +3

      @@miguel-jesus what junk of theirs do you need?

    • @miguel-jesus
      @miguel-jesus 7 місяців тому

      @@botfantasies6229 For my prescribed meds, I am know choosing another store.

    • @Shredder858
      @Shredder858 7 місяців тому +6

      Cue the turbo cancer medication

  • @bellabear653
    @bellabear653 7 місяців тому +95

    In Australia the phrase was (Use it or be fired, can't travel, can't see family.) Time for a lawsuit.

  • @pierrelabbe3173
    @pierrelabbe3173 4 місяці тому +1

    ❤ love Canada Merci Québec M.T.L Merci 😊

  • @Kinkle_Z
    @Kinkle_Z 7 місяців тому +232

    I think UA-cam should be sued also for abetting the fraud!

    • @_Lightning_Dog_
      @_Lightning_Dog_ 7 місяців тому +22

      Facebook also

    • @RedRupert64
      @RedRupert64 7 місяців тому +1

      YT also provided good information. TalkRadio was presenting a balanced view throughout, so after a short while it became obvious that jabs simply were not beneficial or necessary for most of us.

    • @kawataufik5098
      @kawataufik5098 7 місяців тому

      Indian people have power in UA-cam band all information I see CEO being asked she get away at list now!

    • @BrickBasherUK
      @BrickBasherUK 7 місяців тому

      ​@@RedRupert64No, UA-cam have actively taken down or banned literally anyone who said a negative word about the vaccines even when it was evidence based and left videos online containing absolute garbage mainstream propaganda

    • @n0killz44
      @n0killz44 7 місяців тому

      People don’t realise how ‘leaky’ UA-cam is. Without it large a proportion of awake people would still be asleep. I think there’s enough evidence to suggest there’s a white hat at play, suing yt would be a grave mistake imo.

  • @adavies1752
    @adavies1752 7 місяців тому +625

    All involved should be sent to prison for 6 billion years

    • @karlg2950
      @karlg2950 7 місяців тому +8

      That means they will get out , Sorry no Amnesty this time!

    • @hotarobin1
      @hotarobin1 7 місяців тому +4

      @@karlg2950 they will...just not in this realm of their existence..

    • @Emily-pm5gr
      @Emily-pm5gr 7 місяців тому +3

      Probably somewhere around 1/3 of humanity

    • @sunway1374
      @sunway1374 7 місяців тому

      The senior executives are probably people with business degrees. With little understanding or no backgrounds in epidemiology, vaccines, human biology, statistics, clinical and non-clinical trials, etc.
      You let people like that run a high-tech, scientific or engineering company, you would get bad outcomes. Just ask Boeing.

    • @terryfoster1706
      @terryfoster1706 7 місяців тому +11

      Including the government and scientists who were on tv every evening.

  • @debbieclougherty3171
    @debbieclougherty3171 7 місяців тому +801

    Sorry my arse!! The NHS are still offering it to pregnant women!! 🤬🤬

    • @VL-qy4fc
      @VL-qy4fc 7 місяців тому +136

      It's madness, isn't it!
      Pregnant women advised not to drink, not to smoke, not to eat raw eggs or soft cheeses, caution with certain medications, but hey, queue up for your covid jab.

    • @Elleliza3501
      @Elleliza3501 7 місяців тому +46

      It's maddening!!!!

    • @carmeez424
      @carmeez424 7 місяців тому +24

      Same in the states.

    • @bridiesmith5110
      @bridiesmith5110 7 місяців тому +15

      And to patients about to undergo major surgery. lung removed, diaphragm taken out, spleen removed and the lining of the heart replaced. Why would you worry about getting the v I r u s and yes had the jabs to save sick parents.

    • @thefloatingapothecaryroman16
      @thefloatingapothecaryroman16 7 місяців тому +4

      ​@@VL-qy4fcyep, but ok to vape

  • @evannewyork3281
    @evannewyork3281 5 місяців тому +36

    How sorry 😔 are they for making 180 Billion profit for their share holders?

    • @laurenbrehm9357
      @laurenbrehm9357 5 місяців тому

      Fauci and ppl like Anderson Cooper were paid millions to push the vaccine

    • @AmadeuShinChan
      @AmadeuShinChan 4 місяці тому

      Exactly.

  • @kathybailey436
    @kathybailey436 7 місяців тому +325

    These people are guilty of my Mom's death and many others.

    • @josephvanwie6706
      @josephvanwie6706 7 місяців тому +24

      Sorry! Many have to suffer living with brain fog for the rest of their lives. A married man with three children is having his businesses collapse because of it. Almost a fate worse than death.

    • @lrx54
      @lrx54 7 місяців тому +8

      I’m so sorry 🌷❤️🕊️

    • @vdeblois1352
      @vdeblois1352 7 місяців тому +8

      I'm sorry for your loss 😢.. I worry about my mom constantly.

    • @Chris3141592
      @Chris3141592 7 місяців тому +7

      Sorry for your loss Kathy; don't get sad, get angry; get very very very angry and direct that energy in a positive constructive way. Lobby for jail time for those responsible for starters.

    • @toscadonna
      @toscadonna 7 місяців тому +12

      Yep, and my father’s and 40 other people that I know who either died like he did after taking them or were hospitalized and severely harmed. Evil incarnate.

  • @StacyTlaughitinandlaughitout
    @StacyTlaughitinandlaughitout 7 місяців тому +355

    Deeply sorry WTF seriously this is crimes against humanity!🤦🏾‍♀️

    • @tripzincluded8087
      @tripzincluded8087 7 місяців тому +4

      it's the great reset.

    • @tayclift5322
      @tayclift5322 7 місяців тому

      ​@@tripzincluded8087supposedly it happens every 138 years according to this man whose channel is called Archaix I have not gone through all his videos but he has a mountain of data to back up his claims...but from what i have seen it is worth checking out.

  • @christopherjames1453
    @christopherjames1453 7 місяців тому +942

    Millions dead, millions more possibly injured, no single person yet held accountable.

    • @woofwoof9647
      @woofwoof9647 7 місяців тому +36

      17 million an climbing 😢

    • @1cyanideghost
      @1cyanideghost 7 місяців тому +51

      My dad and some elements of our family died to this. Dad took Pfizer, then started manifesting symptoms, got a heart attack then clotting and multiple organ failure. He was a very healthy man!

    • @gwenechotaylor96
      @gwenechotaylor96 7 місяців тому +15

      not yet anyway. I will weep with joy on that day of accountability or public apology.

    • @almafrith778
      @almafrith778 7 місяців тому +27

      @@1cyanideghost
      Sorry to hear about your Dad. 🙏🏼 Most of us won’t forgive or forget the crime against humanity.

    • @fuddyduddyhorsemanship
      @fuddyduddyhorsemanship 7 місяців тому +13

      @@1cyanideghostsorry to hear it. My husband was diagnosed with cancer after the Pfizer booster. He is still around though.

  • @ToweringSpirit
    @ToweringSpirit 6 місяців тому +4

    Dr Campbell - I have followed you since the early days of COVID19. What struck me of you, is your objectivity and scientific method in your reviews. Love your sense of humour. Thank you for your views in dark times.

  • @kevinjhonson5925
    @kevinjhonson5925 7 місяців тому +455

    I’m deeply sorry I listened to the So called experts and got the jab so I could keep my job. I’m deeply sorry that I had to tell my daughter that I have stage 4 lymphoma. I’m deeply sorry for the hell my family went through because of my cancer when i spent 43 days in hospital 12 of them in ICU on a ventalator. But all is ok because Pfizer is sorry

    • @robertadowns217
      @robertadowns217 7 місяців тому +1

      So sorry, Kevin. I tried to warn everyone, for 6-9 months on this podcast. Finally, Dr Campbell decided to do the research and was shocked with his findings!! Many were duped by governments and big pharma!!!!!!

    • @robertadowns217
      @robertadowns217 7 місяців тому +25

      So sorry Kevin! I tried to warn all on this podcast, until Dr Campbell did the research...

    • @robertadowns217
      @robertadowns217 7 місяців тому +20

      So sorry Kevin! My reply keeps getting deleted??

    • @nasserlondon12
      @nasserlondon12 7 місяців тому +32

      I am so sorry to hear your story.
      So many people are in your situation and it's so unfair.

    • @heidiwestgate7045
      @heidiwestgate7045 7 місяців тому +19

      I will pray for you and your family.

  • @workshop3301
    @workshop3301 7 місяців тому +38

    The deeply dripping sarcasm from Dr. Campbell should be saluted!!❤

  • @Pad_See_Ew
    @Pad_See_Ew 7 місяців тому +149

    Albert Bourla, Fauci, Peter Daszak are surely all sorry. In actuality, they should all be tried and prosecuted.

    • @fairchild1737
      @fairchild1737 6 місяців тому

      United States military made the pharmaceutical companies put their names on the vile bottles and bottle them. Forced to do this or else. Threats??
      Military created the poison. Depopulation !

    • @elizabethdjokovic2691
      @elizabethdjokovic2691 3 місяці тому +1

      Yes. I agree with you.

  • @trevorbailey2431
    @trevorbailey2431 6 місяців тому +75

    They are not sorry at all, the only thing they are sorry for being caught poisoning people.

  • @Seiskid
    @Seiskid 7 місяців тому +301

    Deeply sorry. All the way to the bank.

    • @ValleyCyclingNut
      @ValleyCyclingNut 7 місяців тому

      Yes , when it`s just a fine for killing people and they made billions + . they just look the other way , cost of doing business. Criminals for sure but if we the people don`t make some new rules it WILL continue . Very sad .

    • @carlmagnussen7773
      @carlmagnussen7773 7 місяців тому +4

      When does YT stop to act as an agent provocateur keeping promoting this not legal medical product. I am referring to the text from the WHO in the information panel just beneath the video.

    • @noncompliant4316
      @noncompliant4316 7 місяців тому +4

      @@carlmagnussen7773 When YT stops being funded by the pharmaceutical industry through advertising and lobbying.

  • @cynthiapate9138
    @cynthiapate9138 7 місяців тому +495

    So sorry for committing crimes against humanity. Safe and effective….lying words.

    • @lindamacro5945
      @lindamacro5945 7 місяців тому +8

      Who used Parliament recently (where he cannot be prosecuted) to say 'safe and effective' in regard to Covid vaccine? Would say it outside his safety walls?

    • @bustjanzupan1074
      @bustjanzupan1074 7 місяців тому +6

      Yes, but how much that "sorry" is now good 4 the dead ones ?

  • @heathtich3
    @heathtich3 7 місяців тому +621

    “Deeply Sorry” for me having to quit my nursing job because of horrific adverse side effects from 2 jabs that were mandated. I had to have a major surgery from the damage. “Sorry” doesn’t cut it for all of us that were damaged and all the families dealing with losses and illness from something that was supposed to protect us!!!! I have zero faith in pharmaceutical companies! Absolute crimes against humanity!!! This plandemic and all the criminals need to be exposed!

    • @trishalee3198
      @trishalee3198 7 місяців тому +31

      So sorry for all you suffered due to this mandate, and I wish you well from this point forward. May we all be healed from this madness.

    • @kawataufik5098
      @kawataufik5098 7 місяців тому +26

      Nurse and doctors guilty plus anyone had power boss in factory leader in hospital bla bla

    • @pigmeal2224
      @pigmeal2224 7 місяців тому +50

      I left my nursing profession of 20 years rather than take something my clinical judgement could not possibly endorse or allow. Thank god I had a plan B. I view my complying colleagues as a collective of cowards though. Their clinical judgement would have been no different from mine, and had we as a collective stood our ground the madness would have been stopped in its tracks. That day. So yes I feel for you ... but there must be some acceptance of complicity ... like it or not ... 🌹🌹

    • @leesaunders1930
      @leesaunders1930 7 місяців тому +8

      What kind of surgery did you have, if you don't mind me asking?

    • @jcutler1018
      @jcutler1018 7 місяців тому +6

      I hope that you can recover.

  • @zysbca
    @zysbca 6 місяців тому +44

    they should be put in jail!

  • @DonaldMerrit
    @DonaldMerrit 7 місяців тому +238

    I'm 65 and nothing in my life comes close to the criminality (throughout all facets of the establishment) that was involved with the cupid Pokie. My Harrowed heart cannot comprehend forgiveness for those who separated the dying from their families causing them to die alone as their loved ones tears stained the glass that separated them.

    • @EastCoastGal66
      @EastCoastGal66 7 місяців тому +9

      😭❤✝️🙏

    • @CurbBlurbs
      @CurbBlurbs 7 місяців тому +11

      Sad and necessary post. Well said. There will never be forgiveness here.

    • @nintencat
      @nintencat 7 місяців тому +1

      Cupid Pokie 😉

    • @GazGuitarz
      @GazGuitarz 7 місяців тому

      Most of that was completely OUR EXTREMELY CRUEL GOVERNMENTS and HEALTH AUTHORITIES FAULT!

    • @tedlasso8300
      @tedlasso8300 7 місяців тому +3

      To forgive might be divine but right now it would feel inhuman. Perhaps we need consequence and contrition first.

  • @lauriep8762
    @lauriep8762 7 місяців тому +102

    Prior to 1997 it was illegal to advertise prescription drugs in the US. It still should be!

    • @davidarundel6187
      @davidarundel6187 7 місяців тому

      Same in NZ

    • @zainkhanrealtor8198
      @zainkhanrealtor8198 7 місяців тому

      In Canada, advertising of pharmaceutical drugs is limited to make, price and quantity. Advertising of indications for use is prohibited.

  • @boterhammetpindakaashagelslag
    @boterhammetpindakaashagelslag 7 місяців тому +190

    I bet they are wiping their tears with dollar bills ..

  • @antagenvictim
    @antagenvictim 5 місяців тому +109

    Allllll about money. These people have no souls.

    • @maishagrinn4681
      @maishagrinn4681 5 місяців тому +1

      Souls aren't real.

    • @antagenvictim
      @antagenvictim 5 місяців тому +9

      @@maishagrinn4681 Thanks for contributing absolutely nothing to the comments. 👍🏻

    • @derekellisCAN
      @derekellisCAN 4 місяці тому

      @@antagenvictim And women contribute nothing to the world at all but bs.

    • @haurg7418
      @haurg7418 4 місяці тому

      ​@@antagenvictimit's your fault for that guy's comment, next time do not mention the unreal

    • @antagenvictim
      @antagenvictim 4 місяці тому

      @@haurg7418It’s a figure of speech, dork.

  • @DJOverpar
    @DJOverpar 7 місяців тому +325

    Deeply sorry, after making billions of dollars of profit.

    • @rozalynanderson8387
      @rozalynanderson8387 7 місяців тому +3

      Im sure I read somewhere that the owners of the 'shop' were all Isnotreali?

    • @angelawhiteway6306
      @angelawhiteway6306 7 місяців тому

      Bingo!

    • @chazlabreck
      @chazlabreck 7 місяців тому +1

      @@rozalynanderson8387 yeah ..its a common theme,,,you wonder who would be that callous? he chosen ones... we don't matter other than a resource to be managed controlled and exploited.... rewind repeat.

    • @PunsandPixels
      @PunsandPixels 7 місяців тому +2

      They will be sorry when they stand before their maker. Wouldn’t want to be in their shoes.

    • @marissayoung3048
      @marissayoung3048 7 місяців тому

      Exactly

  • @jaykana7677
    @jaykana7677 7 місяців тому +185

    Chief Medical officers in England need to be bought justice !

    • @carmeez424
      @carmeez424 7 місяців тому +4

      In the states too.

    • @michaeldawson6309
      @michaeldawson6309 7 місяців тому +9

      Whitty and Valance need to be fined and jailed for their complicity in the harms against humanity.

    • @hittitecharioteer
      @hittitecharioteer 7 місяців тому +6

      The Health Secretary, Mat Hancock.

    • @paulnewton3059
      @paulnewton3059 7 місяців тому

      Especially that weedy Chris Whitty. A man was jailed for merely jostling him in the street yet Whitty received a knighthood. Where is the odious creep hiding these days?

    • @elizabethlynch3226
      @elizabethlynch3226 7 місяців тому +2

      Australia too!

  • @GrumpyMeow-Meow
    @GrumpyMeow-Meow 7 місяців тому +611

    Say you’re sorry to all the folks who lost their jobs for not taking your product.

    • @Jetmab04
      @Jetmab04 7 місяців тому +22

      Yep and, sorry for the millions of people now killed by their criminal psychopathy!

    • @christenedoering7720
      @christenedoering7720 7 місяців тому +11

      ​@@Jana-om4bbnow I'm convinced your a troll

    • @donnazukadley7300
      @donnazukadley7300 7 місяців тому

      Or the nurses that were mandated, got vacc1ne injured and lost their job ANYWAY BECAUSE THEY TOOK TOO LONG WHILE OUT IN FMLA FROM the 💉 💉 💉

    • @jeffmoodie6144
      @jeffmoodie6144 7 місяців тому +20

      Jobs… don’t forget lives and health and peace of mind for all those who now understand it was a mistake to comply and they don’t know when they will be affected.

    • @MsJoyce31202
      @MsJoyce31202 7 місяців тому

      That's the governments fault. Let jabbers get jabs and leave other people alone. There should have been no threats toward people's livelihoods.

  • @falconinflight6235
    @falconinflight6235 6 місяців тому +3

    Thank you for the continuous insights into medical care.

  • @HeDe-o2j
    @HeDe-o2j 7 місяців тому +196

    No more money fines, they don't work. Lifetime Jail sentences for the people in charge, not lower level management.

    • @emeraldheart415
      @emeraldheart415 7 місяців тому +11

      Well said. Somehow, the 'ones with the power' get off scott-free. They make sure that those lower down are left to carry the responsibility for their greed and corruption. It's sickening. "Sorry" isn't good enough!

    • @JennyMartinPhoto
      @JennyMartinPhoto 7 місяців тому +4

      Yup they pay the fines and are still in massive profit. Jail time would work better

    • @phillipcoiner4232
      @phillipcoiner4232 7 місяців тому +1

      The fines are shareholder money.
      So my bonus is not what it was last year.
      In 18 months he is being interviewed on the business channel of how he steered the ship through rocky times.
      What a hero!

    • @HeDe-o2j
      @HeDe-o2j 7 місяців тому

      Boycott the stocks of Pfizer and Co.

    • @HeDe-o2j
      @HeDe-o2j 7 місяців тому

      Stop investing in companies that try to eliminate the working class.

  • @smobach
    @smobach 7 місяців тому +110

    When will Google apologize for the 'Covid 19' information under these kind of videos.
    Guilty als hell.

    • @lvr5266
      @lvr5266 7 місяців тому +8

      Good one. I've gotten so used to these i'm not even noticing anymore..

    • @jasonscott8844
      @jasonscott8844 7 місяців тому +3

      I had to double check but mine says information from the Australian gubberment. They were still pushing the jab on me a few months ago.

    • @weareruledbyNarcissists
      @weareruledbyNarcissists 7 місяців тому +4

      Accomplices must also be held accountable

  • @joetodd4351
    @joetodd4351 7 місяців тому +133

    So WHY are they still pushing it?!

  • @judycallaghan4889
    @judycallaghan4889 6 місяців тому +4

    Thank you for speaking out.

  • @IndigoStargazer
    @IndigoStargazer 7 місяців тому +194

    All basic Tenets of the Nuremberg Code was disregarded! Especially informed consent.

    • @billbush-t5x
      @billbush-t5x 7 місяців тому

      Calling the vax an investigational agent instead of an experiment was to get consent without informing.

    • @barblucchesi9527
      @barblucchesi9527 7 місяців тому +4

      Biochemical warfare

    • @21972012145525
      @21972012145525 6 місяців тому

      That's not true. They didn't hide it and give it to you

  • @timlong4704
    @timlong4704 7 місяців тому +303

    I will never forget or trust our government for they did to us ever again.

    • @charliebrandt2263
      @charliebrandt2263 7 місяців тому

      Our government is handing over it's power to the WHO. you ain't seen nothing yet.

    • @smokingwraith9990
      @smokingwraith9990 7 місяців тому +6

      Same

    • @kevspencer5744
      @kevspencer5744 7 місяців тому +3

      They were terrible but Labour would have been even worse.

    • @debbiescott6732
      @debbiescott6732 7 місяців тому +6

      Same here. I've always been a big supporter of my country's government. Military brat here. But now, I will NEVER trust them again.

  • @WardenclyffeResearch
    @WardenclyffeResearch 7 місяців тому +222

    They are terribly sorry for ruining millions of lives, and probably won't do it again.... probably.

    • @sarahwalkerbeach6985
      @sarahwalkerbeach6985 7 місяців тому

      Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.

    • @thesouluniversal
      @thesouluniversal 7 місяців тому

      Theyve done it before, with a medicine for haemophiliacs, a batch was tainted with HIV, they knew it, it was banned from sale by in America by an American judge. So they sold it to countries outside of America, with the exact consequences that youd expect. They knew, they just preferred causing death, misery and suffering over taking a loss. Im sure youll find many more cases if the internet hasnt been scrubbed, I havent looked in a long while, google search is worse now.

    • @theflaca
      @theflaca 7 місяців тому +1

      I guessed Perth straight away; black boys and sandy hills and sun. I can't believe John was just a few k's from home. Thankyou John. You were a single candle of reason in a sea of darkness for the last 3 bloody years. I lived through the world's longest lockdown in Melbourne. I watched you daily. The moment the border opened I got straight to Perth. Never looked back.
      signed, a devotee of reason, and a wagirl, Perth Australia.

  • @Patience-un9il
    @Patience-un9il 6 місяців тому +3

    Dr.Campbell you are so good,I am glad I came across you on U tube.Factual, extremely intelligent keep up the honest and awesome job.

  • @mrcomenttoe2009
    @mrcomenttoe2009 7 місяців тому +70

    I'm deeply sorry too
    🌹condolences🌹to all the losses from 2019 2020 2021 2022 - 2023 and 2024

    • @paul4020
      @paul4020 7 місяців тому

      6 million people died due to a lethal and contagious virus. The vaccine saved more millions of lives. You were saying?

  • @nancya8262
    @nancya8262 7 місяців тому +40

    Well DONE Dr. John, you are a true gift to all of us.

  • @ThomasKing19933
    @ThomasKing19933 7 місяців тому +335

    As much as I'm relieved that I never had the 'Jab', I still worry about the people who fell for the lie. (especially family members)

    • @bustjanzupan1074
      @bustjanzupan1074 7 місяців тому +1

      Eeeeeeexxxxxxxaaaaaaaccccccctttttttlllllllyyyyyyy !!! ! !!!

    • @Putinspurpleheaded
      @Putinspurpleheaded 7 місяців тому +5

      I don't I have no sympathy whatsoever

    • @DonaldMerrit
      @DonaldMerrit 7 місяців тому +6

      Yes everybody who took the Pokie is somebody's family member

    • @tinasturgeon7087
      @tinasturgeon7087 7 місяців тому +7

      Me too, family and friends

    • @alanlafromboise3156
      @alanlafromboise3156 7 місяців тому +18

      Same here, 68 yrs young and have never had any kind of jab in my adult life, when this vaxx hit here I warned all family and friends, most listened but my 61 yr young brother let the fear get to him, he did the dirty deed and is dead now,his heart was " shredded"!

  • @TheBumfloss
    @TheBumfloss 6 місяців тому +61

    This was teason! We all know it! They should be put in jail!!!

  • @sdc9593
    @sdc9593 7 місяців тому +329

    Another reason lobbying should be illegal.

    • @NaomiCramerLawyer
      @NaomiCramerLawyer 7 місяців тому +13

      legalised bribery & corruption

    • @hongry-life
      @hongry-life 7 місяців тому +11

      It is corruption.

    • @hongry-life
      @hongry-life 7 місяців тому

      And people in power with double interests. Ursula Vander Leyen's husband is in gentech. And she ordered 1,8 billion vaccines from Pfizer without a debate in the EU parliament or its approval.

    • @Truthseeker-iz3dj
      @Truthseeker-iz3dj 7 місяців тому +9

      tbh no medical company should be listed on the stock exchange. Profits shouldnt be associated with health. Not saying the business can't make a profit but shouldn't involve the pressure of pleasing shareholders.

    • @bbybeatboxx
      @bbybeatboxx 7 місяців тому +3

      @@Truthseeker-iz3dj Total reform is obviously needed. Unfortunately some very cowardly and immoral people would rather die of ignorance and lose their freedom, than admit that they made a mistake. that is how deeply embedded the sat£nic cu$lt has driven narcissism in the world. It is extremely biblical!

  • @stevenweishaupt8591
    @stevenweishaupt8591 7 місяців тому +514

    After they committed crimes against humanity, they're deeply sorry . They covered up all the all the trials.

    • @davidhelling9296
      @davidhelling9296 7 місяців тому +6

      Russel Brand recent expose very unsettling..

    • @papat7435
      @papat7435 7 місяців тому +1

      You are quite deluded.

    • @somethinderpsterious
      @somethinderpsterious 7 місяців тому +10

      ​@@papat7435please please get your booster

    • @sargentpepper8931
      @sargentpepper8931 7 місяців тому

      Even the animal trial of 30 ferrets in 2014 . they all died within 3 years . thats when they knew the vaccine was a success .

    • @Direkte_Demokratie
      @Direkte_Demokratie 7 місяців тому +7

      They are stil on poisoning duty.
      They are sorry for not given the bribe to this agency.

  • @LG-jg8vy
    @LG-jg8vy 7 місяців тому +156

    Pfrizer lied, And yet we still have the Covid-19 vaccine information from the NHS tag on this video!

    • @piscesrising6533
      @piscesrising6533 6 місяців тому +2

      …and the cdc, which by the way is a private company

  • @kobalt77
    @kobalt77 6 місяців тому +4

    God bless you Dr Campbell.

  • @PhysicsViolator
    @PhysicsViolator 7 місяців тому +310

    Of course they’re sorry while laughing all the way to the bank with their billions.

    • @LorettaJameeVincent
      @LorettaJameeVincent 7 місяців тому

      i just got my first song put together check it out guys. thank you! it's anti-v country music

  • @eoin9909
    @eoin9909 7 місяців тому +303

    They need to be closed down and the top people need to be jailed

    • @robinhood4640
      @robinhood4640 7 місяців тому +7

      If we get the politicians on our side it might happen, if we want the politicians to go down with them, nobody will be going to prison.

    • @stevepayne240
      @stevepayne240 7 місяців тому

      Yup let’s just shut down drug companies who, you know, make life saving drugs.

    • @michaeldawson6309
      @michaeldawson6309 7 місяців тому

      Unless an example is made this will happen again ! People died due to government propaganda and poor medical advice. Covid was a scam on an epic scale that killed l a lot of loved ones ! man made hell !

    • @MmmhMarky
      @MmmhMarky 7 місяців тому

      If politicians weren't involved, this would happen but they are joined by the hip.

    • @doveronefoxtrot4417
      @doveronefoxtrot4417 6 місяців тому

      But the top people are part of the global elite, so that's not likely.

  • @jasmin5753
    @jasmin5753 7 місяців тому +653

    If they are deeply sorry.. then they are admitting that their vaccines were unsafe.
    There should now be a class action lawsuit launched against them.

    • @sarahwalkerbeach6985
      @sarahwalkerbeach6985 7 місяців тому

      Just Pfi$er? You're kidding right? Take a look at the recent list of pharma settlements, for failing to report safety issues on their unlawful drugs. All the big names are there. And on more than one occasion... GlaxoSmithKline $3B and $750M, Pfi$er $2.3B and $430M Merck $650B, AstraZeneca $520M and $355M, JohnsonJohnson $2.2B. These 'drop in the ocean' fines will be seen as collateral damage. It's happened before, and it'll happen again. You think anyone cares? Yeah nah.

    • @thedevilsadvocate5210
      @thedevilsadvocate5210 7 місяців тому +15

      no they are only sorry they promoted the jab before it was allowed to be promoted

    • @Madonnalitta1
      @Madonnalitta1 7 місяців тому +7

      It was about misleading on social media, that's probably as good as we're going to get.

    • @mutedsounds2k
      @mutedsounds2k 7 місяців тому +9

      Janine Small admitted it publicly in front of the EU Parliament.

    • @sarahwalkerbeach6985
      @sarahwalkerbeach6985 7 місяців тому

      😷 There will be NO accountability and NO punishment. Remember that governments worldwide granted covid vaccine suppliers Pfizer and BioNTech indemnity from any claims that may arise from use of the vaccine.

  • @davidpersson250
    @davidpersson250 6 місяців тому +33

    Deeply sorry for beeing caught...

    • @ZackSansing
      @ZackSansing 4 місяці тому

      cheap talk. Their actions speak louder than words.

  • @holidayhouse03
    @holidayhouse03 7 місяців тому +1208

    Millions of Dead
    Billions of Wounded
    Trillions of Profit

    • @michelleduncan9965
      @michelleduncan9965 7 місяців тому +23

      Well said & spot on holiday.

    • @thominaduncanson7596
      @thominaduncanson7596 7 місяців тому +25

      Met all the goals.

    • @TransitionedToAShark
      @TransitionedToAShark 7 місяців тому +6

      @@thominaduncanson7596billions is the goal

    • @lisavanoni6552
      @lisavanoni6552 7 місяців тому +13

      Where is Gates, Tech execs, Mockingbird media, and WHO loud mouths!

    • @jamesrussel1133
      @jamesrussel1133 7 місяців тому +8

      And that’s just the result of Johns misinformation and anti vax grifting, Lol

  • @gerardkelly1191
    @gerardkelly1191 7 місяців тому +518

    ALL TRUST IN WEF POLITICIANS & BIG PHARMA IS FOREVER GONE..!!!

    • @deborahp-q3w
      @deborahp-q3w 7 місяців тому +6

      first its opiate crisis now this my daughter is a victim still alive thanks be to God!

    • @judyjackson639
      @judyjackson639 7 місяців тому +5

      As it should be

    • @singleshot1331
      @singleshot1331 7 місяців тому +15

      Well, I never really had trust n them at all

    • @traceyhilton2768
      @traceyhilton2768 7 місяців тому

      Plus NO trust in msm or medical people 🤢

    • @balthiersgirl2658
      @balthiersgirl2658 7 місяців тому +6

      I never had trust in them to begin with

  • @SlackHoffman
    @SlackHoffman 7 місяців тому +38

    Hello Dr John and thanks 🙏 for all that you do 💙🤙….fantastic country Australia 🇦🇺🤙😎

  • @suemcrobertshawirko8505
    @suemcrobertshawirko8505 6 місяців тому +11

    A hell of a lot of good saying sorry does!!!! The damage has been done

  • @geevesnc3008
    @geevesnc3008 7 місяців тому +988

    Why would ANYONE trust the Pharmaceutical Industry. Seriously- wake up.

    • @lorrainewarmington5121
      @lorrainewarmington5121 7 місяців тому +46

      ​@@Dubya-i3vbye bye bot!!!

    • @iainbaker2742
      @iainbaker2742 7 місяців тому +17

      ​@TORY-BLUE prove it, or it never happened........

    • @lisac1619
      @lisac1619 7 місяців тому

      ​@@Dubya-i3vGo get more boosters. You can have my share.

    • @EyesWideOpen...3.16
      @EyesWideOpen...3.16 7 місяців тому

      @@Dubya-i3v What number you on? 8? 9? Yeah they work so well, it’s not a vaccination either, yr a liar 🤥

    • @TheTempleOfBoom
      @TheTempleOfBoom 7 місяців тому +6

      It is mind -boggling.

  • @stephenjones5304
    @stephenjones5304 7 місяців тому +316

    "Two weeks to flatten the population."

    • @ThePantygun
      @ThePantygun 7 місяців тому +2

      Talk of flat earthers...

    • @cynthiarice7438
      @cynthiarice7438 7 місяців тому +11

      Ppl are still taking these damn shots🤬

    • @MsMickey541
      @MsMickey541 7 місяців тому +13

      Isn't that the truth! They flattened it pretty easily with so many voluntarily lining up. I still can't believe how many did without any thought.

    • @bernice4599
      @bernice4599 7 місяців тому +3

      @@cynthiarice7438 😳🙄😬 wow what the f*** is wrong with people???

    • @bernice4599
      @bernice4599 7 місяців тому +3

      @@MsMickey541 I know eh??it’s like they can’t use their own brain to think ummmm something isn’t right here ?! 😬🙄

  • @JennyJames-l9l
    @JennyJames-l9l 7 місяців тому +81

    One of the very few Brits who makes me feel proud to be English. Delicious low key style, a true doctor who can lift your spirits just listening to him! Deeply humorous with a straight face. The world needs more people like you Dr. Campbell. From Jenny James, 5 decades since I headed for the Andean mountains, leaving England in disgust. So glad you exist, a voice of sanity midst the cacophony of lies.

    • @LBStew
      @LBStew 7 місяців тому +6

      He's not a medical doctor

    • @rawgarlic9234
      @rawgarlic9234 7 місяців тому +2

      He was instrumental in the mass poisoning.

    • @carnation_cat
      @carnation_cat 7 місяців тому +8

      ​​@@LBStewNot being a practicing "medical" doctor is an advantage. But his degrees are entirely normal and mainstream. Are you a PhD?

    • @alexanderhowarth6460
      @alexanderhowarth6460 7 місяців тому

      He has an honorary phd for services to nursing​@@carnation_cat. Really not a doctor

    • @danielmeier8321
      @danielmeier8321 7 місяців тому +3

      Speaking as a German, I've actually never met a British person I didn't get along with. They always seemed very well mannered with great humor.

  • @mehdihasan3690
    @mehdihasan3690 4 місяці тому

    Than you Mr Campbell

  • @Loulouchewy
    @Loulouchewy 7 місяців тому +990

    I am deeply sorry I took the Jab. Pfizer should not only be sorry, but they should be in jail.

    • @susanmurray7654
      @susanmurray7654 7 місяців тому +38

      I feel bad for you too. You might escape the consequences though. There are those who do, for sure.

    • @britgal3836
      @britgal3836 7 місяців тому +16

      Me too!

    • @LizzLunney
      @LizzLunney 7 місяців тому +14

      SAME

    • @DesertlizzyThe
      @DesertlizzyThe 7 місяців тому +19

      Yes. Like who's the boss? The CEO CFO Chief in Charge all shd be more than hand slapped. But we know money talks & they will walk.

    • @ruth.greening
      @ruth.greening 7 місяців тому +20

      I am trying to tell you that there is a internet page with protocols. Done by frontF lineL covidC criticalC careC doctors. Keeps getting scrubbed off. Wonder why Dr John Campbell is not talking about it?

  • @b.lloydreese2030
    @b.lloydreese2030 7 місяців тому +42

    They should be brought to justice. My ex wife's life is on their hands. She passed in August of stage 4 cancer, no family history and non hereditary. Figure that one out

    • @21972012145525
      @21972012145525 6 місяців тому

      You don't need family history to get cancer. You didn't even say what kind

  • @richardhumby8704
    @richardhumby8704 7 місяців тому +621

    We are deeply sorry for the mass murder and the 80 billion profit, now can we just draw a line under it and move on!

    • @kathleenking47
      @kathleenking47 7 місяців тому +2

      It didn't effect everyone the same....I'm still wondering what's different
      He's only 60+
      Not too old

    • @lvr5266
      @lvr5266 7 місяців тому +1

      THIS

    • @davisutton1
      @davisutton1 7 місяців тому +13

      @@kathleenking47 Really, saying some intervention isn't universally lethal doesn't make it worth taking.

    • @jpsholland
      @jpsholland 7 місяців тому +6

      actually 600 billion.

    • @outfromtheshadows
      @outfromtheshadows 7 місяців тому +21

      We have yet to see how it affects future generations.

  • @MumMerry
    @MumMerry 6 місяців тому +3

    We need more doctors like you who do their own research 🔬 ❤