Thanks so much. I find this utterly fascinating. Can't wait to give it a try! With my very limited understanding and my rudimentary understanding of the ITS region, I am imagining that, in addition to the steps you shared in the Blast phase, perhaps there is a secondary region that could be tested to narrow down/specify your specimen more precisely. Does this make sense? Does that complexify the process or is there an option for that at the BLAST level?
You are correct that many genera require sequencing two or more loci to speciate with confidence. The process is identical with the exception of the primers used to target the loci and the pcr conditions for the primer set.
LOVE what you're doing with this channel. Keep up the amazing work! I often find a bolete and spend hours trying to identify it only to give up after narrowing it down to a few options. I look forward to using these techniques to confirm/disconfirm my IDs.
so happy I found you!!!!!! I have to sequence a fungi amplicon for the very first time in my life and I am so nervous and excited, your video helped me a lot! All the best wishes for you, thanks again!
That makes me so happy to hear! Please reach out if you need help or have any questions josh @ everymanbio.com and I'll do my best to help you make it happen. You CAN to this! Don't give up.
The F is forward (there are two primers - one forward and one reverse). You’ll need both for barcoding and one or both for sequencing. The sequences are ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4: TCCTCCGCTTATTGATATGC. You can order primers from Genewiz.com or IDTDNA.com.
2 questions please Why the amplification did not work with Aspergillus and yet according to several articles the ITS primers are used for Aspergillus? How to proceed if you have to build a phylogenetic tree linking several fungi?
ITS or the primers aren't an issue with Aspergillus. The DNA extraction buffer here is a blunt tool that doesn't mitigate powerful PCR inhibitors that species like Aspergillus are known to produce. To remedy this, you can wash the cells a few times in sterile water or create a high dilution of the extracted DNA to resolve.
Thank you so much, your tutorial helps me a lot, glad I found this video. May I ask what should I do if I got ITS1 and ITS4 data and do you happen to know the difference?
ITS1 is a forward primer and ITS4 is the reverse. You need both for PCR but you can sequence in either direction or both. If both, you're looking for consensus data. Start with a forward read as it's usually sufficient in most cases.
Very helpful video, thanks so much ! I have a question, if I am submitting multiple samples and they were ran on separate gels, how do I go about submitting the gel images? Do I need to submit as multiple orders? Thanks
If you're using Genewiz, they just need to the gel to estimate the DNA concentration. If you find the concentration (brightness of the band) to be about the same for all samples, just submit one gel image and they'll adapt. You can also edit and combine the image and just throw labels on each lane as it corresponds to the order. Both will work fine.
Is the difficulty of bacterial barcoding much more difficult than this? I am hoping to work my way up into trying to look doing fungal and bacterial barcoding from soil samples for agricultural purposes.
Not difficult at all and arguable slightly easier. You’d use different primers to barcode bacteria but generally, everything else will be the same or similar.
@@everymanbio Cool! I am not sure what primer I would use. But, I can probably find that with some research. I only saw 4 main options in the video menu though. One of the main things I am a little apprehensive about is if there are dozens or hundreds or more distinct varieties of bacteria and fungi in a soil sample how that might cause the cost of testing to kind of skyrocket. Although, maybe I might be able to get a discount on the per-sample rate if I am submitting a bunch at once? Most of the labs I have spent any amount of time in have been physics or chem labs. So, I haven't done any sequencing or anything before. I am in the process of trying to put together a starter lab though. I found a couple videos and people talking about the equipment needed and have been trying to put one together. I have thought about maybe trying to focus on doing Haley soil tests for a bit first. As those can measure biomass roughly for fungi and bacteria. Although, I am still trying to find good papers describing the procedure so I can figure out how to do it and what equipment I will need with that. But, I have an idea for a study that would have results that would be personally useful to me that I haven't found anyone doing something similar in the literature. Focused on the effects of certain crops and agricultural techniques on microbe biomass and potentially composition.
@@jonathanlochridge9462 Yes, for prokaryotes, you'll want to find some universal 16s barcoding primers. There's lots of stuff online that you'll quickly find. My suggestion would be to first establish a working dna barcoding protocol that works in your lab under your conditions before you worry about scaling to dealing with multiple samples. You could easily do this with fungi by buying some button mushrooms from the store and using a small bit of internal tissue as your subject sample. If you get back a good clean sequence that lines up with Agaricus bisporus, then you're in business. Otherwise, when you get to trying to sequence organisms from what I'd call a "dirty" sample, like soil, with lots and lots of species, you need to either use the soil dilution technique and generate lots of isolates and sequence each one individually. Or you can find creative ways to only select for the kinds of organisms you want to isolate by using various kinds of media, creative sample sources, antibiotics, etc. Hope this helps!
@@everymanbio That really does help! I guess I could potentially test procedures aimed more at bacteria by ordering a sample of a non-pathogenic one online and doing a similar test with that to the button mushroom test. So, I might be able to get started with barcoding by simply buying some primers, beakers, TestTubes, Autoclave, cleaning alcohol, and pipettes? I had been thinking I would want to get a mini fridge and freezer specifically for samples pretty early. Although, I might be able to work on calibrating my procedure with really clean samples without them? I could probably keep button mushrooms in my normal fridge fine at least. I am not sure how I would need to store the primers and such. Or if they could just be kept in a cabinet in the shipping container. I have heard that a normal pressure cooker can be used to sterilize. My family already has one of those. How long do you think it would be a good idea to use that before upgrading to a proper autoclave? My instinct would maybe be about the time I start working with dirtier samples would be when an upgrade would be warranted. But the cost of an autoclave looks like it is probably going to be the largest short term cost I will need for my lab. Part of me wonders if trying to do a general 16s primer or having multiple specialized primers for each major domain/kingdom I want to test for. That would be at least 2 primers. Although, it might also be possible to try to sequence nematodes or some other microscopic multi-cellular life. As I have been reading more I have also been consisering a little bit about whether trying to use an OTP or ASV approach to barcoding is likely to give better results. Do you have an opinion on that? One less related question I have is: What is your opinion on using microscopy as a method of analysis for microbes? From my research, microscopy-based taxonomy for them doesn't seem to line up very well with genetic analysis. As many microbes that appear similar may not be that related or vise-versa. Although, presumably it might be usable for getting an idea of things like Fungal to Bacterial Ratios in a sample. I do have some curiosity about soil viruses at well. But, I am kind of a little afraid of even trying to touch them much. Although, presumably there should be viruses adapted to hijacking bacteria and other microscopic life rather than attacking animals. That is lower priority. But based on the calls for papers I have been seeing the role of viruses in soil ecology is an area where we have a very large knowledge gap. We don't even know if they have a significant direct or indirect effect on soil biomass. That also leads me to more generally think about fungi and viruses. Are their viruses that specifically attack fungi? Are they common? etc? Thanks for your reply!
@@jonathanlochridge9462 You're asking all the right questions (and more than I can answer here at this time). Don't give up and keep researching. At some point, you should just get started with some part of the process so you aren't mired into the trap of analysis paralysis and having everything figured out beforehand. I'm still learning myself and improving my own techniques every day.
I assume that in ITS1-F, the F stands for fungi-specific? Do you have the sequence for that primer? Do you order the primers from the sequencing service? Thank you!
The F is forward (there are two primers - one forward and one reverse). You’ll need both for barcoding and one or both for sequencing. The sequences are ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4: TCCTCCGCTTATTGATATGC. You can order primers from Genewiz.com or IDTDNA.com.
@@everymanbio Hello, it appears that F indeed stand for "fungi", ITS1F is a fungi-specific region in front (5' end) of the conventional ITS1 primer. There is also a ITSB primer, specifically for basidiomycetes. We learn everyday :-)
@@Quercus2024 The formal primer name is ITS1 (there is also ITS2, ITS4 and others). The F is used interchangeably in scientific publications, depending on the context, to denote Forward (for forward pimer) or Fungi. It can be confusing for newcomers.
I'm not sure which particular insertion or modification you are referring to, but very often, there are ambiguous or incorrect base calls that you can see in the raw chromatogram data that warrant modification or adjustment.
You have absolutely no idea how happy i am that I found your channel
Thanks so much. I find this utterly fascinating. Can't wait to give it a try!
With my very limited understanding and my rudimentary understanding of the ITS region, I am imagining that, in addition to the steps you shared in the Blast phase, perhaps there is a secondary region that could be tested to narrow down/specify your specimen more precisely. Does this make sense? Does that complexify the process or is there an option for that at the BLAST level?
You are correct that many genera require sequencing two or more loci to speciate with confidence. The process is identical with the exception of the primers used to target the loci and the pcr conditions for the primer set.
This is -by far- the best video I have seen on fungal DNA barcoding. Thank you.
Awesome. Thank you! 🙏🏼
LOVE what you're doing with this channel. Keep up the amazing work! I often find a bolete and spend hours trying to identify it only to give up after narrowing it down to a few options. I look forward to using these techniques to confirm/disconfirm my IDs.
so happy I found you!!!!!! I have to sequence a fungi amplicon for the very first time in my life and I am so nervous and excited, your video helped me a lot! All the best wishes for you, thanks again!
That makes me so happy to hear! Please reach out if you need help or have any questions josh @ everymanbio.com and I'll do my best to help you make it happen. You CAN to this! Don't give up.
This was so helpful, ty!
Appreciate you and your work! 🙌
Thank you for this video! This is really helpful :)
Thks u so much
Thank you for your tutorial. May I ask, what kind primer do you use? Is it universal primer? Thank you
I use primarily these fungi barcoding primers: ITS1 (forward) and ITS4 (reverse)
Great video, very helpful! Would you mind sharing where you get your forward and reverse primers? Thanks
The F is forward (there are two primers - one forward and one reverse). You’ll need both for barcoding and one or both for sequencing. The sequences are ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4: TCCTCCGCTTATTGATATGC. You can order primers from Genewiz.com or IDTDNA.com.
2 questions please
Why the amplification did not work with Aspergillus and yet according to several articles the ITS primers are used for Aspergillus?
How to proceed if you have to build a phylogenetic tree linking several fungi?
ITS or the primers aren't an issue with Aspergillus. The DNA extraction buffer here is a blunt tool that doesn't mitigate powerful PCR inhibitors that species like Aspergillus are known to produce. To remedy this, you can wash the cells a few times in sterile water or create a high dilution of the extracted DNA to resolve.
Thank you so much, your tutorial helps me a lot, glad I found this video. May I ask what should I do if I got ITS1 and ITS4 data and do you happen to know the difference?
ITS1 is a forward primer and ITS4 is the reverse. You need both for PCR but you can sequence in either direction or both. If both, you're looking for consensus data. Start with a forward read as it's usually sufficient in most cases.
Very helpful video, thanks so much ! I have a question, if I am submitting multiple samples and they were ran on separate gels, how do I go about submitting the gel images? Do I need to submit as multiple orders? Thanks
If you're using Genewiz, they just need to the gel to estimate the DNA concentration. If you find the concentration (brightness of the band) to be about the same for all samples, just submit one gel image and they'll adapt. You can also edit and combine the image and just throw labels on each lane as it corresponds to the order. Both will work fine.
Please can I know what is the RPB2 sequence use for Aspergillus identification?
Is the difficulty of bacterial barcoding much more difficult than this?
I am hoping to work my way up into trying to look doing fungal and bacterial barcoding from soil samples for agricultural purposes.
Not difficult at all and arguable slightly easier. You’d use different primers to barcode bacteria but generally, everything else will be the same or similar.
@@everymanbio Cool! I am not sure what primer I would use. But, I can probably find that with some research. I only saw 4 main options in the video menu though.
One of the main things I am a little apprehensive about is if there are dozens or hundreds or more distinct varieties of bacteria and fungi in a soil sample how that might cause the cost of testing to kind of skyrocket. Although, maybe I might be able to get a discount on the per-sample rate if I am submitting a bunch at once?
Most of the labs I have spent any amount of time in have been physics or chem labs. So, I haven't done any sequencing or anything before.
I am in the process of trying to put together a starter lab though. I found a couple videos and people talking about the equipment needed and have been trying to put one together.
I have thought about maybe trying to focus on doing Haley soil tests for a bit first. As those can measure biomass roughly for fungi and bacteria. Although, I am still trying to find good papers describing the procedure so I can figure out how to do it and what equipment I will need with that.
But, I have an idea for a study that would have results that would be personally useful to me that I haven't found anyone doing something similar in the literature. Focused on the effects of certain crops and agricultural techniques on microbe biomass and potentially composition.
@@jonathanlochridge9462 Yes, for prokaryotes, you'll want to find some universal 16s barcoding primers. There's lots of stuff online that you'll quickly find. My suggestion would be to first establish a working dna barcoding protocol that works in your lab under your conditions before you worry about scaling to dealing with multiple samples. You could easily do this with fungi by buying some button mushrooms from the store and using a small bit of internal tissue as your subject sample. If you get back a good clean sequence that lines up with Agaricus bisporus, then you're in business. Otherwise, when you get to trying to sequence organisms from what I'd call a "dirty" sample, like soil, with lots and lots of species, you need to either use the soil dilution technique and generate lots of isolates and sequence each one individually. Or you can find creative ways to only select for the kinds of organisms you want to isolate by using various kinds of media, creative sample sources, antibiotics, etc. Hope this helps!
@@everymanbio That really does help!
I guess I could potentially test procedures aimed more at bacteria by ordering a sample of a non-pathogenic one online and doing a similar test with that to the button mushroom test.
So, I might be able to get started with barcoding by simply buying some primers, beakers, TestTubes, Autoclave, cleaning alcohol, and pipettes?
I had been thinking I would want to get a mini fridge and freezer specifically for samples pretty early. Although, I might be able to work on calibrating my procedure with really clean samples without them? I could probably keep button mushrooms in my normal fridge fine at least.
I am not sure how I would need to store the primers and such. Or if they could just be kept in a cabinet in the shipping container.
I have heard that a normal pressure cooker can be used to sterilize. My family already has one of those. How long do you think it would be a good idea to use that before upgrading to a proper autoclave? My instinct would maybe be about the time I start working with dirtier samples would be when an upgrade would be warranted. But the cost of an autoclave looks like it is probably going to be the largest short term cost I will need for my lab.
Part of me wonders if trying to do a general 16s primer or having multiple specialized primers for each major domain/kingdom I want to test for.
That would be at least 2 primers. Although, it might also be possible to try to sequence nematodes or some other microscopic multi-cellular life.
As I have been reading more I have also been consisering a little bit about whether trying to use an OTP or ASV approach to barcoding is likely to give better results. Do you have an opinion on that?
One less related question I have is: What is your opinion on using microscopy as a method of analysis for microbes? From my research, microscopy-based taxonomy for them doesn't seem to line up very well with genetic analysis. As many microbes that appear similar may not be that related or vise-versa. Although, presumably it might be usable for getting an idea of things like Fungal to Bacterial Ratios in a sample.
I do have some curiosity about soil viruses at well. But, I am kind of a little afraid of even trying to touch them much. Although, presumably there should be viruses adapted to hijacking bacteria and other microscopic life rather than attacking animals.
That is lower priority. But based on the calls for papers I have been seeing the role of viruses in soil ecology is an area where we have a very large knowledge gap.
We don't even know if they have a significant direct or indirect effect on soil biomass.
That also leads me to more generally think about fungi and viruses. Are their viruses that specifically attack fungi? Are they common? etc?
Thanks for your reply!
@@jonathanlochridge9462 You're asking all the right questions (and more than I can answer here at this time). Don't give up and keep researching. At some point, you should just get started with some part of the process so you aren't mired into the trap of analysis paralysis and having everything figured out beforehand. I'm still learning myself and improving my own techniques every day.
I assume that in ITS1-F, the F stands for fungi-specific?
Do you have the sequence for that primer?
Do you order the primers from the sequencing service?
Thank you!
The F is forward (there are two primers - one forward and one reverse). You’ll need both for barcoding and one or both for sequencing. The sequences are ITS1F: CTTGGTCATTTAGAGGAAGTAA and ITS4: TCCTCCGCTTATTGATATGC. You can order primers from Genewiz.com or IDTDNA.com.
@@everymanbio Thank you!
@@everymanbio Hello, it appears that F indeed stand for "fungi", ITS1F is a fungi-specific region in front (5' end) of the conventional ITS1 primer. There is also a ITSB primer, specifically for basidiomycetes.
We learn everyday :-)
@@Quercus2024 The formal primer name is ITS1 (there is also ITS2, ITS4 and others). The F is used interchangeably in scientific publications, depending on the context, to denote Forward (for forward pimer) or Fungi. It can be confusing for newcomers.
@@everymanbio That would be really confusing indeed, and not only for newcomers. And not very scientific.
Nice one. Is this the crude pcr product or did you purify it?
The pcr product must be cleaned-up before sequencing.
why did you type "a" in the sequencing and reblast?
I'm not sure which particular insertion or modification you are referring to, but very often, there are ambiguous or incorrect base calls that you can see in the raw chromatogram data that warrant modification or adjustment.