What is Genomics - Full Length

Поділитися
Вставка
  • Опубліковано 31 гру 2024

КОМЕНТАРІ • 50

  • @kennylong7281
    @kennylong7281 2 роки тому +3

    We humans have been practicing science for hundreds of years. Thousands of beneficial technologies have changed the way we live. Unfortunately, too few scientific pursuits have lead directly to improving the human metabolism. We are all subject to hundreds of ailments, diseases, and metabolic defects. With the science of Genomics, we now have the chance to greatly improve upon human biology, help to prevent dozens of deadly diseases, and the relieve the suffering of millions.

  • @maximumquake1
    @maximumquake1 7 років тому +26

    I still have no idea what genomics is.....

    • @DavidWu-i3b
      @DavidWu-i3b 10 місяців тому

      1:31

    • @Nate3145-zt8rh
      @Nate3145-zt8rh 5 місяців тому

      Lol. No one does, if we did we would live in a utopia(maybe)

  • @WTFbrownie
    @WTFbrownie 12 років тому +8

    It is the same thing as computer programming/packet sniffing. In computing, you have a byte, which is consisted of 8 bits. Each bytes can be a letter like "A" or "Z". Same method applies in genes. A gene contains a code for a protein or a unknown code consisted of codes of ACTG. Compile that code and then you have a scripture how the human/animal/plant i built. Same with computers, compile your binary code and you have a program.

    • @fadimalouf9876
      @fadimalouf9876 6 років тому

      Good point...

    • @swarnavasamanta2628
      @swarnavasamanta2628 Рік тому

      That is exactly why DNA codification so massively complex, far more than computers. Computers only act on 0 and 1, binary coding. But DNA is of 4 building blocks, so it carries more dense information and also more complex.

  • @shiweanyswami7371
    @shiweanyswami7371 Рік тому

    Thank you!

  • @AltafHussain-rr3yg
    @AltafHussain-rr3yg 4 роки тому +2

    Hello could you please tell me which software do you use for these animations

  • @smackalligator
    @smackalligator 3 роки тому +1

    found this very useful. thanks

  • @GarryRose-m7f
    @GarryRose-m7f Рік тому

    can someone provide the proper citation for this video APA 7 format?

  • @fadimalouf9876
    @fadimalouf9876 6 років тому +1

    Great illustration of Genomics. Thanks!

  • @rhysman0001
    @rhysman0001 11 років тому

    is there any websites that show you the human genome?
    plz tell me if there are.

  • @toshikitaya2029
    @toshikitaya2029 8 років тому +1

    I think there might be a grammatical mistake about 1:28, "the cell that houses it TWO factors outside..." shouldn't it be "to" instead of "two"?

  • @MeanMachineRex
    @MeanMachineRex 13 років тому +1

    Hi there, I think there's a mistake on the visual of two copies of genes in the copy number variation section. The two copies should be on the chromosome and its pair not on the same chromosome.

  • @sawairagul251
    @sawairagul251 3 роки тому +1

    Well explained 🥰💜🥰💃

  • @MrWalo1990
    @MrWalo1990 4 роки тому +5

    Here, after the Ark Invest results in 2020 from Genomics funds.

  • @chrisfranz
    @chrisfranz 11 років тому +8

    GATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAATAGTGTCCTATACTTGTATATGTATCTATAGATCGAAACTGACTGTTACTGATGCAGTCACTGACTGACTATGACTACTCTACCTGAATTGCTGTACCTAGGGTACCTCAGTTTCCGAAATAGATAAC i ran out of room...

    • @devononiel
      @devononiel 4 роки тому +1

      OMG you know me so well!

  • @broytingaravsol
    @broytingaravsol 7 років тому

    even for the surfacial curvature of bodies?

  • @mohanagrawal2378
    @mohanagrawal2378 10 років тому +1

    very useful to me..

  • @s1zzel
    @s1zzel 14 років тому

    Very nice! THX

  • @evanstafford55
    @evanstafford55 11 років тому +1

    I'd love to see an actual human genome mapping.

  • @Hshsuiiien
    @Hshsuiiien 14 років тому

    very nice, thanks!

  • @Trent-tr2nx
    @Trent-tr2nx 9 років тому +1

    It's pretty cool that in 2015 we live in a world in which you can get your DNA sequenced for $99 instead of the $1000 it estimated in the video. Amazing!

    • @KoreyKruse
      @KoreyKruse 9 років тому +8

      +Trent Dye DNA cannot be sequenced for $99. There are genetic tests by 23andme.com that provide very limited tests of only certain genes for $199. Whole genotype sequencing is still well over $1000.

  • @Dinocrap1101
    @Dinocrap1101 13 років тому

    cool vid

  • @theyang209
    @theyang209 4 роки тому +5

    Who’s here because of BNGO?

    • @novaicapital
      @novaicapital 4 роки тому

      Me don't worry it's going to the moon If you invest more than $100 in BNGO you well see you wil be rich in 2-3 years

    • @LC2460
      @LC2460 3 роки тому

      Me

  • @j1der698
    @j1der698 4 роки тому

    1:44 3D illusion

  • @augurelite
    @augurelite 13 років тому +4

    I wanna be a genomist

    • @chapterchatter
      @chapterchatter 4 роки тому +7

      It’s been 9 years. How’s that going?

    • @augurelite
      @augurelite 4 роки тому +8

      @@chapterchatter HAHA now I'm an aerospace engineer :3

    • @chapterchatter
      @chapterchatter 4 роки тому +2

      @@augurelite wow, very impressive :) Thanks for the reply

    • @peepdi
      @peepdi 3 роки тому

      @@augurelite OMG great.

    • @Juliana-rw6pt
      @Juliana-rw6pt 2 роки тому

      whyd u decide to be an aerospace engineer instead?

  • @muhammadsaleemfazal7765
    @muhammadsaleemfazal7765 7 років тому

    nice

  • @seanhunsicker
    @seanhunsicker 3 роки тому

    Anyone here to find out what arkg is about

  • @THX1146
    @THX1146 12 років тому

    I wonder if they thought of making genomic changes with a vaccine. Ask your doctor to read the insert that comes with the bottle.Ask him him if he cares.

  • @tahirashakeel327
    @tahirashakeel327 2 роки тому

    🐢🐳🐳🐳🐚🐚

  • @christophermartin972
    @christophermartin972 3 роки тому

    The guy who made my lawn Gnome is a Gnomist

  • @anilkumarsharma1205
    @anilkumarsharma1205 5 років тому

    put the genome mixing with coconut genome mixing with pumpkin genome mixing with water melon genome mixing with melons genome mixing with mustard oil plants mustard seeds genome mixing with oil production plants genome mixing with rubber plants genome mixing with coconut genome mixing with plum genome mixing with pumpkin genome mixing so we got more edibles and complex compound for fractional distillations and patrol solution become easy forever

  • @RozyRoPink150
    @RozyRoPink150 6 років тому

    okaaaaaaayyy?? I learned nothing from this