🚀 Bullish Signals & New Golden Cross! 💰📈

Поділитися
Вставка
  • Опубліковано 16 вер 2024

КОМЕНТАРІ • 239

  • @andersonw2253
    @andersonw2253 5 днів тому +58

    So much information to sift through and you continually bring the best content. Full Stop!

  • @user-gw3ll4lo5e
    @user-gw3ll4lo5e 5 днів тому +81

    Rule 1. Never hold cash - melting ice cube. Cash is trash.
    Rule 2. ALWAYS have a large pile of cash available to buy dips.
    Rule 3. When it dips, Go in hard i.e. use all available cash.
    Rule 4. ALWAYS have a large pile of cash stashed away.
    Rule 5. NEVER hold cash. It’s a melting ice cube.

    • @dustinmccrindle343
      @dustinmccrindle343 5 днів тому +15

      So. Basically, be government so you can simply print more cash! 🤑🤑🤑
      😜🤣😜🤣

    • @kbwinter
      @kbwinter 5 днів тому +12

      Lost me…never hold cash…always have a large stash of cash on hand…make up your mind….😂

    • @user-gw3ll4lo5e
      @user-gw3ll4lo5e 5 днів тому +6

      @@kbwinter LOL yeah he lost me too! 😂 I guess just be rich AF so you can continue to add plenty more to your bags when it dips, then even more when it dips again, then EVEN MORE when it dumps after that, but at the same time all those hundreds of thousands of dollars you just spent is only a tiny percentage of your wealth so the debasement of currency on it doesn’t make a whole lot of difference. So easy when you’re loaded right 😂😂

    • @kammi2590
      @kammi2590 5 днів тому +3

      How could you not hold cash in the same time then have a lot of cash to buy the dips?

    • @kolbenstvedt
      @kolbenstvedt 5 днів тому +1

      😂😂😂

  • @adrianstokes6507
    @adrianstokes6507 5 днів тому +4

    With the UK introducing a law to classify crypto as property. My worry is that they will start to tax it at the same level as bricks and mortar properties which is a much higher level of capital gains tax. I think that’s what this law might be about.😢

  • @AndrewEklund
    @AndrewEklund 5 днів тому +35

    Let's be careful in saying that "Bitcoin didn't like the debate." Bitcoin doesn't care. Partisan holders didn't like the debate.

    • @InvestAnswers
      @InvestAnswers  5 днів тому +8

      solid pt

    • @zLance7
      @zLance7 5 днів тому +7

      I agree with this point 100%. If the current govt was so bad howcome btc didn't care in hitting ATH

    • @Anytimeanywhere444
      @Anytimeanywhere444 2 дні тому +1

      @@zLance7exactly….. literally case and point.

  • @brads.9986
    @brads.9986 5 днів тому +18

    I would love to be "running out of money" at the rate of buying 88 bitcoin a day. 😅😊

  • @alantan5894
    @alantan5894 5 днів тому +10

    88 sounds is a lucky number for the Chinese. Maybe some rich Hong Kong billionaire is buying up BTC!

    • @gwynedd1
      @gwynedd1 5 днів тому

      Its Hitlerian . 88 is code for hh, and BTC is full of dark and nefarious elements.

  • @Rwj378
    @Rwj378 5 днів тому +8

    Day after day you provide fresh new, and important content. It’s really impressive. Thank you.

  • @fat_whacker2598
    @fat_whacker2598 5 днів тому +13

    Mid six figures is 500k. It's the midpoint between five and seven figures.

    • @airjunkieadam
      @airjunkieadam 5 днів тому

      Yeah he sandbagged that pretty hard

    • @wicksleysnipes1476
      @wicksleysnipes1476 5 днів тому +1

      Oh, you’re one of those.

    • @sil8ty01
      @sil8ty01 5 днів тому

      Well there are 9 stages that fall within 6 figures so it can also be the midway point of any of those stages. Eg 100k to 200k mid is 150. Pretty simple concept to comprehend. 👍🏼

    • @palebluedot747
      @palebluedot747 5 днів тому

      500k as per Plan B projection into 2025

    • @bucktownxxx
      @bucktownxxx 5 днів тому +1

      mid 2000s means year 2005, not year 2500.....

  • @ThePostmillennial
    @ThePostmillennial 5 днів тому +5

    Yesterdays movie “Orgy of Debt” followed up with “More Hash” today. 🤙👏

  • @audioeye2803
    @audioeye2803 5 днів тому +9

    You are too awesome sir!
    Thank you James

  • @GhanendraMishra-mx9fn
    @GhanendraMishra-mx9fn 5 днів тому +97

    wohooo we went down 30% and up 2%. Party time!!

    • @paddyanglais91
      @paddyanglais91 5 днів тому +8

      😅

    • @Sol_Bull
      @Sol_Bull 5 днів тому +29

      Volatility is our friend.

    • @builtforbattlemmasports7770
      @builtforbattlemmasports7770 5 днів тому +16

      Right. I'm over it. We were supposed to double in 18 days like 120 days ago lmao

    • @LK5860
      @LK5860 5 днів тому +3

      Back the truck up!

    • @Chris-cz6hn
      @Chris-cz6hn 5 днів тому +22

      I love the bearish comments it’s what tells me the bottom is nearly in nothing goes up until weak hands give up

  • @Charlie-phlezk
    @Charlie-phlezk 5 днів тому +6

    Buy the dip!

    • @D9Wx
      @D9Wx 5 днів тому

      Dip it raw

  • @Robbo_547
    @Robbo_547 5 днів тому +5

    LOVE IT AS ALWAYS JAMES!
    Re Mr 100 : 1988 was a big year for Dell. They went public with the IPO and was the year they changed their name from PCs Ltd to Dell Computer Corporation
    So these 88 BTC buys could be a little signal ;)

  • @MJLGEE
    @MJLGEE 5 днів тому +5

    Thank you James! Great as always!

  • @user-dixk2rx5gz8f
    @user-dixk2rx5gz8f 5 днів тому +5

    Thank you for your much needed optimism!

  • @TheContrarianThinker
    @TheContrarianThinker 5 днів тому +3

    *Do* Blackrock's clients _own_ the BTC, held in trust, James? Or, if push comes to shove, in a failing economy, would they release said BTC to the clients; or take it for themselves? I know where my bet lies.
    That's why *_I_* self-custody!

  • @sarahdrew1588
    @sarahdrew1588 5 днів тому

    The only team I trust for not financial advice. Thx guys n gals

  • @tonyward1932
    @tonyward1932 5 днів тому +3

    Thanks for all you do, James. I have been listening and following you since 2021.

  • @azualbet3805
    @azualbet3805 5 днів тому +2

    Need financial advise 😂 got 3k to spend right now. Put it on TSLA or MSTR?

    • @siddg1463
      @siddg1463 5 днів тому +3

      MSTR for next 16 months then TSLA. -Not financial advice 😊

    • @pmg2120
      @pmg2120 5 днів тому +1

      That’s a great question.
      I just recently sold all of my TSLA and and bought MSTR at $116 I plan to ride it up and go all in on TSLA That should be the right move but I’d be lying if I said I know it for sure.

  • @CoinOperated.
    @CoinOperated. 5 днів тому +1

    Smash that like button everyone! Let's show James some love for all his hard work and consistency for years now! 🎉🎉❤❤

  • @chlovado
    @chlovado 5 днів тому +1

    Looking at the Global Liquidity chart track to Bitcoin price makes me wonder since there is a Diminishing Supply and Accelerated demand because of the ETFs if we are on track for multi year Bitcoin Super Cycle?

  • @kammi2590
    @kammi2590 5 днів тому +2

    Thanks. I love how You bring postive news for me. I am so tired of others youtube video sells groom and doom. They have not found btc yet.

  • @StressFreeVIP
    @StressFreeVIP 5 днів тому

    You said: 'appreciate you all'.
    I say: 'you appreciate also our investment results' 😊😂

  • @nigel904
    @nigel904 5 днів тому +1

    Yes please re the Tesla video James 👍

  • @quiztopics7395
    @quiztopics7395 5 днів тому +1

    Mr100 is an Upbit wallet. The activity is the exchange.

  • @LK5860
    @LK5860 5 днів тому +1

    Every time a golden cross appears "an angel gets is wings!"

    • @Robert-jd6xc
      @Robert-jd6xc 5 днів тому +1

      Fun trivia . . .
      Angles don't have wings.
      If you're a Christian, you won't find any passage in the Bible that indicates angles have wings.

  • @Life_with_Darnell
    @Life_with_Darnell 5 днів тому +1

    Can the national debt be tokenized on the blockchain? 😅

  • @mykormaximus
    @mykormaximus 5 днів тому +1

    Cheers my friend.

  • @terrymoose7273
    @terrymoose7273 5 днів тому +4

    I'm not saying we are going to 180k but we are going to 180k.

  • @markweston3345
    @markweston3345 5 днів тому +1

    James, I gave up coffee also. Went two weeks cold turkey, no caffeine and now introduced black tea, way better, less anxiety.

  • @joshscott4229
    @joshscott4229 5 днів тому +1

    Tesla. 👍👍👍👍 interested.

  • @sungoddogg
    @sungoddogg 5 днів тому +2

    Ease up on coffee, drink tea? Hahaha. Tea has caffeine too 😂😂😂
    But yea. I understand. I drink a jug of coffee a day! That cant be good. But coffee rocks 😅🤪🤪🤪

  • @Itsallmeagain
    @Itsallmeagain 5 днів тому +1

    For mister 100 (88), what currency lost value lately vs USD… maybe they are still doing the same amount, just in a different currency…

  • @kungfu5646
    @kungfu5646 5 днів тому

    Well done 👍 about the coffee. ☕️ messes with adrenals and you were peaking HARD with some videos 😂😂

  • @Maffmatix
    @Maffmatix 5 днів тому +1

    Why quit coffee completely if you can have just one?

  • @Martin-jk2ng
    @Martin-jk2ng 5 днів тому

    Knoxville is near me, we have the TVA which was probably a big factor in CleanSpark choosing the area.

  • @pkgman8822
    @pkgman8822 5 днів тому

    I just switched my 90 year old mom to green tea from coffee trying to decrease the amount of bathroom breaks.

  • @frankdegroot629
    @frankdegroot629 5 днів тому +4

    again btc top 80 K

  • @zLance7
    @zLance7 5 днів тому

    I agree, 50 bp signals trouble.

  • @kungfu5646
    @kungfu5646 5 днів тому

    Well done 👍 about the coffee. ☕️ messes with adrenals and you were peaking HARD with some videos

  • @aijcr
    @aijcr 5 днів тому +3

    Imagine if Mr 100 is Warren Buffett lol

    • @kbwinter
      @kbwinter 5 днів тому +1

      Or peter schiff😂

    • @InvestAnswers
      @InvestAnswers  5 днів тому +4

      Schiff is poor - he took all his gold commissions from selling gold and invested in emerging market stocks, and they have completely underperformed the last decade. The guy does not know how to handle money.

    • @allthingsconsidered7111
      @allthingsconsidered7111 5 днів тому

      Peter Schiff?

    • @D9Wx
      @D9Wx 5 днів тому

      ​@@InvestAnswersdo you have more money than Schiff? Im curious. How wealthy are you really. Who is this guy... Agent Bit07?

  • @IamT26
    @IamT26 5 днів тому

    Thank for the update! Can you do a miner update soon!

  • @SilentGrower
    @SilentGrower 5 днів тому +2

    Thank you, amazing as always!

  • @thegrumpyscotsman1986
    @thegrumpyscotsman1986 3 дні тому

    Its painful living in the uk. I literally double check every tweet before I send it.

  • @littlebitmckee8234
    @littlebitmckee8234 5 днів тому +14

    Do you know that Kamala Harris’s commercial immediately procedure video? My finger can’t get to the skip button fast enough.

    • @gwynedd1
      @gwynedd1 5 днів тому

      vivisection without anesthesia?

  • @sylversyrfer6894
    @sylversyrfer6894 5 днів тому +2

    You are the best James!! Thank you so much for all the hard work you do everyday for the community! You are so VERY much appreciated!!! ❤

  • @elizabethchavez56
    @elizabethchavez56 5 днів тому

    Thank you somuch Jam s and team❤

  • @danielmohr8796
    @danielmohr8796 5 днів тому +9

    You are a trusted and solid source

  • @1Bob4All
    @1Bob4All 5 днів тому +1

    Did you buy more BTC when the price was down 30%?

  • @kennycarneal6765
    @kennycarneal6765 5 днів тому

    Oak Ridge is right down the road from Knoxville, I was there last week, and I was in Secret City on the fourth, where the families involved in operation paperclip lived.
    We stayed with some old hippy friends of ours and they have a pool from the thirties and they put sand around it. It's the only nice beach Oak Ridge. 😅 It's also rumored that the US government has an underground city around there.

  • @1HundredP
    @1HundredP 5 днів тому

    Much appreciated James and IA team!

  • @showbags7
    @showbags7 5 днів тому +5

    Cheers Jimbo, appreciate the IA troop and the quality of the content.

  • @nickfahey6862
    @nickfahey6862 4 дні тому

    Would love you to do an interview on the 18.6 year land cycle. It says major recession like 2008 coming around 2026. Thoughts?

  • @agtatrade
    @agtatrade 5 днів тому

    EKTA/USDT bag it now! Cheers!

  • @tiwowo1234
    @tiwowo1234 5 днів тому +4

    WHAT A LIAR LIAR

  • @s.thomas5220
    @s.thomas5220 5 днів тому

    Why give up coffee?!?! Don’t do it!!

  • @Luke-xt8dg
    @Luke-xt8dg 5 днів тому

    Thank you very much James!! Still watching 🎉

  • @konstantinoszir8223
    @konstantinoszir8223 5 днів тому

    Many greetings from Greece ♥️

  • @brandonthielman6395
    @brandonthielman6395 5 днів тому

    We are so FKn back 🚨🚨🚨

  • @jessewilson1622
    @jessewilson1622 5 днів тому

    Bitcoin races down and limps up xo

  • @rodrigofiuza2540
    @rodrigofiuza2540 5 днів тому +1

    V-shape recovery. Down 30% and up 5% lol

  • @thecollectivecoop6654
    @thecollectivecoop6654 5 днів тому

    Love your work James
    Any news on the Tether investigation into market manipulation they are accused of ??

  • @josephscott1952
    @josephscott1952 5 днів тому

    Good insights James👍

  • @averybaker1185
    @averybaker1185 5 днів тому

    Shout out to my hometown of Knoxville, TN for finally doing something promising 😂.

  • @Michael.James6
    @Michael.James6 5 днів тому

    Thank You James and Crew..

  • @blisshurom7527
    @blisshurom7527 5 днів тому

    Thanks for sharing your unparalleled perspectives, James !😇

  • @chaprahu
    @chaprahu 5 днів тому

    I think Mr 100 means he/she expects BITCOIN to go to 100 K and when he/she started buying , it might be now between 88K to 100 K. Just a thought :-)

  • @catcatcatcatcatcatcatcatcat1
    @catcatcatcatcatcatcatcatcat1 5 днів тому +1

    Good Times, thanks James, you the best ❤️

  • @peacebypeace1900
    @peacebypeace1900 5 днів тому

    Thank you James!!

  • @jeffreysmith6161
    @jeffreysmith6161 3 дні тому

    When the markets reacts to silly numbers, it feels like it’s often algorithm based trades done by hedge funds and institutions

  • @dogefromthefuture
    @dogefromthefuture 5 днів тому +1

    9:30 - when you zoom in it looks like Bitcoin didnt like the debate performance, but when you zoom out, it's like 1% LOL
    Not a very accurate portrayal of reality in my opninon!

  • @Nobody-pe2jj
    @Nobody-pe2jj 5 днів тому

    Millionaires are not really leaving. Just "relocating" for tax time.

  • @patrickleclaire6404
    @patrickleclaire6404 5 днів тому

    Time to lose that caffeine cough James.

  • @MatMoss1689
    @MatMoss1689 5 днів тому

    Thank you!

  • @wustachemax
    @wustachemax 5 днів тому

    Nobody's gonna talk about the Indonesian exchange hack yesterday huh.

  • @benwelsh9293
    @benwelsh9293 5 днів тому

    Great episode james

  • @trevedmunds
    @trevedmunds 5 днів тому

    LOVE your work

  • @jerrysmith7762
    @jerrysmith7762 5 днів тому +2

    🎉

  • @cryptononymos3163
    @cryptononymos3163 5 днів тому

    Will Hedgefunds short BTC to H..... at some time ? I worry !

  • @johnqlunchbucket
    @johnqlunchbucket 5 днів тому +2

    👍

  • @bitcoinpoemspro1406
    @bitcoinpoemspro1406 5 днів тому

    Thx James

  • @GreatScottTheGamer
    @GreatScottTheGamer 5 днів тому

    They shut off 12% of their miners for some reason.

  • @leeleelee0054
    @leeleelee0054 5 днів тому

    BTFD, HODL

  • @jontsa8752
    @jontsa8752 5 днів тому

    Just watched a sensible yet depressing analysis yesterday of an incoming mild bullmarket this cycle because there are not enough money printing yet and high rates doesn't help either... We need a real crisis for the system like covid and then the money printers can make crypto great again!

  • @mobs3576
    @mobs3576 5 днів тому

    Great show, thank you so much James!❤

  • @jonnyharvell7591
    @jonnyharvell7591 5 днів тому +3

    Did you sell Cleanspark ?

    • @InvestAnswers
      @InvestAnswers  5 днів тому +3

      i bought more

    • @LK5860
      @LK5860 5 днів тому +2

      No, may add more If I see a trend..

    • @D9Wx
      @D9Wx 5 днів тому +1

      ​@@InvestAnswersme too 😁 9,59 and 8,18. I got a bit hastey early drop.

  • @soltrain9332
    @soltrain9332 5 днів тому +3

    Thanks James

  • @europana7
    @europana7 5 днів тому

    Corporate greed prob has more impact on prices than oil

  • @slipslider9048
    @slipslider9048 5 днів тому

    Why would I buy BTC at $60k when I could have bought the last bear market at $20k?

    • @Sean-fj9pn
      @Sean-fj9pn 5 днів тому

      Because you earned more money between now and then?

    • @slipslider9048
      @slipslider9048 5 днів тому

      @@Sean-fj9pn , well yeah. I bought Solana at $10.

    • @pmg2120
      @pmg2120 5 днів тому

      If it’s going up who cares.

  • @lefthandedscrewdriver3954
    @lefthandedscrewdriver3954 5 днів тому

    👌 Excellent

  • @cjkohrs
    @cjkohrs 5 днів тому +7

    Another outstanding video…..not surprised.

  • @cosmothewonderdog8602
    @cosmothewonderdog8602 5 днів тому

    Trump doesn’t care about crypto. He just cares about crypto bro money. 😂

  • @IngenuityThroughPhilosophy
    @IngenuityThroughPhilosophy 5 днів тому

    Who is Satoshi Nakamoto? I believe he is a ZEN BUDDHIST monk and he would not believe in gambling on the blockchain!

  • @builtforbattlemmasports7770
    @builtforbattlemmasports7770 5 днів тому

    So we ever gonna double or was that click bait?

  • @hawksbystv
    @hawksbystv 5 днів тому

    Legend

  • @modela6301
    @modela6301 5 днів тому

    love it!!!

  • @JayManuel-b2l
    @JayManuel-b2l 5 днів тому

    I love u james ❤

  • @vincentiengo4470
    @vincentiengo4470 5 днів тому

    Free AI ! adopt web5, no crypto no vote!

  • @gabrielalfoad9222
    @gabrielalfoad9222 5 днів тому

    Hello. What is the price prediction for macro strategi?

  • @nancywhite7897
    @nancywhite7897 5 днів тому

    Awesome