Why do we need science communication? (w/ Dr Rob Swanda)
Вставка
- Опубліковано 8 чер 2024
- Patreon: / drwilsondebunks
I rarely read UA-cam comments these days, so if you want me to see your comment, here is how you can contact me directly and I will be glad to respond to you when I can:
Email: dr.wilson.debunk@gmail.com
Facebook (direct message): / docwilsondebunks
Dr. Rob Swanda:
/ robswandaphd
Resources on science communication:
www.ncbi.nlm.nih.gov/books/NB...
pubmed.ncbi.nlm.nih.gov/28412...
ncbi.nlm.nih.gov/pmc/articles...
www.ncbi.nlm.nih.gov/pmc/arti...
He was researching on mRNA for cancer treatments up til 2016… long before anyone cared.
And before that research on mRNA technique had been going on for three decades…
Then the antivaxxers joined the chat.
The mRNA concept was first put on paper in the 1960's
I read some papers on mRNA from the early 2000's. The general vibe was that it is a very promising specific delivery mechanism , but there are big safety issues to overcome, especially ADE , as with the Adenovirus vectors!
They could never pass the safety requirements, even for specific critical patient cohorts. So what changed to suddenly pass for All ages and pregnant women who are not even sick? Crisis , Regulatory capture, EUA and immunity for liability.
@zumph12345 oh how could technology have improved since the early 2000s? It's not like science improves over time.
@@zumph12345 the biggest change was the discovery by Katalin Karikó and Drew Weissman and the fact the vaccines are locked in a pre-fusion state. No vaccine rolls out to children before adults or the pregnant but that didn't stop those in the trial getting pregnant and inadvertently providing data to show it was beneficial.
”Chemistry helped visualize what was going on, on a microscopic level”
This is so important. Many laymen (particularly social media experts) lack this ability and thus can’t understand topics on an the same level as an academic expert.
Chemistry on a microscopic level? Dem is BIG molecules if you can see them with a microscope
It was more like physics and engineering that helped develop intricate high tech devices to visualize biology and chemistry at microscopic level LOL @@fintonmainz7845
Maybe once you allow Elon Musk implant you with his Neuralink brain electrode arrays, you might catch up with academic expertise levels without education and hard work ... Some day ... Not quite yet though although FDA gave them the green light to go ahead with human subjects.
@@fintonmainz7845to be fair with a high enough resolution TEM you can observe say, a metal atom on a microscope. The same can be said of large proteins. It's not exactly useful but it's cool nonetheless. Look up pics on google, there's many now.
Thank you so much for inviting me, Dr. Wilson! It was a wonderful discussion & always a critical topic to continue talking about 😄
It must be comforting being in an Echo chamber of lies and misinformation.
@@Invitational2
no idea.
Why don't you tell us .....what's it like inside John's head? Is it comforting?
oh, and by the way - Echo has one C & an H.
😂😂😂😂😂
@@fifthoarsmanoftheacropolis4173 I'm sure anti-poisoners are open to having jabbers on their channel. Wilson here can only interview his fellow jabbers. Echo chamber junk science.
"Go get your toxic jab"
"Are you gonna take me out to dinner first?"
That's how you "volley back"? Hahahaha, lame af
It’s so wonderful to hear the stories of the “accidental” science communicators that were “born” during the pandemic. Amazing interview, thanks to both of you for the work you continue to do!🙌👏
What a great conversation, thank you! I love how many scientists have really started getting into communication directly with the public to counter misinformation. I really hope it's a trend that keeps going! Thank you both!
I liked Rob Swanda approach, he doesn't divide people into camps or cherry pick. Overall a good watch on someone's perspective!
Thanks for doing what you do, both of you.
I'm going to come back to this one - I think it is hugely important to promote science communication to the lay public. Good one, Dan!😊
It is hugely important. That's why UA-cam and the mockingbird media have entire departments dedicated to censoring science, data, and truth. The twitter files has revealed this. time for you to wake up and spread the truth in the face of censorship.
Maybe in addition to a scienctific abstract all papers should also have a media abstract for the general understanding?
That is an amazing idea!
We call them an "Executive Summary".
@@christopherrobinson7541 yep, I call it the Janet and John explanation… but scientific papers don’t have one that’s targeted for someone outside the field in question…
@@simongordon8182 For significant research there is typically a press-release written for journalists and laypeople, but even then those releases are misinterpreted.
@@jaykanta4326 my suggestion is to include that material in the actual paper so it’s not disconnected not lost when people look at the paper. But what you say goes back to my original point, this text needs to be written with the target audience in mind so as t9 not result in misunderstandings. This is a skill that needs to be learned. It’s hard to explain in layman’s terms without dumbing down and loosing key nuance. However it is possible.
Great convo! 🤠💜
His approach likely captures more people on the opposite side, which is nice to see, but I feel we need all types and even MORE scientists and health professionals combatting health misinformation.
How's the Pfizer stock? Booster uptake, 2%? Nobody believes your jab cult now except you yourselves looking for financial gain
I thought 99% of scientists and health professionals supposedly are pro-jabs? How come your camp seems to be struggling and need more help?? Maybe because truth is prevailing..
@@Jasper-11Jasper declares to cancel science so the uneducated free thinking can lead us back to Neanderthal times!
@@steveoxocube The 10M figure is just for England, adjusting for the UK population then it will be 12M. The population of the UK that is 65+, the group offered the vaccine is 11M. In addition those at risk and those living in close proximity to those at risk were also offered the booster. So the uptake is likely to be at least 80%. The UK COVID-19 dashboard will be updated shortly to include the booster uptake.
Science communication helps reduce local entropy.
It works every time.
Pump up the volume!
I had not heard of Dr Rob before. Thanks for the introduction
Merry Christmas Vaxxers!
Still waiting for even one of you to answer the following:
In your own words, what exactly it is that you feel you get out of having the covid vaccines that those without them are "missing out" on?
I think I've heard of him, does he play the bagpipes?
There should be a Nobel Prize for science communications. In general, scientists are dreadful communicators.
Linguists are dreadful communicators, because they don't speak all the time in English.
@@theultimatereductionist7592 You thought you were writing something clever but it's just your usual boring drivel.
Why did the AstraZeneca vaccine *quietly* get pulled off the market in the UK and other countries? Because communication in science is crucial, right?
These two especially. They managed to get PhDs, they accepted relatively high paying jobs in industry and they talk down to people due to their own inferiority complexes now.
Dr. Drew Weissman, Fauci's former postdoctoral student, who just got awarded the Nobel Prize for his synthetic mRNA vaxx along with his former UPenn research partner, is a good enough science communicator. Go back to the source not these two self important pretenders.
@@lufcharrison2234 its little cousin J&K also got phased out ...
Excellent stuff. I hope his subscriber count rockets up. Thanks
Raise your vibration, guys.
Very good thank you.
AstraZeneca court case in the UK any thoughts?
@@steveoxocubeNo one is saying they have total immunity, bozo. They're referring to the 1986 Act. Give it up, you're running out of excuses..
The 1986 act? Do you mean this one, the HEALTH SERVICES ACT
SEC. 2111. ø300aa-11 (a) GENERAL RULE.-
(2)(A) No person may bring a civil action for damages in an amount greater than $1,000 or in an unspecified amount against a v _(edited to avoid being hidden)_ administrator or manufacturer in a State or Federal court for damages arising from a v.....etc... _(edited to avoid being hidden)_ ..... *unless a petition has been filed, in accordance with section 2116,* for compensation under the Program for such .... etc .... and-
(i)(I) the United States Claims Court has issued a judgment under section 2112 on such petition, and
(II) such person elects under section 2121(a) to file such an action
SEC. 2116. ø300aa-16¿ (a) GENERAL RULE.-In the case of-
(1) a v _(edited to avoid being hidden)_ set forth in the _(edited to avoid being hidden)_ which is administered before the effective date of this part .... etc .... no such petition may be filed if the first symptom or manifestation of onset or of the significant aggravation of such ..... occurred more than 36 months after the date of administration of the V ....
...... etc ....
Section 2112_ (f) APPEALS.-The findings of fact and conclusions of law of the United States Claims Court on a petition shall be final determinations of the matters involved, *except that the Secretary or any petitioner aggrieved by the findings or conclusions of the court may obtain review of the judgment of the court in the United States court of appeals for the Federal Circuit upon petition* filed within 60 days of the date of the judgment with such court of appeals within 60 days of the date of entry of the United States Claims Court’s 5 judgment with such court of appeals.
SEC. 2121. ø300aa-21¿ (a) ELECTION.-After judgment has been entered by the United States Claims Court *or, if an appeal is taken under section 2112(f),* after the appellate court’s mandate is issued, the petitioner who filed the petition under section 2111 shall file with the clerk of the United States Claims Court .... etc ....
SEC. 2123. ø300aa-23¿ (a) GENERAL RULE.-A civil action against a _(edit to avoid being hidden)_ manufacturer for damages for a _(edit to avoid being hidden)_ associated with the administration of a v _(edit to avoid being hidden)_ after the effective date of this part which is not barred by section 2111(a)(2) shall be tried in three stages.
(b) LIABILITY.-The first stage of such a civil action shall be held to determine if a v _(edit to avoid being hidden)_ manufacturer is liable under section 2122.
(c) GENERAL DAMAGES.-The second stage of such a civil action shall be held to determine the amount of damages (other than punitive damages) a v _(edit to avoid being hidden)_ manufacturer found to be liable under section 2122 shall be required to pay.
(d) PUNITIVE DAMAGES.-
etc ....
@@Muritaipet Muripuppet is learning 👏👏👏
@@Muritaipet I think I said in the UK. Not sure what your reply is attempting to do. Could you explain it to an Englishman.
@@steveoxocubeI'm saying when people say that vax manufacturers are immune from liability they are usually referring to the 1986 Act American law. Who said anything about them having TOTAL immunity for everything??
*_"Breaking news : GoofMonkey returns and is as boring as ever!"_*
How shall I mock thee? In all the usual ways ......
ua-cam.com/video/hKfnJhd7_qA/v-deo.htmlsi=r7BwVfVVrnP3KBeM
Scientists and mathematicians need to stop dumbing their ideas down.
Those who want to understand us need to do the hard work of learning the language of math and science.
Can you imagine how angry multilinguals would get if a monolingual in language X told them to speak only in X?
When your vocal fry is so severe you sound like RFK Jr.
Biggest "I told you so", in the history of all "I told you so's" combined.
Hands down.
🍿
@@steveoxocube Can easily look it up, but you won't.
Speaking of lies... here is just a handful of the outright lies that you swallowed:
- The vaccinated do not carry the virus that causes covid
- Natural immunity doesn’t work
- Won’t require more than one shot
- Won’t require more than one booster
- 4th shot provides the most protection
- Breakthrough cases are extremely rare
- It’s a pandemic of the unvaccinated
- Nobody is injured or dying from the shot
- The vaccine saved millions
- Masks help prevent the spread
- gene editing/gene expression drugs are a conspiracy theory
- Vaccine prevents long covid
- Vaccinated people don’t carry the virus and don’t get sick (CDC Walensky)
- Vaccines block you from getting and giving the virus
- If enough people get vaccinated, it halts transmission
- You’re not going to get covid if you have these vaccinations (Pres Biden)
- The vaccine makes you a dead end for the virus. You don’t allow it to use you as the stepping stone to spread to the next person. (Fauci)
- It’s 10x more lethal than the seasonal flu. (Fauci)
- When people get vaccinated, they’re not going to get infected. (Fauci)
- Now we know that the vaccines work well enough that the virus stops with every vaccinated person
- If a vaccinated person gets exposed to the virus, the virus does not infect them and the virus then can not use that person to go anywhere else
- There is no variant that escapes the protection of our vaccines. (Pfizer CEO Burla)
- It's as simple as black and white. You're vaccinated, you're safe. You're unvaccinated, you're at risk. Simple as that. (Fauci)
😉
@@steveoxocubeSounds like Walensky needs to learn the difference since she said vaxxed people do not carry the virus (infection) 😂
@@steveoxocubeOne of the leaders of your cult
@@steveoxocube "Show the evidence blah blah blah".... You've cited the study I first cited, the one about p53 spooning, grinding and binding to the 🐒V Forty promter found in the" vaccines". The Ori of the promter funky could not find, but it wasn't his fault he couldn't find it: because he, just like you, didn't do the research. No he blame @NonFlyiingDutchman's hero Philip Buckhaults, half a dozen labs have confirmed tested these tainted vials, Buckhaults fault dan cherry picked the data.
@@steveoxocubeCDC Director in the US, former. Anyway, Doesn't matter if you never heard of Walensky. All you need to know is one of you cult leaders falsely claimed vaxxed ppl don't carry the virus. 🤣🤣
Can you do a video about this antivax conspiracy site called The Expose? They have this page on the front of the website showing a bunch of COVID batch numbers with VAERS data on each saying some batches are more toxic than others. I have no idea where they are getting the data on the specific batches from. They even have a search bar where you can search your batch and see adverse reactions. Some batches show 100s of deaths while others show almost none. Its really strange and a layman like myself would appreciate someone like you to demystify the data they are using.
"Some batches show 100s of deaths while others show almost none."
Well, one very simple explanation is that some batches were given in the early days, where most vaccinated were very old people, meaning you SHOULD expect more deaths *associated with* (which does not equal "caused by") vaccination. There are also size differences between batches.
@@Marco-it2mr Further to your point, the Danish "letter to the editor" was using the number of vaccines in a batch that were delivered, rather than the number used, also it was just using the number of reports, which was higher early after deployment of the vaccine.
Post 💉 Syndrome: A Descriptive Analysis of Reported Symptoms and Patient Experiences After Covid-19 Immunization
Harlan M. Krumholz, MD
@@steveoxocube "This study is the largest to describe people who report a severe, debilitating chronic condition following covid-19 vaccination. This chronic condition began soon after covid-19 vaccination and persisted in many people for a year or more. The symptoms reported are diverse and severe. Despite having tried many treatments, the median EQ-VAS score was low."
"PVS could be caused by several potential mechanisms, including a mechanism related to the vaccination or manufacturing process. It may represent a rare response to vaccines in susceptible individuals"
Repeat after steve0..... "Safe and effective Collateral damage"
"But fears of inciting vaccine hesitancy should not impede efforts to research this condition-and make progress for people who are suffering."
Repeat after steve0.... Nothing to see here folk.....nothing but antivaxer trope
@@MessiahNonEstdo we need to go over middle school algebra now, 70s brat?
Speaking of communication, why did the AstraZeneca vaccine *quietly* get pulled off the market in the UK and other countries? Because communication is key too science, right doc?
It didn't, it's still fully approved and still used in some countries. The Uk stopped buying it because there are better alternatives. Question for you: why did the Ford Sierra get pulled off the market?
@@NonFlyiingDutchman oh the censorship has begun. I’ve just tried quoting you some evidence and my comment got deleted. Welcome too your dystopian future
@@lufcharrison2234 don't flatter yourself, we all get links, copy and pasting and comment with trigger words deleted regardless of the view you are putting across. Besides, the AZ vaccine still has full approval, there's nothing you can say that contradicts that.
@@lufcharrison2234 You are a liar, which is typical of anti-vaxxers. Anti-vax as a cult is built on nothing but lies.
Hey - why do you think the Oxford Uni/Astra Zenecca/Serum Institute of India vaccine was so amazingly successful.
They supplied more doses just in India, than Pfizer did worldwide
Safety and Immunogenicity of the BNT162b2 Vaccine Coadministered with Seasonal Inactivated Influenza Vaccine in Adults.
Infectious Diseases and Therapy.
12th September 2023.
"BNT162b2 coadministered with SIIV elicited immune responses that were noninferior to those elicited by BNT162b2 alone and SIIV alone, and BNT162b2 had an acceptable safety profile when coadministered with SIIV. The results of this study support the coadministration of BNT162b2 and SIIV in adults."
So what, germ-theory denialist?
Useless little skidmark.
Approximately 550 healthy volunteers ,average age 39yrs, minimum requirements to enter 2 jabs and a booster. In the month from 1st dose in the mRNA/flu group 9% caught covid, the placebo group 11% so statistically insignificant, no protection. A month after the 2nd dose infections were at 20% so not getting any better. A 1 in 5 chance - after 2 jabs a booster plus another 2 in - of contracting covid over just two months.
5 "cardiac disorders" AE's plus an additional 2 cases of "cardic problems" recorded as SAE's.
On a lighter note.... The vaccine did elicit an immune responce.
Australia population 25.7 million. April 20th 2022 total cases 366,537... 1 in 70
New Zealand population 5.1 million. May 11th 2022 total cases 209,862....1 in 24 .... 70/24 mean 50...1 in 50 chance of contracting covid during the trial period where 1 in 5 in the test group contracted covid.
@@steveoxocube Australia total cases 11796923 total recovered 11766999
New Zealand total cases 2491809 total recovered 2482481
I bet those young healthy 20% of trial cases are oh so glad the vaccines lessened the symptoms while reducing their chances of hospitalisation and death, plus a whole bunch of (it means the vaccines working) side affects.
@@MessiahNonEstStats, charts, math and science isn't your thing, sucks to be you!
Excess mortality in England post Covid-19 pandemic: implications for secondary prevention.
Jonathan Pearson-Stuttard
"The UK Office for National Statistics (ONS) has calculated that there were 7.2% or 44,255 more deaths registered in the UK in 2022 based on comparison with the five-year average (excluding 2020).1 This persisted into 2023 with 8.6% or 28,024 more deaths registered in the first six months of the year than expected."
@@steveoxocube Just to clarify Suki. Nanny DotGov whom you love and ardour are not a reliable source? Your falsely claiming I said something I have not proves Nanny gov data and the BBC are not to be trusted? Yeh you keep making like Linus gripping that blanket of cope Suki, grip as tight as you can, the cult are counting on you.
This is from a two page article to be published in the next edition of the Lancet in Jan 2024. Care needs to be exercised when reading this document as it refers to differences sources that use different models. The latest ONS weekly report estimates excess deaths to be 3.8% and COVID-19 accounting for 1.7% of this total.
@@christopherrobinson7541The ONS dea ths by vax status show the never-vaxed dropping at much higher rates than the never-vaxed .
Largely not from the acute phase of c19, but from post acute sequelae of c19 (PASC).
@@lindaward "The ONS dea ths by vax status show the never-vaxed dropping at much higher rates than the never-vaxed"
I think you meant:
The ONS deaths by vax status show the never-vaxed dropping at much higher rates than the ever-vaxed. The indirect deaths from other conditions are increased post infection with SARS-CoV-2. Currently the direct and indirect deaths are each 2 - 3%.
The model used by the ONS to estimate the expected deaths includes the two covid tears 2021 & 2022. As the virus occurs in wave, the peaks and troughs do not align with those in the current year, which results in glitches in these data. Hence estimates of excess deaths are best viewed as a 4 week rolling average. This method tends to slightly overestimate the expected deaths by including covid years; however it also does not fully take into account population changes, which underestimates expected deaths. These errors act in opposite directions and generally cancel each other out.
Lol so go digging around pieces to show what you can pick to misrepresent and try to paint a picture opposite of what the facts suggest . With this kind of lack of integrity you must be an antivax activist .
So why is it that the the vaccinated are mostly spared the excess deaths ?
I know that you tried to trick your way out f a simple question elsewhere regarding process 2 when you completely failed to answer the question - why exactly study in process 2 was required when it was clearly demonstrated that product from both processes were not any different .
Let’s watch you fail here and demonstrate what levels do antivaxer activists need to sink to malign vaccines .
“SV40 is a DNA virus that sometimes causes tumors in animals, but most often persists as a latent infection.”
latent = (of a disease) in which the usual symptoms are not yet manifest.
example: "diabetes may be latent for some years before diagnosis"
1. Not been shown in humans
2. Virus is not present in the vaccines, there is sequence analogous to SV40 genome sequence in the vector used for making the vaccine.
The spectrum of non-fatal immune-related adverse events following COVID-19 vaccination: The population-based cohort study in Seoul, South Korea
IQ Test
1.) Do you trust a product that's being pushed through blackmail? Take it or else you lose your livelihood?
2.) Do you trust a product that's using bribery for uptake? Enticing you with free donuts, weed, beer, etc?
3.) Do you trust a product from a maker that has a criminal history?
🤣🤣🤣
1) never been blackmailed nor lost my schooling. Quit lying idiot.
2) still a student struggling to pay tuition. Why haven't I been paid yet by Big Pharma? You just deny reality when it suits you.
3) So we should trust criminals and liars like Kirsch, McCullough, RFK jr, et al instead?
But would anyone trust a Boring Ill Informed TroII? LOL. Of course not.
🎵"Yes we heard the covert narcissism you disguise as altruism 🎵Just the usual anti vaxman (Tale as old as time) 🎵
🎵You'll stare directly at the sun but never in the mirror 🎵It must be exhausting being such a loser anti-hero"🎵
(Anti-hero by Taylor Swift, modified for Winn the BIIT)
@@sithwolf80171) & 2) Did I say they were necessarily done to you, personally?? The reality is that the quackcine has been pushed in such ways, idiot.
3.) Lol, now this just screams desperation here.. they're criminals...in your head 🤭 so you assert it as reality??
@@MuritaipetMuripuppet avoids the questions as he can't face reality. Keep singing like a delusional zombie.. 🧟♂️🤣🎵
@@winnmatthews
Blaming the unvaccinated during the COVID-19 pandemic: the roles of political ideology and risk perceptions in the USA.
Maja Graso.
Great video by Matt Orfalea on this, posted May 2023 😆
@@steveoxocubeActually the video was a compilation of pro-vaxxers being gnarly ghouls 😂
@@steveoxocubeYou should care. Because people don't trust control freaks 😂
@@steveoxocubeSo you conned tons of people into taking the quackcine...congrats on your achievement. How many of them do you think trust you or now regret it and won't ever take anymore?
@@steveoxocubeNot everyone has woken up from your con... But there's a downward trend. Pfizer stock nosediving. Texas suing them. Sinking Vax Titanic. 😂
miR-142-3p Is a Key Regulator of IL-1β-Dependent Synaptopathy in Neuroinflammation
Georgia Mandolesi
@@steveoxocube And the relevance of that paper to miR-142-3p....... Is it E=MC^20/0268😈😈😈A1. 🤣🤣
@@steveoxocube Not at all just testing your research abilities. Now all you got to do is crack the clue, the guys at Bletchley are rooting for yah🤣🤣🤣.
@@MessiahNonEst Read back what you just posted - you are now completely incoherent, you need help
@@NonFlyiingDutchman In simple terms.... That research you did and sent to steve0..... That was for another patent. You need to recalibrate that Vax Generation sequencing thing-e-mybob of yours, that alignment was way off.
@@steveoxocube Can you post that mRNA covid vaccine patent to Kevin... I'm shocked he didn't think to check there for it🤣🤣🤣
Over the past 3 years I've had two major open surgeries with about 15x follow up appointments, multiple dental cleanings and exams, an endoscopy, two ER visits, physical therapy sessions, etc where I met with no less than 65 different med staffers.
Not one asked "How are you doing so well with zero covid vaccines!?".
Seems like that should be the hot question for medical people to be asking today, but nope!
So WHERE is the "science communication" that should be there?
Isn't a huge part of science monitoring the success (or lack of) of the "control group"?
Rather telling that we are being flat out ignored.
yeah, well as an ex-military meat-head you don't understand how pharmacovigilance works...not your fault.
Safee so what is your problem, you are being well looked after 65 different med staff that is brilliant.
@@samsmith962 It does beg the question why he keeps going back to these medical professionals who are all part of a global conspiracy to kill everyone though doesn't it?
Out of interest, what did all these medical professionals say when you told them your theories about vaccines? Or when you presented your list of victims?
When the debate is lost, slander becomes the tool of the fool.
No new videos in a month?
Somebody is having adverse reactions to the boosters!!!!!!
New born!
Show me/us your hands, Dr.
"Safe and effective" now "dead suddenly".....oops "science" 😂 hilarious.
Is that what your imaginary friends 🙈💩🤡 and 🤖 tell you? Isn't it time to play with your choo choo trains together?
Nazitaipet, who lives here and has no private life, was able to see my comment within 49 minutes after me writing it. And one month after uploading this video. It tells you how lifeless he is. Everyday, the dude checks all new comments in here hoping to bring some light to his crappy lonesome life.
GoofMonkey, whose main joy in life is posting nonsense and fantasizing about Poutine riding with his shirt off.......
..... seems a bit angry today. How shall I mock thee ...... (you know the rest)
Ouch, hahaha. Muppet is by far the most pathetic of the goons here in coping with their failing vax narrative.
@@winnmatthews 🎵Winn wakes up screaming from dreaming 🎵 everyone's leaving bored with his scheming🎵
🎵And the troII will lose all his meaning 🎵(For the last time)🎵
🎵He stares directly at the sun but never in the mirror 🎵It must be exhausting losing like an anti-hero 🎵
(Taylor Swifts Anti Hero, modified for Winn the fully vaccinated BAUT)
@@Muritaipet Muppet squirming 🎵 Keep on singing 🎵 Your only way of coping 🎵
🐟🐠
🤣🤣
@@winnmatthews
The channels suffering hence why I'm here to jack up the algo... It's nice to be nice.... Hint : mention John Campbell again in one of your clips he'll have your ratings rocketing
TGATAAAGTACTTAATGAGAATGAGAAG
codes for nothing without regulatory elements and is naturally occurring in many organisms.
@@steveoxocube @steveoxocube Nope not even close. McKernan didn't find that sequence, someone else did so no you haven't debunked it nor did you debunk Kevin: you were writing "trust me bruh" cheques - regulators aware, in the patent etc - you could not cash. Could not provide a single piece of evidence, not a pennys worth.
@@steveoxocube 🤣🤣🤣🤣 You're latest evidence is a papent from 2022. That's evidence the regulators were aware before the rollout,. And also evidence that sequence McKernan found is detailed in the MA-1273 patent filled in 2020. 🤣🤣🤣🤣
@@steveoxocube Now about that sequence someone else found..... It shouldn't be there right...... Only RNA right?
@@MessiahNonEst Why should the sequence you posted appear in only in RNA? If you are referring the mRNA vaccines then if that sequence is in the mRNA vaccine then it has to be in the DNA vector used to make the vaccine, obviously.
*COVID and flu vaccine rates are declining for US health care workers, CDC reports: ‘Disturbing trend’* Nov 16 2023
😂👏👏👏
Disturbing indeed. 😂😂😂😂😂
Unexpectedly, the ghouls are celebrating bad medical choices...
@@Marco-it2mr Cry me a river vax-worshipper
@@steveoxocube "Most health care insurance plans cover the annual flu shot as preventive care. Flu vaccination is often available at no or low cost to people who do not have insurance.": CDC
"Here’s why Covid vaccines will still be free for uninsured Americans as public health emergency ends": MSNBC
"HHS Launches Bridge Access Program to Safeguard Free COVID-19 Vaccination for Uninsured and Underinsured Adults": CDC
The biggest issue is you are talking bollocks of the total and the utter kind..... Monumental...
Administered through the CDC, the program is available now
@@steveoxocube Did I think about your "trust me bruh" claims without evidence yet again........ Yes, yes I did. So can you provide that information: covid vaccine application form #.... Flu vaccine application form #......I'm really curious as to how filling a simple form is such a difficult task that someone would forgo a life saving "safe and effective" vaccine.
As for illegals they should take that up with their employer. The least their employer could do given they are exploiting their illegal status by illegally employing them.......only illegal immigrants in the US can get a free covid vaccine no questions asked... But hey you already knew that because you did your "research" right? 🤣🤣🤣
So chop chop and post those covid and flu vaccine form numbers..... Lets see your evidence.
Who's this guy working for ? It's not pharma related by any chance is it?🤔 Last I heard it was Eurofins and they were doing some testing for Moderna at the time .. open to contradiction if anyone can prove otherwise 👌😊
@@Jasper-11 was there anything there about once conspiracy theorist or flat earther?
@@Jasper-11 surely he can't be on UA-cam slating the VX even if it were true? That would be bad for business wouldn't it? But who am I to guess?
@@Jasper-11 "He named as skills: RNA Biology, protein purification, antibodies, hybridoma, gel electrophoresis et al"..... And of course uploading Debunking videos to youtube, can't not mention that skill.
@@MessiahNonEst your hero Campbell got a PhD for uploading videos to UA-cam
@@NonFlyiingDutchman Dr John Campbell Esquire PhD has uploaded two more parliamentary debates since Bertie Smalls went all supergrass sqealing like a 🐖 to nanny government. I'm starting to think Dr John Campbell Esquire PhD is trolling supergrass Bertie 'oxo cube' Smalls while the government's complaints department are pissing themselves.
Direct RNA nanopore sequencing of full-length coronavirus genomes provides novel insights into structural variants and enables modification analysis.
Adrian Viehweger et al.
Novel insights indeed 🤔
Hematologic abnormalities after COVID-19 vaccination: A large Korean populationbased cohort study
Vax fanatics: the evidence is overwhelming that the hokey pokeys are safe and effective! There is no need for a debate!
Also the vax fanatics: _spends their lives arguing and debating in the comment section_
😂😂😂
@@steveoxocube Has BG's long time mantra for the pseudoscience of C.C. been that there are too many people on the planet emitting too much CO2?
@@steveoxocube Increased.
@@steveoxocube How many vaxxed people died in the trial versus placebo group? 🤭🤣
@@steveoxocubesteveopube: "There's overwhelming evidence the vax is safe and effective.
Why is a debate needed?
Feel free to prove me wrong."
What a freaking bozo. You don't realize the contradiction there? You're claiming it's settled, no need for a debate, and then inviting for a debate??
Keep in mind folks...
When the debate is over, slander becomes the tool of the fool.
If you are incapable of reinforcing your position with logic, reason, and rationale and only resort to irrelevant ad hominem attack, then it means you lost... plain and simple.
🤗
then you lost....plain and simple. Kudos to you for acknowledging it.
If you lie about vaccines, you're an anti-vaxxer.
That's not ad-hominem, and name-calling isn't ad hominem.
Aren't you intelligent enough to know that?
"If you are incapable of reinforcing your position with logic, reason, and rationale" .... there's always DARPA!!
@safeeffective385 12 days ago
@Muritaipet You might want to go do some research about that, as you obviously have no remote clue about it.
@safeeffective385 12 days ago
@Muritaipet Do you understand what DARPA is and does? All that they've ever designed are high tech weapons systems.
@safeeffective385 12 days ago
@Muritaipet "DARPA provides their partners across the Army, Navy, and intelligence services with weapons and weapon systems. After testing and fielding, those partners make the ultimate decision about whether or not to deploy them."
All that DARPA has ever done is develop high tech weapons systems... and never "life saving vaccines".
Aren't you the least bit curious about that?
Personally, I would be all over looking into this... if I were a Vaxxer.
*BTW - you still haven't explained to me how DARPA was responsible for the worlds most popular CV vaccines* They are
Sinovac CoronaVac. Approved in 56 countries, with 42 trials in 10 countries
Sinopharm (Beijing) Covilo. Approved in 93 countries, with 39 trials in 18 countries
Oxford/AstraZeneca Vaxzevria. Approved in 149 countries, with 73 trials in 34 countries, and supplied by Serum Institute of India as Covishield. Approved in 49 countries, 6 trials in 1 country
@@NonFlyiingDutchmanHow many are you converting into your cult versus leaving it and listening to anti-poisons? You still haven't answered that
@@MuritaipetYou still haven't explained to me why the FDA excused Pfizer for failing to do the subclinical myocarditis study. Hahaha, forever failure Muripuppet
Pernicious Anemia Following COVID-19 Vaccination: A Report of Two Cases
Hamidreza Soltani et al
Sinopharm.
Assessment of Myocardial 18F-FDG Uptake at PET/CT in Asymptomatic SARS-CoV-2-vaccinated and Nonvaccinated Patients
Takehiro Nakahara
@@steveoxocube Asymptomatic for now steadily growing like asymptomatic cancer, by the time the symptoms become apparent is when you really start to worry. My heart goes out to you and the possibility you may have asymptomatic myocarditis. Luckily for you getting a replacement for your 'my old car died' is much easier, just give Arthur Daily a bell.
@@steveoxocube "Asymptomatic? 😂"...... Correct.... Asymptomatic.
Myocarditis and Sudden Cardiac Death in the Community: Clinical and Pathological Insights From a National Registry in the United Kingdom.
" Most individuals (n=50 [61%]) were reportedly asymptomatic before SCD."......That'll be asymptomatic sudden cardiac death..... Sudden death with no symptoms or warning: Asymptomatic.
@@steveoxocube "Cardiac MRI (4,7,8) and fluorine 18 (18F) fluorodeoxyglucose (FDG) PET/CT imaging (9-11) have been routinely used in the noninvasive diagnosis of myocardial inflammation of diverse origin"
And another word for myocardial inflammation is...
@@steveoxocube "Patients who had blood glucose levels greater than 100 mg/dL (5.55 mmol/L) at the time of 18F-FDG injection or who had fasted for less than 12 hours (15) were also excluded. Patients were also excluded if they had pre-existing diseases or conditions that could artifactually influence the myocardial FDG uptake. Specifically, patients with hematologic diseases, such as lymphoma and leukemia, cardiac sarcoidosis, and thyroid disease (16); those who had undergone cardiac surgery, chemotherapy likely to result in cardiac dysfunction, or chest irradiation within the past 6 months; and patients currently undergoing anti-inflammatory therapy, were all excluded"
@@MessiahNonEst haha “ asymptomatic for now “ the shameless with which you make up things . No wonder you felt no shame in asking questions that have absolutely zero use eg process 2 study . Do you think being morally bankrupt is a requirement to be an antivax activist ?
Correlation between COVID-19 vaccination and inflammatory musculoskeletal disorders.
Correlation does not equal causation. This is as old as science.
Yeah. The subjects in the study could have been taking other fizor products that caused the inflamation.
@@sithwolf8017 Yes, due to the cult’s design, unblinding and jabbing the control group, allows you to make that claim. Evil
@@sithwolf8017 Yeh but when shotgun blasting genetic material then rearranging all those A, C, U and G's to spell "scary virus"..... That's a correlation you can get behind right?
Edit A, C, G, and U......"scary virus"
@MessiahNonEst so humans aren't real? We use shotgun sequencing to sequence our genome bucko. In fact that's how we sequenced our entire genome.
Guy was so no annoying I bailed after 1:50
Why would you "bail" if he was "no(t) annoying"? Short attention span.
Thanks for admitting that you don't seek the truth and you're only here to troll.
So, you are no really Iron Hide?
@@williamverhoef4349Caesium hide is more like it lmao.
More like Wet Tissue Paper Hide.@@williamverhoef4349
Novel chemical-physical autopsy investigation in sudden infant death and sudden intrauterine unexplained death syndromes
Antonietta M Gatti.
"Nano-sized foreign particles, particle clusters and organic-inorganic structures have been found in altered brain tissues of fetuses and newborns who died suddenly without any apparent cause of death."
"The presence of inorganic entities could be considered a possible cofactor of lethality in perinatal life."
And how do you think this is relevant to anything discussed in this video.
Just a small hint if you want to link it to COVID vaccines: "Received 26 May 2021".
Absolutely nauseating. Interesting to see bigger gaps between your videos Wilson. The truth continues to come out and eventually your gig will be over.
He's got a new born. I think he's got better things to be doing.
What "truth"?
@@May_Day45 Dr Wilson is a father of two now and Dr Oliver's channel continues positive growth month after month. You do know it takes seconds to check your lies, right?
@@plumpuddinandjamLies or delusions?
Vaxgig will eventually be over. 🎉 Lawsuits are coming.
Let's hear it from the point of view of one of the many Vax injured.. isn't it healthy to have a happy balance or is this channel completely biased?
What are you so scared of?
Gotta feed the audience what they want 😉
🦗🦗🦗🦗🦗🦗 🎶
@@safeeffective385 the audience tends to hide when I appear 🤣 could've sworn that was a tumbleweed blowing by.. taking advice from someone who works on behalf of you know who and quoting paid Docs 🤣🤣🙈😫
Re "the audience tends to hide when I appear". Sorry Clueless Truthless, but I think everyone has worked out your not really anti vax, and just a troII. So you get ignored.
Unfortunately, you're also really boring, and barely worth mocking. Goodbye
@@ruthlesstruthful Yeah, this echo chamber tends to shut down when prevented with most anything that doesn't serve to propel the narrative that they were so carefully conditioned to believe.
@@MuritaipetYes, Clueless Truthless is as boring as 🦇💩
🥱💤
Why are you still promoting fake science?
Why do you insist in showing off you are a gullible fool?
Autoimmune diabetes mellitus after COVID-19 vaccination in adult population: a systematic review of case reports
Ali S Alsudais,
Well, I'm now convinced that vaccines are 100% safe. So, go for it, get all the jabs!
Totally up to you, and consult your Dr. 1st, as you can't use any of these videos as medical advice, but - just don't troll, because then Dr. Wilson will find it funny. And we can't have that.
@@TroyKanta4327You don't accept science or even understand the basics. You've made over 20 sock accounts just to express your delusional thoughts and all you do is cry.
@@May_Day45Gotta lie to be an anti vax!
"COVID-19 Vaccine AstraZeneca confirms 100% protection against severe disease, hospitalisation and death"
Pfizer : "Vaccine was 100% effective in preventing severe disease as defined by the U.S. Centers for Disease Control and Prevention and 95.3% effective in preventing severe disease as defined by the U.S. Food and Drug Administration"
The WHO: "While COVID-19 vaccines are highly effective against serious disease and death, no vaccine is 100% effective."
And still ZERO EVIDENCE from you of your imaginary "harms" from pharmaceutical drugs and vaccines compared to their MASSIVE benefits.@@TroyKanta4327
30:19 Wilson calls people who speak truth and debunk his contrived science as “trolls” and thus unworthy of scientific debate whilst head buried in sand.
You're a drummer. Not exactly qualified for scientific debate.
In fact, based on your comments on Dr Wilson's recent videos, you do qualify precisely as a "troll".
you call them trolls, others call them truth tellers, the weak minded call them conspiracy theorists... whatever floats your boat.@@diandian9827 truth is truth no matter how deep you bury your head in sand.
@@Invitational2 How do you determine "truth" about a virus and vaccine without a science background, except for agreeing with what confirms your already-held beliefs?
John, perhaps troII is a good description for you? TroIIs are fantasy creatures. You seem to live in a fantasy world.
In every discussion I've had with you, you made up things. Even after I gave you evidence, you continued with the fictional version.
@@MuritaipetI still remember his claims of viral infections being caused by man made chemicals post 1900s and that sanitation alone was responsible for the eradication of smallpox across the globe.
I would have loved to have watched this but I can't stand the vocal fry.
Encephalitis following COVID-19 Vaccination: A Systematic Review
Mariam Abdelhady,
All this biochemistry expertise and neither can figure why their T is so abysmally low. The paper, “Chronic toxic effects of polystyrene microplastics on reproductive parameters of male rats” may have some clues and for the wider human population as a whole.
I wonder how many downvotes Wilson’s videos get.
You'll never know. Only the video creator gets that info. I did down vote your useless comment though.
it may seem useless... trivial... and not worth thinking about to the weak-minded sheep. But for those who can use their critical thinkers to think about this may begin to understand that truth does not require censorship... Lies, However, depend completely on the censorship of truth.@@diandian9827
@@Invitational2 You're not a critical thinker in the slightest. You're a musician, human evidence of Dunning Kruger, who wastes time trolling Dr Wilson's channel with zero-content posts like the one you made here.
@@Invitational2 so why haven't you used your critical thinker to answer my challenge to you? Or did you forget that third world countries with poor or nonexistent sanitation services exist and managed to eradicate smallpox in the 80s, Mr "Sanitation alone was responsible for the eradication of smallpox"?
@@diandian9827 please provide your evidence that I am not a critical thinker. All my content is rich and thought provoking. Your content is name calling… before we are done here now doubt you will call me anti-Semitic as is customary per your playbook.
Military Could Owe Billions to Service Members Involuntarily Discharged for Refusing COVID Shots.
The U.S. military could owe billions in back pay and legal fees depending on the outcome of three class-action lawsuits filed on behalf of service members who allege they were wrongfully discharged for refusing the COVID-19 vaccine.
@@steveoxocube Keep telling yourself whatever makes you feel good about the experimental gene editing drugs that you were suckered into getting!
Meanwhile, those of us who had zero are all doing just fine and could not be happier with our decision... and the whole world knows it too.
😘
Answering to anti vaxxers, power hungry individuals, privileged people, influential snobs, and conspiracy theorists I retort: "Sarcasm, because beating the crap out of people is illegal."
You are right, anti-vaccine members are full of crap 💩
Power hungry people? You mean like vaccine-pushers who coerce people into taking their crapcine and using censorship to control the narrative?
@@winnmatthews Exactly. On one side we have authoritarians who want to force experimental medicines on people against their will for profit, and other motives, censoring any who dissent, and the other side who wants individual freedom, autonomy and full debate. The detachment from reality of the covidian/pharma cult is a stunning example of psychopathy.
@@philo3479💯 For real. The legit people versus who the evil mor0ns are couldn't be more obvious. But we live in a clown world these days.
@winnmatthews how are you numbnuts being censored when you're right here? There are millions of antivaxer books, youtube channels, social media groups, etc out there on the internet. Where's the censorship?
"Army invites back soldiers discharged for refusing COVID-19 vaccine."
Last week, the service notified vaccine-related discharged soldiers they could contact their local recruitment office for information on reapplying to the Army.
👈
Hey, you still haven't told me which vaccines on that list I gave you were created by DARPA.
Was the Abdala vx one of them? If so, that would be masterful of DARPA - getting the Cubans to supply Venezuela with a DARPA vx.
it' not 'game over' it's pandemic over.
@@steveoxocubeWhy was the clotshot even mandated in the first place to physically fit soldiers and athletes who are not at risk?
@@winnmatthews OMG, you're such a boring ill informed troll. So Win the BIIT, lets see if your little BIITy mind can do simple thinking and simple research.. I'll ask you two questions ........
*Are the US military smarter than you?* (Rhetorical question, of course they are)
How many people did the US military lose to covid?
Hmm... what is that noise? Oh, a dim puppet whining cuz he's still a struggling failure 💩