May's Brexit Deal Rejected by MPs, Again - Brexit Explained

Поділитися
Вставка
  • Опубліковано 26 січ 2025

КОМЕНТАРІ • 783

  • @edgeyt1
    @edgeyt1 5 років тому +903

    The ad that played before the video was for a sore throat spray :-)

    • @raheem201231
      @raheem201231 5 років тому +16

      Extra thin condoms

    • @SamA-cw3be
      @SamA-cw3be 5 років тому +11

      @@raheem201231 and extra small

    • @groslait7814
      @groslait7814 5 років тому +2

      Ads are personalised for you, i saw many commercial website ads.

    • @DanielM2006UK
      @DanielM2006UK 5 років тому

      Cavoooooonia!

    • @thepoormansguidetothegalax3981
      @thepoormansguidetothegalax3981 5 років тому +2

      How about those flavoured or glow in the dark condoms? Are they any good?

  • @SatoshiNakamotoAi
    @SatoshiNakamotoAi 5 років тому +496

    She's sounding more and more like a sith lord the closer we get to brexit.

  • @DutchTDK
    @DutchTDK 5 років тому +447

    I'm worrying about the TL:DR news team. They must get no sleep at all these days

    • @meevil24
      @meevil24 5 років тому +30

      Don't forget that Jack also has a full time job

    • @kennethhwang3425
      @kennethhwang3425 5 років тому +25

      Aasim And a boyfriend, some people truly are capable of multitasking.

    • @stahl1624
      @stahl1624 5 років тому +3

      kenneth hwang Men can’t multi task, we are simple creatures of simple desires lol

    • @OneEyeShadow
      @OneEyeShadow 5 років тому +8

      Well, there was about 2 years of no news, so it's more like crunch-time right now :P

    • @meandmetoo8436
      @meandmetoo8436 5 років тому +1

      Still more than Miz May.

  • @Sami-ss3ti
    @Sami-ss3ti 5 років тому +339

    Astonished by how quick your getting these out. Thanks!

    • @CharalamposKoundourakis
      @CharalamposKoundourakis 5 років тому +18

      Don't think he sleeps now.

    • @JamesRoyceDawson
      @JamesRoyceDawson 5 років тому +13

      I'm guessing he preps the version he thinks will happen. It was pretty clear this was gonna be rejected, so it'd be smart to prepare this video.

    •  5 років тому +6

      You're

    • @Joso997
      @Joso997 5 років тому

      Why has he skipped that part where they say no to second referendum? 3:45

    • @jascrandom9855
      @jascrandom9855 5 років тому

      The power of Templates.

  • @Aquelll
    @Aquelll 5 років тому +189

    UK is in a serious need of an intervention by Lord Buckethead.

    • @kegal
      @kegal 5 років тому +4

      It’s one of the queens executive actions

    • @Itsfedebitchhh
      @Itsfedebitchhh 5 років тому +2

      He said this was going to be a shitshow

    • @Furykidxxx
      @Furykidxxx 5 років тому

      YES

    • @MrCrazyLeprechaun
      @MrCrazyLeprechaun 5 років тому +1

      @@Itsfedebitchhh To be fair, many could see it was going to be a shitshow, he was just the only one willing to say it without political bru-haha to soften the blow.
      Kinda curious about his policies as a whole these days. If he ain't just a nazi with a bucket hat then I might hitch a wagon to his tyrannical empire.

  • @richardtickler8555
    @richardtickler8555 5 років тому +82

    they sound like a bunch of school kids witnessing an exchange of insults "oooooh" "ahhhh"

  • @lellyparker
    @lellyparker 5 років тому +301

    I am shocked. May added approximately two commas and an exclamation mark to her deal and still they rejected it.

    • @SamA-cw3be
      @SamA-cw3be 5 років тому +40

      we told her she needed to add a semicolon, but she just didn't believe us.

    • @dougdawson3232
      @dougdawson3232 5 років тому +18

      @Sam A Semicolon is too divisive. Ministers and MPs cannot agree on its placing or whether it is actually a comma or a full stop. :D

    • @livefreeordie42
      @livefreeordie42 5 років тому +19

      Guys i dont know if she is doing a good or bad job but i frankly cant envy her, she is trying to salvage a deal against the WHOLE europe, try to figure this our for yourself guys, it must be real hell. And i think you have been bad boys and should not get a too good deal, but you are still our cultural brothers so we can accept a favoreable deal. Just dont expect too much guys, you endangered the european union with your rekless behavior.

    • @SamA-cw3be
      @SamA-cw3be 5 років тому +6

      LiveFreeOrDie I almost feel bad for her, and then I remember she ran for this position

    • @lellyparker
      @lellyparker 5 років тому +18

      @@livefreeordie42 There are no good deals. I don't blame May for her deal. No party can deliver a deal that fixes the Irish border problem. The mistake was having a referendum to begin with. The second mistake was trying to honor the referendum with such a tiny majority, which is no real mandate for such an intrinsic change.

  • @somecrazdude2412
    @somecrazdude2412 5 років тому +64

    My goodness, May's voice sounds as destroyed as her Brexit deal...

    • @joselugo4536
      @joselugo4536 5 років тому

      What evil goes around, it comes around. Every dirty trick under the sleeve, a perversion of democracy, represented on this modern Boudicca.

  • @CharalamposKoundourakis
    @CharalamposKoundourakis 5 років тому +270

    May lost her voice! What great timing.

    • @DanielM2006UK
      @DanielM2006UK 5 років тому +7

      I don't even think it was her voice. I think it's the voice of the EU demon that controls her soul.

    • @Khonsu1373
      @Khonsu1373 5 років тому +7

      Pity she didn't lose it permanently two and a half years ago

    • @groslait7814
      @groslait7814 5 років тому +21

      @@DanielM2006UK why u hate the EU so much ! LMAO

    • @henkiepaulisma
      @henkiepaulisma 5 років тому +20

      Midly interesting fact: in the Netherlands we use the same word for voice and vote ("stem"). So a lot of pundits over here are now saying 'May lost her "stem" (voice) and lost her "stemmen" (votes)'

    • @ouonouanwilfried-desire7758
      @ouonouanwilfried-desire7758 5 років тому +7

      I'm kinda sad for her

  • @HRRN-gh3wj
    @HRRN-gh3wj 5 років тому +316

    0:08 ORRRDDDDAAAAA... ORDA... ah I love John

    • @linaiisaye8357
      @linaiisaye8357 5 років тому +11

      Oida!

    • @SamA-cw3be
      @SamA-cw3be 5 років тому +44

      with half of his job being to yell at the ministers to shut up, it would suck if he had a sore throat.

    • @Pining_for_the_fjords
      @Pining_for_the_fjords 5 років тому +4

      @@SamA-cw3be It would be hilarious though.

    • @user0K
      @user0K 5 років тому +2

      ora ora ora ora

    • @cookiesenpai1641
      @cookiesenpai1641 5 років тому +20

      I have to admit the first time I saw him and the way british chamber works I was like : wtf ? And I still am... Wtf britain ? But he is pretty funny so that's ok

  • @linaiisaye8357
    @linaiisaye8357 5 років тому +123

    You can say a lot about May, if you like her or not, but you can't say she doesnt have the balls to be the Prime Minister during this period. All the original leavers just jumped ship and she did step up and she sounds like she will do what the parlement wants, while still sticking true to her own ideas. Im fairly sure I dont agree with her politically, but for that she has my respect.

    • @markedfang
      @markedfang 5 років тому +23

      May has looked very weak leading up to Brexit, but maybe it's because British parliament is so demanding and the EU is so unwilling to compromise.
      I've never seen anything admirable written about May, I suppose you've given me some change of heart, my good man.

    • @linaiisaye8357
      @linaiisaye8357 5 років тому +9

      @@markedfang thanks ^^ not saying I necessarily like her though, just respect

    • @KathyClysm
      @KathyClysm 5 років тому +44

      As someone not from the UK, I have to agree. She inherited a clusterf*** and tried to provide an actual solution to impossible promises. But if noone agrees on what they want, how was she to get a deal that pleases two completely opposite extremes? This was all futile from the start

    • @thebrsrkr6428
      @thebrsrkr6428 5 років тому +1

      I think it's quite the opposite, in fact.
      You agreed to vote to get out of the EU 2 years ago. You're still in. Why? May doesn't actually want to leave. That's fine, but meaningless, because the people have voted, and she is supposed to provide. She instead spent all her time making what looks to be surrender terms after a lost war. Britain is still an extremely powerful and influential country, but she seems scared to do things herself, as opposed to with the EU handling it. It's disgusting.

    • @JB940
      @JB940 5 років тому +6

      @@thebrsrkr6428 it's not surrender terms, its a midway. Gain some freedom while also not being sent back 50 years in time.
      99% of the house don't want a no deal. The majority of both opposition and mays side, don't.
      It's disastrous. Ofcourse they'll try to get better deals, that's what this whole thing is for.
      You don't understand how this is good for you?
      You're getting a no-deal brexit if it doesn't work out, if per chance it does, you will only have gotten a better deal. If they didn't negotiate that would be anti UK.

  • @VideoGameAnimationStudy
    @VideoGameAnimationStudy 5 років тому +58

    Maybot's voice synthesiser is running low.

  • @trabladorr
    @trabladorr 5 років тому +57

    There's at least one good thing coming out of brexit: The rest of the world has become more familiar with your hilarious parliament, thank you for the entertainment!
    ORDAAAAAH!

    • @wibblemu9
      @wibblemu9 5 років тому +13

      The British parliament is living meme, it's hilarious

    • @SASMacDroid
      @SASMacDroid 5 років тому +2

      they are all weird over there .i still dont get the point of people over there wanting a brexit it comes over like they expect to have more money in there pockets after that xD if yes they are definitely a one of a kind special idiots

    • @TheCimbrianBull
      @TheCimbrianBull 5 років тому +1

      *Theresa May dancing memes be intensifying!*

    • @obligatoryusername7239
      @obligatoryusername7239 5 років тому

      @@SASMacDroid One of the main groups that made Brexit happen were UK farmers that were drowning alive with all the competition in the EU market. From what I have seen, they made a terrible choice, but simply dismissing them as idiots without examining their motives is wrong.

  • @RokuRG
    @RokuRG 5 років тому +12

    I feel sorry for May. I mean, no matter if you like her or not, she's in charge of delivering a deal that no-one will agree on, no matter what the deal is.

  • @nicc7637
    @nicc7637 5 років тому +104

    There’s nothing quite like a burcow ooooodah

    • @TheCimbrianBull
      @TheCimbrianBull 5 років тому

      *Theresa May dancing memes be intensifying!*

  • @lellyparker
    @lellyparker 5 років тому +99

    If they drag this on until April 1st the government can turn around and say "April Fools! We're not really leaving the EU! Hahaha Gotcha!".

    • @aneesh2115
      @aneesh2115 5 років тому +1

      April 1st

    • @jacobjorgenson9285
      @jacobjorgenson9285 5 років тому +5

      Lelly Parker I don’t think Britain will leave , it’s just too stupid

    • @lellyparker
      @lellyparker 5 років тому +1

      @@aneesh2115 LOL, just testing! Thanks.

    • @jacobjorgenson9285
      @jacobjorgenson9285 5 років тому +4

      Night Shade Yes, populations are prone to do stupid things . Lesson, never let fools vote on serious subjects

    • @ColonizerChan
      @ColonizerChan 5 років тому +2

      Jacob Jorgenson
      Mate, it’s already said and done. You’re going to have to leave pretty much before the summer. If you don’t, then your referendums are truly meaningless

  • @jhwheuer
    @jhwheuer 5 років тому +23

    When boarding a train wreck one should not expect comfort and room service.

  • @Zeruyu
    @Zeruyu 5 років тому +10

    It will be a No Deal Brexit. Everyone willing to see can see this now.
    Edit: If the vote to extend Article 50 will have a negative result, there will be a No Deal Brexit despite a No Deal Brexit will have been rejected earlier on in this case. That's because No Deal is the default option, and the parliament can vote as much as it wants against it - it's like voting against gravity.

  • @propergander8509
    @propergander8509 5 років тому +89

    0:08
    Will someone bring Bercow his Hors d'Oeuvres?
    For fuck's sake! Don't make the man scream like that! :D

    • @kennethhwang3425
      @kennethhwang3425 5 років тому +2

      Proper Gander Bercow is a diligent and excellent Speaker, and I am by no mean a nostalgist, but Boothroyd would have never let MPs tried her to the second time.

  • @braderzs101
    @braderzs101 5 років тому +30

    Just would like to say thanks for these videos, must be hard work making these on the fly as things happen, i’m currently not in the country and these videos are a great sauce of information and keep me updated on what is happening.

    • @Joso997
      @Joso997 5 років тому

      Why has he skipped that part where they say no to second referendum? 3:45

  • @barryallott
    @barryallott 5 років тому +9

    It sounds like the PM has been spending too much time in fields of wheat

  • @FriedrichHerschel
    @FriedrichHerschel 5 років тому +97

    You seriously count by eyes and noses? No wonder why this whole Brexit fiasco happened.

    • @nannyoggsally
      @nannyoggsally 5 років тому +16

      Imagine now if they were pirates... that'd be an awesome mess!

    • @matejsmrekar1218
      @matejsmrekar1218 5 років тому +3

      Lmao

    • @glue6143
      @glue6143 5 років тому +17

      i seriously can't be the only one that thought they were saying eyes and nose even for a little

    • @ShermanLeungpointofgravity
      @ShermanLeungpointofgravity 5 років тому +6

      ayes and no's.

    • @darkazurr9891
      @darkazurr9891 5 років тому +13

      head, shoulder, knees and toes , knees and toes

  • @alextrex3975
    @alextrex3975 5 років тому

    Thanks for video TLDR

  • @gavrielpapas773
    @gavrielpapas773 5 років тому

    TLDR News !
    I'm too exhausted after my work, I can't read articles, but I love your visual presentation and I do give a like whenever it's possible.

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 5 років тому +7

    May lost her voice, but the country lost it's sight when the rethoric of "both sides" became so prevelant. We can not always treat all opinions as valid. We have to accept there are questions without the comforting middle-position. This is one of them, and clearly compromise isn't cutting it. One side has to win, and the other side will have to fight for their view from a changed status quo.
    Are both sides passionate and have good points? Sure, but that changes nothing.

    • @Pedgo1986
      @Pedgo1986 5 років тому +1

      Maybe best solution is held another referendum. If people vote for stay they still can try another brexit after few years and use the time to prepare everything.

    • @alexanderchristopher6237
      @alexanderchristopher6237 5 років тому

      @@Pedgo1986 problem is, how does a post-Brexit Britain will look like? How will their interactions with the EU, which is a big deal economically and politically, will look like? How does a referendum can answer that?

    • @Pedgo1986
      @Pedgo1986 5 років тому

      @@alexanderchristopher6237 thats why you hope for best but prepare for worst. But how this whole thing is unraveling it looks like they have no idea what they are doing and start it just for popularity without any preparation.

  • @Yossus
    @Yossus 5 років тому

    Your videos are wonderful! I don't always have the time to watch the parliament so it's great you show all the interesting bits in full. The background info and explaining is also really nice!

  • @Miniman-hq1zn
    @Miniman-hq1zn 5 років тому +31

    You got a busy week coming up now. It's pretty admirable how fast you are trying to keep up. Keep it up with the good work, but don't try and overwork yourselves. Perhaps a break next week, unless we're in the same position we are now.

  • @smogstreaming
    @smogstreaming 5 років тому +4

    May's voice is as strong and stable as her government.

  • @casperes0912
    @casperes0912 5 років тому

    The fact that you can produce these this quickly and with this high quality is amazing, baffling and greatly appreciated. I love getting these videos this quickly, though knowing how much effort video production requires even with reusable assets like your art and occasionally an animation or two, I almost feel sorry for you, hehe. Great work!

  • @therealmccoy6817
    @therealmccoy6817 5 років тому +9

    Anyone else pissed of with labour seeming more interested in a power with a election rather than pushing for a second referendum

    • @jimporter
      @jimporter 5 років тому +1

      Yes as the two things are separate issues. The Brexit issue and governance of the country as we have seen does not split along party lines and must remain separate, this should be the main driver for a second referendum and let an election come in due course.

    • @therealmccoy6817
      @therealmccoy6817 5 років тому +1

      Jim Porter totally agree but this constant call for another general election is doing more harm than good, his push should be for a second referendum and then try to paint labour as the party that rode in like a white knight to save the country from a brexit disaster at the eleventh hour. After that am sure that they would be very popular come a general election.

    • @therealmccoy6817
      @therealmccoy6817 5 років тому +1

      Night Shade that exactly right, we need a Labour opposition that is willy to do what is desperately needed by the county, if they were pushing for a people’s vote rather than a power grabbing gene election am pretty confident we would get our people’s votes.

  • @ranjith27
    @ranjith27 5 років тому +5

    Who else was coughing when they heard May speaking?

    • @ranjith27
      @ranjith27 5 років тому

      This is my highest liked comment 😂

  • @pedrop1192
    @pedrop1192 5 років тому

    Once again, thanks for covering this matter almost up to the minute!

  • @cyrilio
    @cyrilio 5 років тому

    Super impressed by the amount of videos you make while having a full time job. Thanks for keeping us up to date on these issues.

  • @eleoneell
    @eleoneell 5 років тому

    Thank you so much for your videos! Without you I wouldn't have any clue about what's going on.

  • @liammargetts
    @liammargetts 5 років тому +5

    3:44 if you're an expert at politics and some English studies you can hear a very subtle "yes" from them, just wanted to point it out in case you missed it

  • @LivingIronicallyinEurope
    @LivingIronicallyinEurope 5 років тому

    It's a downward spiral my dudes

  • @jarq19
    @jarq19 5 років тому

    Why can't I find anything about the actual deal? Every news report tells shit about the latest voting but nothing in regards to the deal itself. What did the latest deal state?

  • @mattheweades
    @mattheweades 5 років тому +4

    3:44 you guys have cut everybody saying "no" out? Why

  • @VME-Brad
    @VME-Brad 5 років тому +3

    You cut out the much louder "No" that followed the yes when a second referendum was mentioned.

  • @j.obrien4990
    @j.obrien4990 5 років тому

    If I ever go to England, I will go to a restaurant and start screaming "OrrrrDerrr....Orrderrr" just like the guy at the start of the video....

  • @samsalin
    @samsalin 5 років тому

    its always nice to see people stand up for themselves

  • @cadelaide
    @cadelaide 5 років тому

    Im sorry but as an Aussie I really really love the speaker of your house

  • @TheMixCurator
    @TheMixCurator 5 років тому +3

    I'm really glad we have this Brexit thing going on, as we in the UK have no other pressing political issues occurring currently: no issues with schools or funding, no declining police force struggling to deal with crime, no problems at all with the NHS - the roads and infrastructure too are the best I've ever seen.
    This is now 2 and a half years since 2016 and these "professionals" in charge (they somehow get paid handsomely for this) CANNOT EVEN AGREE ON THE BASICS.
    I'm now at the point of cycling through frustration, disbelief at the events occurring, getting angry whenever another politician lying or just turning to even more withering sarcasm.
    Rant done. Onwards with the shitshow!

    • @Pedgo1986
      @Pedgo1986 5 років тому

      You sa you are from UK may i ask you something. I am curious when referendum was held do you thing people was informed enough about consequences even bad or presented with notion that leaving EU will be super sparkling awesome fixing every problem country have?

    • @TheMixCurator
      @TheMixCurator 5 років тому +1

      @@Pedgo1986 I think the main issue was in the lead up to Cameron calling the 2016 ref, that no-one knew how much the UK and EU co-existed on a trading level - no-one really knew what the EU did, why we were within this trading bloc & what the purpose of it was. People on the street only saw freedom of movement in their everyday lives. People speaking a foreign language seems to make some people feel uneasy. I live in London (born in London too) so I've spent my life in a multicultural society (my parents are also non-English europeans).
      The EU has always been viewed in the UK with suspicion. I remember Boris Johnson writing for the Telegraph in the 1990s about EU laws about Bananas having to be curved (wasn't true). The UK, and the English view anything "other" than themselves as something not to be trusted, from my experience.
      So no, the UK public were wilfully ignorant to what the UK/EU relationship did. I feel we know a lot more about it now. Which is one of the few positives to Brexit. But then you had M. Gove during the campaign to ignore experts too.
      As you can see, its a complicated question you've asked!

    • @Pedgo1986
      @Pedgo1986 5 років тому

      @@TheMixCurator Im not blaming people to dont know but gouverment must know how much are EU and UK entangled together. If i may i ask you about another things. Im not from UK so any information about brexit goes throu idelogical filter in media that why i ask you this silly looking questions like my first question. When this whole thing about referendum start there was only one picture presented (by media in my country) everything will be great and politicians give press conferencess about how great deals they make and nothing bad can happen. So was there any oposition or everything goes on "Evil EU" note. And another thing i wish to know is about May and her stance. Why she never comprise even when she must know she fail? Its stupidity, pride or she want become new "Iron Lady" who freed UK from EU tyranny no matter what? Sorry for english self teaching and not my native language :D

  • @ruochenwang7841
    @ruochenwang7841 5 років тому

    Why did cut out the part when majority of MPs yell “no” back at few of those who said “yes” to the PM’s question “do we want a second referendum? Why? Don’t try sneak in your own little opinion, that’s just cheap. Be objective. Show the whole picture.

  • @nicholasorton17
    @nicholasorton17 5 років тому

    Love these videos soo much. Thank you

  • @Keytaster
    @Keytaster 5 років тому +2

    The way the British Parliarment overestimates its power in the Brexit process is beginning to be comical rather than sad. How many more times does the EU27 have to tell you: take May's deal or you get nothing (no deal) no matter what you debate in your parliarment! Any extension needs a VERY convincing explanation (people's vote)... or you can finally end this shit show and revoke article 50. FFS, this is annoying beyond belief...

    • @lellyparker
      @lellyparker 5 років тому

      I am beginning to think the government has to go through this so the country think they tried. But at the end of the day there is no solution to the Irish border problem and no political party wants to be the one to break the Good Friday Agreement even though they all know it is what needs to happen to execute Brexit. May's deal basically put off deciding what to do with Northern Ireland until some indefinite time in the future but everyone knows the problem will not be fixable in the future any more than it is fixable today. So I think their options are to stand up and be known as the party to break the Good Friday Agreement or let Brexit fail. Every party is in the same boat, so I suspect that Brexit is not going to happen and this is all just pantomime.

  • @santamariamarvy
    @santamariamarvy 5 років тому

    Oposiion hinks he deal is not sufficient but fails o realize there is no other deal. EU will not risk dissolution for UK. You already took so much from them with the current arrangement yet you want more whilst avoiding obligations. The nerve.

  • @juanfelipeleyvaacero8186
    @juanfelipeleyvaacero8186 5 років тому

    😂🤣 love how you cut out the noooooooooooo from MP's in the second referendum

  • @Pidove727
    @Pidove727 5 років тому +1

    If i was to write a book where the Prime Minister lost her voice, as her deal was rejected, and the country began plunging into chaos, the publishers would reject it for being too on the nose 😂

  • @swanky_yuropean7514
    @swanky_yuropean7514 5 років тому +1

    Doesn't the UK have a spare Maybot in the case one breaks down? Or is the other one also in maintenance?

    • @Slainte-Mhath
      @Slainte-Mhath 5 років тому

      Sure do. She is on the Last Leg now and again.

  • @spectre2635
    @spectre2635 5 років тому +2

    Oh Jeremy, if he truly wanted to avoid no deal, he would have had his party vote for this deal. Those things he listed, May tried to get them in her deal, but the EU had none of it so we had to compromise and go with Mays current deal, does he not understand that the EU will not budge now?

    • @davianthule2035
      @davianthule2035 5 років тому

      What are you talking about? May didn’t push for a CU or SM access

  • @bmyers8356
    @bmyers8356 5 років тому

    As a curious Yankee, I’m wondering about the 2nd worst loss by a sitting Government.

  • @darkness21princess
    @darkness21princess 5 років тому

    They should do another referendum to see what the people say now that they are grasping in the reality of what it would actually mean to leave.

  • @jennyj0007
    @jennyj0007 5 років тому

    Thanks for your explanation.

  • @meevil24
    @meevil24 5 років тому +15

    *Pretends to be shocked*

  • @themaximus144
    @themaximus144 5 років тому +1

    I love how dramatic everything in British parliament looks and sounds. All the here here's after everything someone says really adds to it. We could definitely use more hear hearing in the U.S. house and Senate lol.

  • @GuyNamedSean
    @GuyNamedSean 5 років тому

    I can't be the only person that heard someone shout "What about a general election?" at May.

  • @georgeveltchev530
    @georgeveltchev530 5 років тому

    as an outsider here in Africa I can say .... ' immensely entertaining circus folks ' ! The sad reality is that we are even in a deeper mess ... damn this humanity !

  • @seanezeh2290
    @seanezeh2290 5 років тому

    The immense shock robbed May of her voice

  • @NeilOosthuizen
    @NeilOosthuizen 5 років тому

    Sitting here on the other side of the world, being a newly registered UK citizen trying to get myself and my family re-allocated to the UK, it starts feeling like out of the frying pan into the fire :/

  • @ΔημήτρηςΜπινιάρης-π2δ

    The only thing that is perfectly clear is that there isn't a single person in the UK and abroad that has the slightest idea of what both the HoC and more importantly the people of the UK really want out of all this brexit mess! The perception for us outside the UK is that the people didn't know what they voted for, that the country is divided on all levels and that the so called establishment has created this mess and now has no idea how to get the country out of it! Some in the UK are nostalgic about the days of the empire (!), some are xenophobic , blaming the foreigners (EU and immigrants) for the country's problems, some are in denial regarding the global status quo (globalisation of the economy, terrorisme etc) and almost everyone is pretty ignorant about the basics of today's Britain concerning the economy, law making, international relations etc! This brexit thing hopefully will be a loud wake-up call for the voters!

    • @Slainte-Mhath
      @Slainte-Mhath 5 років тому

      The people did know what they were voting for, they voted to have their cake and to eat it too. Sadly reality is somewhat different and others involved say that cake is theirs too.

  • @peebs1701
    @peebs1701 5 років тому

    If Parliament rejects leaving without a deal AND votes against an extension what will happen? OK, realistically the UK crashes out, but what will they try to do?

  • @Zoks39
    @Zoks39 5 років тому +2

    Why did you cut the video at 3.45

  • @andyboy3070
    @andyboy3070 5 років тому

    what was the 2nd biggest parliment defect

  • @iddomargalit-friedman3897
    @iddomargalit-friedman3897 5 років тому +1

    How about a video of how the UK could deal with possible violence in NIR in case of no-deal?
    That might just end up to be the case.

  • @boptah7489
    @boptah7489 5 років тому

    The fact that TM is giving a free vote to her cabinet means she is not intending to support government policy . which is " no deal is better than a bad deal".

  • @colonelgraff9198
    @colonelgraff9198 5 років тому +14

    0:09 Brexit in one word

  • @moyamacgregor6739
    @moyamacgregor6739 5 років тому +9

    Thank You TLDR, appreciate your (generous hearted) work.

  • @ninawernick6501
    @ninawernick6501 5 років тому +3

    My heart bleeds for Ms May. I mean, I'm on the side thinking the whole Brexit is a fool's errand. That said, she truly seems to be doing the best one can under the circumstances. Now she's clearly getting sick, has no support for her decisions, but also is forced to remain in place to keep making those decisions. Good lord. I can only admire that she's not resigning and moving to a lovely tropical island somewhere, where no one will ever bother her with politics again.

  • @whoknew2273
    @whoknew2273 5 років тому

    Next statement she read she have a sign language assistant at her side lol

  • @taegiseoktrash8874
    @taegiseoktrash8874 5 років тому

    I left the UK back in 2017 and for a long time I was simply too bitter to keep up with the whole Brexit thing. Now I'm trying to re-educate myself on the subject matter.
    I'm a bit confused about Corbyn, can someone explain this to me? He doesn't want to leave the EU without a deal and he doesn't want May's deal, and he's insisting on putting forward the proposals for "a negotiated customs union, access to the market and the protection of rights" but how is he gonna get those things? The EU has already stated they are not interested in renegotiating the current deal and I'm pretty sure that the UK is in no position to make a whole new (more favourable) deal?

    • @RobertWhittaker1
      @RobertWhittaker1 5 років тому

      Partly it is easy to sit in opposition and state things that have no chance of being tested, or the other thought is that the deal we have is the best given the government's red lines, he's tearing these up and in doing so creating more room for negotiation.

  • @maxfriis
    @maxfriis 5 років тому +2

    Lost everything for this channel when I saw the edit at 3:40.
    I support remain and I want edited news filtering the information, but I want it to try to reflect reality fairly. Deleting the ERG's answer to the spontaneous sympathy for a second referendum is an unforgivable crime imo. I can not see a valid reason for trying to manipulate me like this.
    So sad - I was a big fan of the channel :(

    • @steveyrock1
      @steveyrock1 5 років тому

      Is this because the edits were for her word and not for the reaction of the crowd?

    • @maxfriis
      @maxfriis 5 років тому

      @@steveyrock1 I see several edits in the stuff from parliament trying to make it shorter. Guess they are very true to there TLDR motto and really want to make it short. The problem with this edit is that it's too biased. It was possible to edit out both reactions if the focus was making it short.

    • @steveyrock1
      @steveyrock1 5 років тому

      @@maxfriis It's hard to edit out reactions without cutting someone off mid sentence. It's not like reactions start after some one is done speaking. We are just getting a bit of the first reaction because there is overlap.

    • @steveyrock1
      @steveyrock1 5 років тому

      I am not saying there isn't Bias. There is bias in all reporting. I am just say, I can understand this one.

  • @jonyijoe
    @jonyijoe 5 років тому +4

    At 3:40 you edited out the loud objections against a second referendum yet kept in the loud support for it. I thought this was meant to be unbiased?

    • @jonyijoe
      @jonyijoe 5 років тому

      Ethan M Kindly shut it. The edit was so obvious and precise.

    • @jonyijoe
      @jonyijoe 5 років тому

      Ethan M *slow clap*

  • @neuronbob
    @neuronbob 5 років тому

    Thank you so much for making Brexit understandable for this American, who lived in England as a child. Have followed the entire series so far. Seems to me the road forward is a delay and second advisory referendum. Hopefully the British government will find a way out of this blind corner.

  • @PatrickPereiraVieira04
    @PatrickPereiraVieira04 5 років тому

    So you do podcasts at all? I normally just walk around listening to you talk about Brexit with UA-cam open. Most of the time I don't even watch the animation 😮

  • @1urie1
    @1urie1 5 років тому

    Maybe someone should have explained Brexit harder than ever before UK got itself into this mess.

  • @dougdawson3232
    @dougdawson3232 5 років тому +6

    Fantastic videos! Stay healthy and keep up the good work! :)

    • @HRRN-gh3wj
      @HRRN-gh3wj 5 років тому

      Pffft that profile pic... A tad egotistical perhaps?

    • @dougdawson3232
      @dougdawson3232 5 років тому +1

      @@HRRN-gh3wj Why? I'm comfortable with my body and I don't really mind showing off a bit when I am proud of my achievement. Feel free to show off your ego sometimes! :)

    • @HRRN-gh3wj
      @HRRN-gh3wj 5 років тому

      @@dougdawson3232 ah each to their own I guess. Fair enough

  • @davidbautista351
    @davidbautista351 5 років тому +2

    more exiting than ever

  • @Jeffcrocodile
    @Jeffcrocodile 5 років тому +10

    Brexit...the gift that keeps on giving. Hoping for an extension so the comedy can last longer.

    • @lellyparker
      @lellyparker 5 років тому

      Don't worry. When this is over we're going to rescind Decimalisation.

    • @Evan490BC
      @Evan490BC 5 років тому

      Hardly. There is a strict deadline, and this is before the European parliament elections.

  • @literate-aside
    @literate-aside 5 років тому

    I’ve lost a great deal of faith in our parliament. Not our government, I didn’t like Theresa May, but damn that woman has balls and tenacity. But our parliament? What a disappointment.

  • @cameronspalding9792
    @cameronspalding9792 5 років тому

    ORDER!!!!!!

  • @mariuszkonieczny3393
    @mariuszkonieczny3393 5 років тому

    What a mess...

  • @joshuaparrott2458
    @joshuaparrott2458 5 років тому

    Oh boy, I can't even guess what's next

  • @leodouskyron5671
    @leodouskyron5671 5 років тому

    Is there even a reason for them to do Brexit with such British resolve? I mean I am enjoying the show and hearing PM May’s voice eating itself like her policy is eating the UK’s future, but I just don’t see a reason to proceed.

  • @alinamihai89
    @alinamihai89 5 років тому

    Ur videos are so good can't imagine the work behind.

  • @nwabuezeozuzu6370
    @nwabuezeozuzu6370 5 років тому

    At this point it is very clear the UK will not leave the EU!

  • @maggiee639
    @maggiee639 5 років тому

    We are watching the world burn....😕

  • @whoknew2273
    @whoknew2273 5 років тому +4

    Leave in a Orderly way she like a Kingarten Teacher trying to orgainse a Day out lol

  • @ColonizerChan
    @ColonizerChan 5 років тому +5

    Goodness, that raspy voice May has, is she okay?

  • @MH-ji6td
    @MH-ji6td 5 років тому

    The speaker sounds like his calling bingo on grumpy night

  • @Electroaurora
    @Electroaurora 5 років тому

    How to sum up Brexit : ORDAAAAAAAAAAAAAAAA!!! hahahahaahahha :D

  • @The_Angry_BeEconomist
    @The_Angry_BeEconomist 5 років тому

    so much credits, do all those people get paid?

  • @jesusurrabieta9700
    @jesusurrabieta9700 5 років тому

    Hi there. If an outsider might ask: those comments after each sentence from the prime minister saying "yeah, yeah, yeah". Are supportive or sarcastic? I cannot tell...

  • @SlickReviews
    @SlickReviews 5 років тому

    So re-voting is only ok when it’s the tories 🙃🙃🙃🙃

  • @martizasas
    @martizasas 5 років тому

    Why so late you do this?

  • @duran9664
    @duran9664 5 років тому

    Please don’t extend this. The whole world is sick of this selfish boring drama..

  • @BigBawMcGraw
    @BigBawMcGraw 5 років тому +4

    Disappointed that you do the same as the BBC and Sky news and cut what the 3rd largest party in Westminster has to say.

  • @Rgsetters
    @Rgsetters 5 років тому +6

    I am sorry... I know you try to be unbiased but I watched this last night live. In your video at 3:43 when May asked does the house want a second referendum you have all those in favour shouting ''YES'' but you cut out the immediate response from those against who shout ''NO'' with not so slick editing.
    Your editing makes it appear, to those who don't follow this so closely, that the whole house wants a second referendum when that's far from true.
    It is hard to completely remove bias, but I do think you should indicate which way you voted so there is complete transparency on any potential bias this channel holds.

    • @Pidove727
      @Pidove727 5 років тому +2

      Honestly i don't see how anyone, when in full possession of the facts, especially someone as informed as TLDR News, could lean towards leave.
      Another point but announcing which way one voted in the 2016 ref also has no indication of what they believe now, as so many people have changed their minds, when the facts have become clearer.

    • @Rgsetters
      @Rgsetters 5 років тому

      @@Pidove727 I just know this channel strives to appear unbiased and it seems shady when they edit out leave sentiment from MPs. It would appear to me to be a sensible position to be transparent and let us know how they voted and whether or not they've changed there mind at all.
      Also you're point about facts are largely unfounded as there are no facts about how the UK would be economically after leaving the EU. As it hadn't happened everything is based on predictions and they can be wrong, even with sophisticated modelling. Look at the referendum result for example, definitely a wrong prediction, even with many polls saying contrary.
      Also people might not vote on economic basis, they might prefer what they might think of the UK Post brexit culturally for example. Again no facts on that either.
      Just asking for transparency if they want us to trust their content.

    • @TorianTammas
      @TorianTammas 5 років тому

      Rob Setting - I am always amazed what demands people have on stuff they consume for free. Could we not be happy to be provided with it?

    • @Rgsetters
      @Rgsetters 5 років тому

      @@TorianTammas I am happy, but I wouldn't present myself as unbias and then be quite blatantly bias.
      Also I appreciate TLDR News aren't behind a pay wall. Some people support them on patreon. But they run ads on their channel and good for them! So whilst it doesn't cost me money personally it does cost me time watching ads and makes the channel money.
      By the way, I like the channel which is why I watch it. Just giving feedback my friend.

    • @Rgsetters
      @Rgsetters 5 років тому

      @@TorianTammas incidentally I provided that comment you responded to for free. No ads! You consumed it and then complained about it. Might not be as valuable as a whole video but you could PayPal me a penny or two.

  • @mezworsley1150
    @mezworsley1150 5 років тому

    Does she knows the outcome of leaving the eu? The only thing we grow in the UK is potatoes and onions and everything else is getting imported that means rest of the world will charge us anything they want.

  • @xslytitanx
    @xslytitanx 5 років тому +2

    Love these videos. It has been so hard to get unbiased information on Brexit. Keep it up!