COVID-19 Reinfections Are a Thing: Here’s What We Know So Far | SciShow News

Поділитися
Вставка
  • Опубліковано 16 лис 2024

КОМЕНТАРІ • 1,1 тис.

  • @jtiza
    @jtiza 4 роки тому +2369

    Just want to say I REALLY appreciate your pre-episode disclaimer with the date and playlist for future videos. It's refreshing to see folks taking accuracy seriously on such a serious topic.

    • @TheZenytram
      @TheZenytram 4 роки тому +27

      I think this should be in every science related video on internet.

    • @Just1Lis
      @Just1Lis 4 роки тому +7

      @Cerberus only if you believe him and not the CDC

    • @Just1Lis
      @Just1Lis 4 роки тому +6

      @Cerberus oh FFS....I missed that. But I just found an article about this. ....sigh.....

    • @vasectomyfail442
      @vasectomyfail442 4 роки тому +4

      @Cerberus orange man bad

    • @semaj_5022
      @semaj_5022 4 роки тому +8

      Their attention to accuracy and always providing citations and sources is why I have been watching this channel for the better part of a decade. They've definitely been a breath of fresh air in the current environment of opinion charged media.

  • @blacktimhoward4322
    @blacktimhoward4322 4 роки тому +1022

    "I'm sorry to say this so much, but we do not have enough information"
    PLEASE please say it. Say it whenever it applies. It's the people who don't admit it that scare me

    • @HoloFizz
      @HoloFizz 4 роки тому +32

      YES! exactly. I wish more people would be honest up front instead of failing to mention things like that. It can cause confusion, more harm than good.

    • @thebasketballhistorian3291
      @thebasketballhistorian3291 4 роки тому +16

      These days, my favorite is when someone starts off a sentence about COVID with...
      "I've heard that..."
      "Some people say..."
      "According to my sources..."
      And this person never says who they heard it from, who these people are, or what these sources are, lol.

    • @solar0wind
      @solar0wind 4 роки тому +10

      @@thebasketballhistorian3291 "According to my sources" is something that I could say, although I would provide all sources that I remember.
      The thing isn't that people often don't give sources, it's that these sources often suck, at least in my family. I guess we all have this "sceptical" family member, and if yours has a degree in a science, it's way harder to see why the arguments don't make any sense because at first they obviously sound good because the person writing it is educated and smart. The arguments are still wrong and the sources given by this person often don't prove any point they have made. But when I dare to say this or any counterarguments, I don't get any answer. Maybe I get another statistic that doesn't prove anything the person said. And then they wonder (according to another family member) what "weird" opinions I have. Just tragic. It shows that just because you studied a science decades ago, it doesn't mean you have a scientific way of thinking.

    • @crushsatan
      @crushsatan 4 роки тому +1

      That's a perfectly valid way of starting off a sentence.

    • @lilaclizard4504
      @lilaclizard4504 4 роки тому +11

      This is why Australia has done so well overall. In early February our government declared a pandemic & released the pandemic management plan to the public, which basically said they didn't have a clue what was going to happen BUT they also laid out 3 different potential scenarios of seriousness & the actions they had planned for each & made us feel really confident that we'd get through it together & they were going to be honest with us on everything.
      Had some issue in one state where people got their information from overseas rather than the Australian government & the Oz government were too slow to notice that had happened, but overall we've done well because they've been honest with us & so we trust them

  • @Nulibrium
    @Nulibrium 4 роки тому +650

    You should never apologise for saying you don't have enough information, the danger is when the media jump to unfounded conclusions.

    • @theyredistortingyourrhthym8883
      @theyredistortingyourrhthym8883 4 роки тому +3

      10 months on
      0 phantom deaths
      Northern Territory
      Aboriginal Australian
      pregnant mum
      person under 20
      nurse/doctor/police/military
      biosecurity sector/airline sector/public transport sector
      childcare employee/university employee,student
      ALL Australian school students
      0 virus
      Millions AWAKE.

    • @alexesteh
      @alexesteh 4 роки тому +8

      I didn't take it as an apology, just that they, the SciShow team, are "sorry" that we, the population as a whole, don't have enough information. And I appreciate that.

    • @stanleyc2978
      @stanleyc2978 4 роки тому +14

      @@theyredistortingyourrhthym8883 *Extremely secluded group with little contact with outsiders of Australia, let alone globally, with no one actually recorded their communities did not report any COVID infections*

    • @ManuLeach
      @ManuLeach 4 роки тому +3

      @@BeaMeUpMrScott did you even read the link I sent? It explains how the primers work in pairs and your sequence matcges the reverse primer and does show up in the human genome but the sequence that matches the forwards primer doesn't show up anywhere on chromosome 8. Therefore it doesn't amplify the human genome. In fact, that WHO protocol you sent me corroborates this.
      If it detects the human genome as a false positive, why are only 9% of the PCR tests positive?

    • @ManuLeach
      @ManuLeach 4 роки тому +2

      @@BeaMeUpMrScott why are you ingoring the fact that the test won't give a positive if it only finds the sequence that matches the reverse primer? Yes, you're right that it's a sequence that's also found in chormosone 8 but that's fine as the forwards primer isn't matched in chromsone 8.

  • @robranney-blake8731
    @robranney-blake8731 4 роки тому +2059

    Thanks for being a reliable news source.

    • @airplanemxde
      @airplanemxde 4 роки тому +23

      Brought to you by PBS

    • @robranney-blake8731
      @robranney-blake8731 4 роки тому +50

      I’m old enough to know who has been reliable and who has proven untrustworthy. PBS rocks, as does NPR.

    • @TheWalz15
      @TheWalz15 4 роки тому +14

      Seriously! I trust them that they did their research.

    • @Krystalmyth
      @Krystalmyth 4 роки тому +1

      Bet you all watch Fox News.

    • @Zecronym
      @Zecronym 4 роки тому +19

      @@Krystalmyth ??? Lmao

  • @itsthevoiceman
    @itsthevoiceman 4 роки тому +342

    3:54 - I'd rather "we do not have enough information: be said MORE often, than making opposite claims of certainty.

    • @conlon4332
      @conlon4332 4 роки тому +7

      Yep. Just wanted to point out you forget your end quote. 😊

    • @FlyingDwarfman
      @FlyingDwarfman 4 роки тому +1

      @@conlon4332 Or rather, they had a slight typo, hitting shift+; to make a [:] instead of shift+' to make a ["]

    • @conlon4332
      @conlon4332 4 роки тому +2

      @@FlyingDwarfman Oh. On my keyboard they're nowhere near each other. I have shift+; to make :, then to the right I have shift+' to make @. My " is all the way on the other side with shift+2.

  • @TragoudistrosMPH
    @TragoudistrosMPH 4 роки тому +551

    Refreshing to hear actual information and not just uninformed *strong* opinions from people who know nothing about virology...

    • @TragoudistrosMPH
      @TragoudistrosMPH 4 роки тому +71

      @Commander Spock ... or you could note how they cite their sources and you could read for yourself.
      You provide an example of a strong opinion without the underlying basic facts being accounted for... (citations and the fact that no one considers SciShowa peer reviewed journal). Arguing against something no one actually said. 😕

    • @richieThach
      @richieThach 4 роки тому +39

      @Commander Spock Your argument was most illogical.

    • @xponen
      @xponen 4 роки тому +3

      strong opinion usually trigger strong debate from the opposite side. If someone just reference and report a news then it usually passable and don't motivate people to fight.

    • @disorganizedorg
      @disorganizedorg 4 роки тому +4

      @@TragoudistrosMPH Read? "Commander Spock"? I don't fully grasp your sense of humor.

    • @ericb4127
      @ericb4127 4 роки тому +2

      @@TragoudistrosMPH Just because one person's opinion comes complete with word salad articles and pretty graphs doesn't make it anymore meaningful than someone's monosyllabic counter opinion.
      You might wanna start looking around you and see the destruction that has been caused by the Draconian lock Downs and while you're at it ask how many people you personally know died from covid and I mean covid only in the last 6 months.

  • @CraigHarris101
    @CraigHarris101 4 роки тому +114

    The fact that I live in the UK and trust this more than most on news tells u something. Anyway keep the info coming

    • @SarahArielBelle
      @SarahArielBelle 4 роки тому +4

      Same here!

    • @FlyingDwarfman
      @FlyingDwarfman 4 роки тому +3

      An unfortunate trait of most mainstream news is that it has always been very distant from scientific sources.
      Not to imply you mean or think this, but the common belief that modern news is unique in this way would be untrue.

    • @yw5617
      @yw5617 4 роки тому

      Same, the only new source that is consistently scientific.

    • @MaryAnnNytowl
      @MaryAnnNytowl 4 роки тому

      The same feeling exists in at least one other country that I know of due to direct observation. 🙄

  • @davidlazarus67
    @davidlazarus67 4 роки тому +67

    Having accurate even if incomplete information does help us to make better decisions. I am so glad I have remained in self isolation.

  • @Richard_Jones
    @Richard_Jones 4 роки тому +271

    Ahh, SciShow. Never has doubt felt so comforting.

    • @sandrastreifel6452
      @sandrastreifel6452 4 роки тому +20

      Richard Jones: Isn’t it great that they’re honest and up-front about what’s NOT known?

    • @FaffyWaffles
      @FaffyWaffles 4 роки тому +6

      @@sandrastreifel6452 I showing these comments to my friends, this is exactly what I'm trying to tell people

    • @pierreluc5382
      @pierreluc5382 4 роки тому +1

      wait what.. science doesn't know everything?
      No, and that's the beauty of it

  • @jasonnugent963
    @jasonnugent963 4 роки тому +120

    As someone who spent 38 days in the Hospital (16 of those days in ICU on a Ventilator),.. I’m not sure how to feel about this. I’d like to think given how severe my case was the 1st time, that I have some pretty good immunity now, but I’m also still wearing a mask everywhere and distancing wherever possible.

    • @noahludford3667
      @noahludford3667 4 роки тому

      Ted Nugent in your family?

    • @nosuchthing8
      @nosuchthing8 4 роки тому +3

      We all hope you recover and stay healthy? Do you know how you were infected?

    • @taritangeo4948
      @taritangeo4948 4 роки тому +8

      Thats what everyone should do whether they were infected or not. Dont be a rat licker

    • @limiv5272
      @limiv5272 4 роки тому +10

      Until we know more you're doing the right thing by social distancing and wearing a mask. I hope you're doing well now

    • @disorganizedorg
      @disorganizedorg 4 роки тому +15

      I'm glad you pulled through! Even if it were iron-clad that once infected people are immune, wearing a mask is still a good idea if only to set a good example and avoid normalizing people making spurious claims for exemption. *SMH* If your respiratory tidal volume is so small that the tiny amount of added CO2 from re-breathing is an issue for you, you should not be out in public in the first place; you should be hospitalized for the (likely imagined) difficulty. Perhaps someone can put such people in the hospital.

  • @kevinhackbarth9617
    @kevinhackbarth9617 4 роки тому +111

    Important correction: the Hong Kong patient did not get a different "strain" of SARS-CoV-2. Technically, a different "strain" means a virus that functions differently. For cases like this where the nucleotide sequence is different but we don't think there's a functional difference, you can call it a different "variant" or "isolate". So far there isn't evidence that there are more than one strain of SARS-CoV-2.

    • @masondickerson9466
      @masondickerson9466 4 роки тому +6

      Thank you so much, that's really good info to know.

    • @ValeriePallaoro
      @ValeriePallaoro 4 роки тому +5

      Thanks so much. I was having trouble with this myself; you've worded it perfectly. Much appreciated.

    • @ValeriePallaoro
      @ValeriePallaoro 4 роки тому +2

      I wish you got more likes cause this is very relevant

    • @pierreluc5382
      @pierreluc5382 4 роки тому +3

      SCISHOW!
      confirm and pin this comment!

    • @FlyingDwarfman
      @FlyingDwarfman 4 роки тому +6

      I wonder if it may have been an uncaught spoken error. The captions don't show "strain", but rather "version".
      That said, like another requested, let's get this pinned @SciShow!

  • @TakToyooka
    @TakToyooka 4 роки тому +127

    3:53 Don't apologize for saying "we don't have enough information"! Normalize admitting ignorance.

    • @noahludford3667
      @noahludford3667 4 роки тому +1

      That's gotta be the wisest thing I've read today. Kudos 👍

    • @nofanfelani6924
      @nofanfelani6924 4 роки тому

      They don't want people to get offended or disliking the video just because of it.
      This is the internet and there are many kind of people out here.

    • @disorganizedorg
      @disorganizedorg 4 роки тому +1

      I can think of a politician or two that would burst into flames if they were ever forced to admit they didn't know everything. I'm sure everyone can think of their own politician(s) this applies to.

    • @bramvanduijn8086
      @bramvanduijn8086 4 роки тому +1

      @@disorganizedorg It's in the job description, or to be more precise, it is part of the training (by which I mean the process of getting elected, not literal training).

    • @marlonmoncrieffe0728
      @marlonmoncrieffe0728 4 роки тому +1

      I think he means that he is sorry for disappointing us.

  • @warrenphilips8441
    @warrenphilips8441 4 роки тому +20

    You don't have to apologize for always saying "more research is needed." It should always be assumed, but it isn't, so it should always be said. Science is not a creator of truth or even a determiner of truth, as what was once thought to be truth often changes. Science is a seeker of truth, and that requires humility.

  • @katerinaschenke819
    @katerinaschenke819 4 роки тому +37

    Im glad he called it physically distancing. You want to physically be 6 feet away but still socialize.

    • @CarrotConsumer
      @CarrotConsumer 4 роки тому +1

      Anyone with half a brain understands what social distancing means.

    • @culwin
      @culwin 4 роки тому +1

      I don't want to socialize.

    • @nickl2854
      @nickl2854 4 роки тому +5

      @@CarrotConsumer Yeah but social distancing is the most annoying term I've ever heard in my life

    • @huangec
      @huangec 4 роки тому +3

      I've been using "physical" distancing instead of "social" since they started talking about this too. I really dislike the negative connotations of the latter.

    • @culwin
      @culwin 4 роки тому

      @@huangec There isn't any negative connotation of it.

  • @DoctorX17
    @DoctorX17 4 роки тому +289

    'Physical distancing' hurts my soul less than 'social distancing'

    • @Krystalmyth
      @Krystalmyth 4 роки тому +17

      If you have a soul, not doing either should hurt you more.

    • @Gutsey
      @Gutsey 4 роки тому +26

      Im good at social distancing, ive been doing it for the past 21 years!

    • @DoctorX17
      @DoctorX17 4 роки тому +9

      @@Krystalmyth I mean I prefer the term 'physical distancing' over 'social distancing'. I've been staying in my house this whole time

    • @DoctorX17
      @DoctorX17 4 роки тому

      @@Gutsey lol

    • @ooooneeee
      @ooooneeee 4 роки тому +9

      Yeah they changed the term because it's about physical distance, not emotional distance.

  • @DiybyUnclenui
    @DiybyUnclenui 4 роки тому +11

    May you all be safe

  • @wamsang7818
    @wamsang7818 4 роки тому +84

    And here, we have a rare specimen:
    An impartial video on COVID19

  • @01eocoe10
    @01eocoe10 4 роки тому +6

    Thanks so much for being clear about what is known, what is new information, and what is not yet known. Really helps manage my anxiety around the disease.

  • @chrisdugmore2462
    @chrisdugmore2462 4 роки тому +17

    "I'm sorry to say this so much, but we do not have enough information"
    And this ladies and gentleman is why we need scientists!

  • @amarug
    @amarug 4 роки тому +14

    Thanks for the neutral, factual updates. I am so absolutely sick of and done with this pandemic. I just want it to be gone and forgotten.

  • @wonderwend1
    @wonderwend1 4 роки тому +55

    Yours is the only info I trust.

    • @airplanemxde
      @airplanemxde 4 роки тому +3

      Very wise decision

    • @ButtMcDuck
      @ButtMcDuck 4 роки тому +7

      @john smith yeah he needs to go to the flat-earth but somehow the matrix, anti-vax, religious but not really, fascist hole of the internet to allow our society to degrade more. I mean get rid of all those none whi.... i mean own those libtar... i mean practice real "science". The same things people thought during historic dark ages, but don't mind that. Just follow the leader 🙃

    • @frankly2677
      @frankly2677 4 роки тому +4

      Sideways N i love this can i steal it to troll republicans? 🥴

    • @ButtMcDuck
      @ButtMcDuck 4 роки тому +3

      @@frankly2677 lol yeah that's fine and dandy with me

    • @sandrastreifel6452
      @sandrastreifel6452 4 роки тому +3

      Sideways N: Love your comment!😂

  • @NeuromodulatorNetwork
    @NeuromodulatorNetwork 4 роки тому +76

    As a Harvard neuroscientist who has now provided professional scientific editing/consulting for 50+ COVID-19 studies since the initial outbreak, I'll soon be releasing vids on the up-to-date science behind COVID and SARS-CoV-2. Cheers. 🧠💕🌎

    • @watsoniancrickston2824
      @watsoniancrickston2824 4 роки тому +5

      Sounds like an insightful perspective. Subbed and looking forward to it.

    • @blacktimhoward4322
      @blacktimhoward4322 4 роки тому +22

      Sir this is the internet, we don't take kindly to actual experts

    • @candya1040
      @candya1040 4 роки тому

      Look forward to it.😊

    • @garrett6064
      @garrett6064 4 роки тому

      I'm a Harvard scientist too!

    • @cloudsephiroth6701
      @cloudsephiroth6701 4 роки тому +8

      @@garrett6064 Yeah well his channel actually gives proof that he is. You can search his Gscholar and it shows his verified Harvard email.

  • @thatsmrfisher
    @thatsmrfisher 4 роки тому +7

    I honestly would like to understand the dislikes on a video like this? Do you feel something was inaccurate?
    Personally I’m grateful for these bite size updates as the situation is still unfolding

  • @RCSVirginia
    @RCSVirginia 4 роки тому +17

    " One and Done"--Many people have had relationships like that.

    • @3800S1
      @3800S1 4 роки тому +1

      You're not wrong.

  • @ambertapping7919
    @ambertapping7919 4 роки тому +3

    I'd be interested to know if those folks who were re-infected still had antibodies from their previous infection, given that it's very likely that we don't hold on to our COVID-19 antibodies indefinitely. I had a positive antibody test 2 weeks ago (NHS worker) and whilst I don't know for sure, my best guess is that I had COVID-19 in late March as that's when I lost my sense of smell. That seems to be on the longer end of how long they think we're keeping the antibodies stocked up for. If it was possible I'd love to get tested every week to see how long they last.

  • @Saplingbat
    @Saplingbat 4 роки тому +1

    Bless you, admitting you don't know everything is so so sooo much more important than pretending you do.

  • @Fkazuo24
    @Fkazuo24 4 роки тому +5

    I'm not sure (cause I didn't test) but I got the disease at least twice in March-April. The first time was horrible, intense fatigue, fever and some discomfort breathing. The second time was a little bit less fatigued and no breathing impairment. There was a third time with a very mild fatigue. That's what living in a country where the president itself minimizes the disease, even though we at home took the precautions against it (both the president and the virus)

  • @ArranitM
    @ArranitM 4 роки тому +2

    You guys are doing wonderfully, keeping us updated beyond the informative videos. Thank you for putting care into getting the most up to date information that you can.

  • @geekjokes8458
    @geekjokes8458 4 роки тому +19

    important to note that we dont have enough information about reinfection because the virus is SO YOUNG, there simply hasnt been enough time for us to see *cycles* of spreading - even though the normal period of recovery is 2-3 weeks
    HOWEVER, even if you consider merely reported, not even confirmed, reinfection, there's been around TEN cases
    worldwide
    *out of **_30 MILLION_*
    we should have definitely seen more cases by now if it were common

    • @leenlovesdancing3561
      @leenlovesdancing3561 4 роки тому

      Thanks 😃
      The media really scared me.

    • @taritangeo4948
      @taritangeo4948 4 роки тому

      When you put things lime that...

    • @firstlast5454
      @firstlast5454 4 роки тому

      I was just about to ask WHY are we only getting 2 reliable sources of reinfection with so many cases worldwide

    • @limiv5272
      @limiv5272 4 роки тому

      That's what I've been thinking. I'm just worried that the low number of confirmed reinfections is due to people not being tested the first time they got Covid-19 or healthcare professionals thinking a new infection is a continuation of a previous one without checking. Sequencing a viral infection isn't routine at all so we might be missing a lot of cases. I guess we'll find out

    • @geekjokes8458
      @geekjokes8458 4 роки тому

      @@leenlovesdancing3561 its important not to panic but please dont take it lightly
      be a little scared

  • @WhereWhoMe
    @WhereWhoMe 4 роки тому +1

    Thank you SciShow for posting all that you do, especially with COVID-19. The fact that you date the videos, and the reminder that you are telling us things as they are being discovered, even though more information is needed.

  • @vladistic7500
    @vladistic7500 4 роки тому +4

    I want to thank you guys for producing videos based in FACTS & SCIENCE. It really helps me answer questions for my young children. I will continue to turn to you guys for your awesome videos that keep us up to date on whats REALLY going on.

  • @Cancer6667
    @Cancer6667 4 роки тому +1

    I work in a big store, up to this day there are as far as i know anywhere between 4-7 co-workers infected. Me myself was hospitalized for 10 days and was under treatment.
    I was asymptomatic mostly, just lost my smell/taste for 2-3 days then they came back. I took 2 tests before i was hospitalized and both were positive, got out of hospital with a 3'rd, negative test.
    I will have to go back to work in 7 day's time. Out of these 4-7 other cases at work, no one reported anything to anyone and just stay home. I am REALLY nervous about going back there to be honest.
    They are trying to hide the infections of our own workforce so the store isn't closed (f***ing money) and the higher ups are basically waiting for all of us to drop like flies, or until someone will actually die of this. The fact you could get reinfected and possibly have more severe 2'nd time symptoms makes me feel very uncomfortable but all this is beyond our own power. All we, and i can do is hope that when we will catch the virus again, it will not be worse than the first time.
    Stay strong everyone, take good care of yourselves because your bosses can only think about money, not your health, animals.

    • @sparkle1596
      @sparkle1596 4 роки тому

      Oh i'm so sorry to hear that. :( It does sound really scary. I hope you stay safe and please be as careful as you can for yourself!

  • @KarinIris123
    @KarinIris123 4 роки тому +4

    I actually am someone who got chicken pox twice in my life because the first case wasn't severe. 2nd case was about the same as the first one for me.

  • @TheGiver33
    @TheGiver33 4 роки тому +1

    I want to weigh in with my experience as a pharmacist in the ICU. I have seen two patients since I started a month and a half ago at my particular hospital who seem to have been reinfected with COVID-19. Both cases had mild cases in mid july, and came to the ICU late august and early september with much more severe symptoms. Out infectious disease physician was excited to document these cases as reinfections at first, but we don't routinely store all of the COVID tests and we didn't have the sample of these patients from the first time they had tested positive to compare to. So.. they don't get counted as reinfections.

    • @devashish6704
      @devashish6704 4 роки тому

      Can you elaborate their symptoms the second time?

  • @ronch550
    @ronch550 4 роки тому +2

    I have just recovered from it, and if it's any consolation at least I already have antibodies against it. But man.. this video has me scared.

  • @alexbelles1370
    @alexbelles1370 4 роки тому +2

    This channel is really important to me, thank you so much for getting reliable information

  • @Eneov
    @Eneov 4 роки тому +7

    I'm not sure why people dislike scientific updates on the pandemic...

    • @FootLettuce
      @FootLettuce 4 роки тому +7

      They are stormtroopers who try to click like but missed

    • @Eneov
      @Eneov 4 роки тому

      @@FootLettuce 😂

    • @disorganizedorg
      @disorganizedorg 4 роки тому +6

      The reason is herd mentality. As opposed to herd immunity.

    • @Gwilfawe
      @Gwilfawe 4 роки тому

      @@disorganizedorg is that a jab at the don don?

    • @ghwk-phd2784
      @ghwk-phd2784 4 роки тому

      Anyone that is interested in immunological science in relation to the SARS- COV-2 pandemic, here is a very basic virology overview, that for some reason is not being discuses by the scientific community, yet is all fully verifiable with over 65 years of empirical epidemiological understanding and logic.
      Because we have all been exposed to several different Corona viruses from past pandemics and they all share similar RNA code and borrowed and hijacked micro-molecular machinery, there is partial T-Cell immunity memorization response happening in every new infection with SARS-COV-2 even though it is considered a novel virus. This is precisely why in the vast majority of the infections the symptoms are very weak or completely benign. (MPIE) mass population immunization by exposure (herd immunity) is the only way this type of virus outbreak ever comes to an end, through virulence dilution by infection saturation throughout the healthy population. This is nothing new however and is precisely how all past corona outbreaks have ever ended.
      History dictates that a vaccine will not be effective for SARS-COV-2, as they have never been effective for any Cor/viruses, (and very poor flu virus response also) due to the rapid antigenic shift (mutating) properties of the spike or surface proteins within the viral RNA polymerase caused by the hijacked malfunctioning Ribosome's, replication transcription system inside the cells nucleus. By the time a vaccine is developed and tested the viral RNA genomic blueprint will have altered enough to make the vaccines effectiveness nullified and useless and round it goes with microbiologists/chemists, always playing a dog chasing its tail catch up game with a perpetually error prone and weakening virus.
      The risk and damage with SARS-COV-2 by all the scientific evidence, data and math is several magnitudes less than what is being discussed by the scientific community. At the end of Dr. David Katz podcast he cites in detail the most comprehensive detailed scientifically data based summery to date, with sources and hyperlinks to the references of all the actual data and numerical statistical math, verifying this immunological and mathematical fact and reality, that the damage from SARS-COV-2 is massively less than previously understood and currently being reported.
      It is long overdue for the world leaders to acknowledge this, instead of the constant round and round cycle, from a small community of career infectious disease experts, politicians and the media trying desperately to remain relevant and prove to the world that they were right! ua-cam.com/video/q6LB2Rp44zA/v-deo.html ua-cam.com/video/urCPH8W2M4Y/v-deo.html globalnews.ca/news/7085775/coronavirus-vaccine-false-hope/

  • @jorreleramirez5037
    @jorreleramirez5037 4 роки тому +2

    As someone who tested positive, and it has been almost a month since my initial swab.
    I feel at ease everytime I get new information from this channel. It gives you a sense of security and hope that maybe someday experts will figure this virus out.
    Thank you for making this a series of episodes for the latest updates. I hope if you are reinfected* it is mild rather than severe.
    Stay safe everyone! Wear a mask and wash your hands!

  • @brothapipp
    @brothapipp 4 роки тому +22

    i appreciate the information that isn't tied to a narrative.

    • @culwin
      @culwin 4 роки тому

      Unless you watch right-wing propaganda there is no narrative

    • @brothapipp
      @brothapipp 4 роки тому

      @@culwin Perhaps we can agree that this video presented the information very narrative free and just appreciate scishows delivery...There is no reason to start poking holes in someone else's leaning except to serve your own narrative....which then leads me to believe that either you are the only person not caught up some narrative, or that you are suffering from the same narrative bias that both sides exhibit.

    • @culwin
      @culwin 4 роки тому

      @@brothapipp Ah, the old "both sides are bad" nonsense. LUL what's your narrative you're trying to push? As if we don't know.

    • @brothapipp
      @brothapipp 4 роки тому

      culwin why not check out kialo.com I’m sure you will find you match in wit over there. I am small time. I just thought that it was a very informative video, and didn’t push a narrative. Sorry if I’ve said something that was offensive.

    • @culwin
      @culwin 4 роки тому +1

      @@brothapipp Flagged for spam

  • @RNG-999
    @RNG-999 4 роки тому

    I work in a Washington state nursing home and I have had covid-19 at least 4 times since March 13th 2020.

    • @devashish6704
      @devashish6704 4 роки тому

      Really? You got tested all 4 times? What were your symptoms btw?

  • @bouteilledargile
    @bouteilledargile 4 роки тому +51

    what does this mean for any future vaccines? if people can be reinfected then will a vaccine help us in any way?

    • @frikativos
      @frikativos 4 роки тому +30

      I don't really know, but I think that vaccines will help a lot for sure, even if they are not 100% effective. Many of the vaccines we have today are actually not 100% effective, but if everyone is vaccinated, it is way harder for the virus to find someone it can infect. Some estimates say that the vaccine needs to be at least 60% effective to stop the virus (assuming everyone gets vaccinated), but even if it is a bit lower than that, combined with washing hands and other measures should help a lot.

    • @TheExplorder
      @TheExplorder 4 роки тому +5

      @@frikativos According to the CDC and the FDA 70%

    • @Belzughast
      @Belzughast 4 роки тому +5

      Forget the idea with how fast Covid mutated and hundreds of different strains around the world, if not thousands.

    • @ooooneeee
      @ooooneeee 4 роки тому +26

      @@Belzughast Those rare genetic mutation does not equal phenotypic (= amino acid sequence/protein structure) mutation. Scientists have actually modelled this:
      www.pnas.org/content/early/2020/08/28/2008281117
      A SARS-CoV-2 vaccine candidate would likely match all currently circulating variants
      Bethany Dearlove, Eric Lewitus, Hongjun Bai, Yifan Li, Daniel B. Reeves, M. Gordon Joyce, Paul T. Scott, Mihret F. Amare, Sandhya Vasan, Nelson L. Michael, Kayvon Modjarrad, and Morgane Rolland
      PNAS first published August 31, 2020
      The rapid spread of the virus causing COVID-19, SARS-CoV-2, raises
      questions about the possibility of a universally effective vaccine. The
      virus can mutate in a given individual, and these variants can be
      propagated across populations and time. To understand this process, we
      analyze 18,514 SARS-CoV-2 sequences sampled since December 2019. We find
      that neutral evolution, rather than adaptive selection, can explain the
      rare mutations seen across SARS-CoV-2 genomes. In the immunogenic Spike
      protein, the D614G mutation has become consensus, yet there is no
      evidence of mutations affecting binding to the ACE2 receptor. Our
      results suggest that, to date, the limited diversity seen in SARS-CoV-2
      should not preclude a single vaccine from providing global protection.

    • @barryfraser831
      @barryfraser831 4 роки тому +4

      Basically it depends on how common a reinfection is. If the immunity time is measured in years then a vaccine can be helpful, but as you get lower and lower immunity time vaccines lose use.

  • @adrianarc1941
    @adrianarc1941 4 роки тому +1

    I'm recovering from COVID19, didn't need to go to hospital, and now people are like "oh you're immune now you don't need to wear a mask anymore" and I'm like yeah...nope. I'll keep wearing it, if that's ok with you. an even if it isn't. my mantra is exactly that "we don't have enough information". I don't wanna catch it again, nor do I wish to give it to someone else.

  • @jasepoag8930
    @jasepoag8930 4 роки тому +33

    That shirt is making my eyeballs hurt

    • @jorionrange8336
      @jorionrange8336 4 роки тому

      Same

    • @andyb1653
      @andyb1653 4 роки тому +1

      It keeps doing the chain-link fence zoom-in illusion

    • @Pussmash
      @Pussmash 4 роки тому +1

      @@andyb1653 yeah and opposite design on those buttons. >:(

  • @4thNebula
    @4thNebula 4 роки тому

    This video helped explain some issues with reinfection that I had. Appreciate information that is helpful and reliable.

  • @albinolozano3582
    @albinolozano3582 4 роки тому +7

    So, for me, I was asymptotic during my first infection in April, I was then reinfected in August, and this time I was pretty sick, not enough to land me in the hospital, but... enough to be scary. I had lost my father to covid -19 in July.

    • @dantan1249
      @dantan1249 4 роки тому

      Makes you wonder if the extreme cases are just reinfections and the mild cases are novel infections. What if you keep getting it worse every time?

    • @devashish6704
      @devashish6704 4 роки тому

      Could be that the first time your results were false positive. The gold standard of covid testing is still not 100% accurate

    • @devashish6704
      @devashish6704 4 роки тому

      dan tan that’s what happens in dengue fever. But many other reinfection cases have been milder and asymp

    • @albinolozano3582
      @albinolozano3582 4 роки тому

      Devashish I was tested twice, my infectious disease specialist was very confident in my diagnosis. I didn’t get an antibody test, only because, I didn’t want to get poked anymore, since I had been through a series of infections, and I was done with being poked and prodded.
      It also considerably lowered my testosterone, which is one of the after effects of covid-19.

    • @devashish6704
      @devashish6704 4 роки тому

      albino lozano getting an antibody test was the only way to know if the first bout was a real infection. The most accurate can throw false positives too

  • @MrHerks
    @MrHerks Рік тому

    Fully vaccinated and on my 3rd infection as I type this, all 3 AFTER vaccine. 1st infection was super mild, almost no symptoms, 2nd was a bit worse but symptoms only lasted2 days, this 3rd infection I'm dealing with right now is horrible, pretty much bedridden, extreme exhaustion, and just nasty all around. Just started Paxlovid

  • @mannysaintsaleman
    @mannysaintsaleman 4 роки тому +9

    I had got covid , it hit my lungs pretty bad
    I recovered
    So these videos are awesome 😎
    Thanks y’all

    • @noahludford3667
      @noahludford3667 4 роки тому +1

      Glad to hear from a survivor. I hope your donating to the cause with your antibodies.

  • @Magicponcho10
    @Magicponcho10 4 роки тому +1

    I ended up with it twice, I had antibodies after the initial infection. 4 months later I got it again and the symptoms were the same both times. I was infections both times as well.

  • @lordbrod9686
    @lordbrod9686 4 роки тому +11

    Thanks for the update, I like it because u only include facts!

  • @veddergirl3521
    @veddergirl3521 4 роки тому +1

    Thank you for your excellent work. Bless you.

  • @Techno_Tod
    @Techno_Tod 4 роки тому +5

    Acknowledging the limits of present knowledge and inaccuracies of past statements are what empower science as a whole. Never trust anyone who claims to know everything and to be flawless, as their initial premise presenting you information is already false.

    • @noahludford3667
      @noahludford3667 4 роки тому +1

      That's helping me see alot of things differently

  • @katz57
    @katz57 4 роки тому +2

    It is nice that you are explaining about covid. There is less and less talk about it when there should be more until everyone understands how it spreads and how to protect themselves.

  • @seanpatrick1243
    @seanpatrick1243 4 роки тому +19

    Well explained!
    Now if we can just get the cult followers to believe facts, we’ll be on our way!

    • @seanpatrick1243
      @seanpatrick1243 4 роки тому +3

      @Glorious Bastard
      Science deniers, those who rely on anecdotal evidence, etc.

    • @seanpatrick1243
      @seanpatrick1243 4 роки тому +1

      Glorious Bastard
      So you are in Glasgow, which generally speaking has done a better job of keeping things under control. If you look a graph of daily hospitalizations of COVID patients, you will see all regions are following a similar trend with a peak in mid to late April and then a gradual decline that continued into August. Starting in the beginning of September, an increase started.
      So, your anecdotal scenario at Queen Elizabeth hospital is perfectly normal, unless you are looking for a way to justify your own predetermined beliefs.

    • @seanpatrick1243
      @seanpatrick1243 4 роки тому +2

      Glorious Bastard
      I am not sure who has called for an entire UK lockdown nor if it is warranted, but certainly enforcing the use of masks and other measures are in order. And there very well may be certain regions where a lockdown is deemed necessary.
      As for the specific data, it was obtained from coronavirus.data.gov.uk/healthcare
      You can see we are just at the start of the uptick. You can also imagine how catastrophic a spike like the one in April would be to the NHS as a whole during the flu season.

    • @seanpatrick1243
      @seanpatrick1243 4 роки тому +2

      @@soulsbourne
      Yeah, you do realize that Steve Bannon is behind that "study" which contradicts every reputable scientists' findings who have examined it?
      But hey, we live in the world of alternative facts now.

    • @seanpatrick1243
      @seanpatrick1243 4 роки тому

      Allen Mathew
      Do you also deny the consensus of more than 97% of climate scientists?
      Your “study” has already been debunked by scientists who have proven that the molecular structure shows no way it was created in a lab.

  • @mackenzieonyx7586
    @mackenzieonyx7586 4 роки тому

    you guys have been doing a terrific job! it doesn't go unseen and ur all profoundly appreciated, *thank you!*

  • @radiofrog
    @radiofrog 4 роки тому +5

    If scientists controlled the media, more people would be alive right now. Thank you scishow

    • @ghwk-phd2784
      @ghwk-phd2784 4 роки тому

      Anyone that is interested in immunological science in relation to the SARS- COV-2 pandemic, here is a very basic virology overview, that for some reason is not being discuses by the scientific community, yet is all fully verifiable with over 65 years of empirical epidemiological understanding and logic.
      Because we have all been exposed to several different Corona viruses from past pandemics and they all share similar RNA code and borrowed and hijacked micro-molecular machinery, there is partial T-Cell immunity memorization response happening in every new infection with SARS-COV-2 even though it is considered a novel virus. This is precisely why in the vast majority of the infections the symptoms are very weak or completely benign. (MPIE) mass population immunization by exposure (herd immunity) is the only way this type of virus outbreak ever comes to an end, through virulence dilution by infection saturation throughout the healthy population. This is nothing new however and is precisely how all past corona outbreaks have ever ended.
      History dictates that a vaccine will not be effective for SARS-COV-2, as they have never been effective for any Cor/viruses, (and very poor flu virus response also) due to the rapid antigenic shift (mutating) properties of the spike or surface proteins within the viral RNA polymerase caused by the hijacked malfunctioning Ribosome's, replication transcription system inside the cells nucleus. By the time a vaccine is developed and tested the viral RNA genomic blueprint will have altered enough to make the vaccines effectiveness nullified and useless and round it goes with microbiologists/chemists, always playing a dog chasing its tail catch up game with a perpetually error prone and weakening virus.
      The risk and damage with SARS-COV-2 by all the scientific evidence, data and math is several magnitudes less than what is being discussed by the scientific community. At the end of Dr. David Katz podcast he cites in detail the most comprehensive detailed scientifically data based summery to date, with sources and hyperlinks to the references of all the actual data and numerical statistical math, verifying this immunological and mathematical fact and reality, that the damage from SARS-COV-2 is massively less than previously understood and currently being reported.
      It is long overdue for the world leaders to acknowledge this, instead of the constant round and round cycle, from a small community of career infectious disease experts, politicians and the media trying desperately to remain relevant and prove to the world that they were right! ua-cam.com/video/q6LB2Rp44zA/v-deo.html ua-cam.com/video/urCPH8W2M4Y/v-deo.html globalnews.ca/news/7085775/coronavirus-vaccine-false-hope/

    • @mstandenberg1421
      @mstandenberg1421 4 роки тому

      Ugh... that’s denying the efficacy of vaccination system evolution in favour of a future’s history where its relevant impact has passed.
      You’re deciding the typical conclusion is worth the dead without a fight.
      You’re a fool. And a downright nasty one.

    • @radiofrog
      @radiofrog 4 роки тому

      dean mushtuk That’s a lot of text without much of a conclusion. I’m sorry, but what are you really even arguing here? That we just stand idly by and await its passing? A million are dead already, and that’s *with* these extreme precautions much of the world is taking. I’m really not sure what you’re suggesting here. Have you read the long-term symptoms?

  • @LeDank
    @LeDank 4 роки тому

    The fact that you admit what we don’t know is why I come here for the stories.

  • @twocvbloke
    @twocvbloke 4 роки тому +3

    Next problem to solve, how to deal with incompetent british politicians who keep doing U-turns on policies regarding the virus, which just make the situation worse?

    • @bipolarminddroppings
      @bipolarminddroppings 4 роки тому +1

      The problem isnt really the U-turns, its the half measures.
      Example: You have to wear a mask in shops, except if you work there. My local sainsbury's staff are a great example, all the staff under 45 wear masks for their entire shift, the two elderly ladies who work there dont wear one at all. Make of that what you will.
      Groups of 6 allowed in pubs (where there are strangers all around you) but not in your own home. Masks also only have to be worn while walking in, moving around the premises or ordering drinks.
      It should be this simple, when you are in public you must wear a mask at all times.

  • @mattb2382
    @mattb2382 4 роки тому

    Thank you for using the correct term. It's PHYSICAL distancing not SOCIAL distancing.

  • @DreamPath323
    @DreamPath323 4 роки тому +6

    I got COVID 23. It’s not even out yet, but I have connections.

  • @jasperxmaster9703
    @jasperxmaster9703 4 роки тому +1

    Im grateful for Channels like these

  • @Doomzdayisgone1969
    @Doomzdayisgone1969 4 роки тому +9

    Oh perfect.

  • @katheymann2334
    @katheymann2334 4 роки тому

    My son contracted the chickenpox at his preschool at age 4 with a very high fever & small number of the pox lesions. Several years later we thought he had poison ivy because he had no fever. But he had lesions in places where the poison ivy could not have gone. A doctor's visit confirmed he got chickenpox again withe lesions everywhere. My daughter contracted chickenpox from her brother at the age of 2. She had lesions in her ear, between her toes, her genital area, scalp & even in her mouth. She began her potty training because the lesions irritated her bottom so much she couldn't wear a diaper. She didn't get a really high fever like my son & she did not get infected when my son got the chickenpox again.

  • @petermc_grann4192
    @petermc_grann4192 4 роки тому +8

    Whilst this is a considered source of news opinion- just want to emphasise- both cases mentioned are case reports- involving one individual in different countries- these cases are not even directly comparable to each other, let alone in a broader sense to populations of people.

  • @sidkemp4672
    @sidkemp4672 4 роки тому +1

    Excellent update on this very important issue. Two points I think are relevant. One, at 4:12, you say, "until the experts figure all this out." That phrase could easily be misundertood in a way that could create an inapproprite and hostile reaction, "Why don't the researchers work faster?" We've all seen this around vaccine testing. The fact is that reinfections occur months or years after first infections. Before anyone can figure this out, we need years of experience of COVID-19. There is no other way.
    Second, receiving a vaccine is very similar to getting an infection. So while this research is not directly about the effectiveness of a vaccine, it is more likely that a vaccine will be less effective for a virus that is not "one and done" like the measles, where one two-dose vaccine lasts a lifetime. Even if we get a safe, effective COVID-19 vaccine, we don't know how many years it will protect us.

  • @jessejauregui
    @jessejauregui 4 роки тому +3

    Great video!

  • @radiationshepherd
    @radiationshepherd 4 роки тому

    I have really wanted more information on this topic. Thanks for being applicable

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca 4 роки тому +6

    I only really trust three sources: our national radio and television in Finland, raw data WHO verifies and publishes, including studies and their results, and sci-show news.
    This channel makes good use of studies and reporting, yet never over sells it's conclusions. Mistakes will be reported, but I would still encourage this channel to accept the role of primary source; re-visiting old videos may not make interesting content, yet is crucial for some of your viewerbase.
    YLE reports what happens in my country, and if they are biased, it is the bias that is currently steering our nation: that's news in itself.
    And WHO, even with all messy political shenanigans, still is the common ground between all of humanity. Mistakes they do will surely rise attention, and they are the least bias body coordinating all the nations of the world, and their data.

    • @disorganizedorg
      @disorganizedorg 4 роки тому +1

      On behalf of America, I apologize to Finland for injuries resulting from laughing and eye-rolling over "raking the forests". We are having some technical difficulties and hope to have them sorted by January 21, 2021.

    • @friedawells6860
      @friedawells6860 4 роки тому +2

      I’ve had issues with the WHO ever since they starting heaping praise on the CCP for their handling of the pandemic when it was very obvious that the Chinese government was lying about case numbers and fatality numbers. I mean China went from thousands of new infections per day to zero in one day and stayed at zero for months, you would have to be kind of stupid to believe those numbers are authentic.

    • @bramvanduijn8086
      @bramvanduijn8086 4 роки тому +1

      Check out the Healthcare Triage channel, that's a source I trust too.

    • @Jp-ue8xz
      @Jp-ue8xz 4 роки тому

      lmao, plz don't insult scishow by comparing them with any state-run media anywhere, or lobbyist-run w.h.o, same assholes that told the world not to wear masks for months, and helped china coverup their mess

  • @katrinasmith5343
    @katrinasmith5343 4 роки тому +1

    Thank you video format is so much more palatable for my dyslexia and I've been wondering about this and effectiveness of vaccines.

  • @peacewillow
    @peacewillow 4 роки тому +4

    since coronaviruses in general have been with us for a very long time, and have been studied extensively, why aren't we using them as a measure for covid 19?
    i understand that our most common yearly cold viruses aren't as deadly as this one, but wouldn't their behavior be similar?
    the common cold is highly contagious, travels thru air, can be caught repeatedly in a single season and has no known "cure" or vaccine. sound familiar?
    so what else can our common coronaviruses tell us about their new friend?

    • @sandrastreifel6452
      @sandrastreifel6452 4 роки тому +15

      by peacewillow: This new coronavirus is more similar to the original SARS or MERS coronaviruses, than to the common cold. We can’t assume their “behaviour” will be the same, but researchers have used knowledge about those diseases in their work with the virus which causes COVID-19.

    • @bluwasabi7635
      @bluwasabi7635 4 роки тому +2

      This is a good question. While Covid differs from other corona viruses in how it infects cells/etc, wouldn't it at least be useful to study and compare these in terms of the physical/mechanical properties?
      Example...
      How far can these viruses be carried in a water droplet (if applicable)?
      How long does it take for these viruses to break down on various surfaces?

    • @dannulik
      @dannulik 4 роки тому +9

      But they did and do use information they learned about SARS and MERS to try to find more informations about SARS-Cov-2.

    • @ValeriePallaoro
      @ValeriePallaoro 4 роки тому +11

      I'm concerned that you and Bluwasabi don't seem to think that scientists looking at Covid-19 would have thought of this. And that if it's not coming up in conversation it's not cause they haven't done it, it's because it's not all that relevant to the things we need to know about the virus being studied.

    • @Dragrath1
      @Dragrath1 4 роки тому +3

      @@sandrastreifel6452 Don't forget that this virus has proofreading capabilities which are rare in RNA viruses and practically unheard of in coronaviruses that infect people. Genome wise in the June issue of Scientific American they showed viral genome size comparisons and SARS CoV 2 has a huge genome for a virus. That in principal means it has the potential for a lot more genetic tricks and far greater quality control over the resulting viral copies which means more viruses produced will be viable. This might potentially have to do with why it can spread in so much smaller respiratory droplets.
      Evolutionarily speaking it seems to be a fairly slow and genetically conservative virus that makes it hopeful for lasting immunity to work against it is also from a family of fast mutating viruses that typically render immunity worthless after a few months to years of mutation which probably has to do with why our bodies don't usually maintain lasting immunity. So in this sense its similarity as a coronavirus might actually hurt us in treating it if our immune systems respond like they normally would do for a coronavirus thus throwing away perfectly good immunity due to normal coronaviruses having changed too much after a certain point for maintaining that memory to be effective.
      So one of the big questions has been will our bodies treat it like slow mutators where lasting immunity is effective or will it treat it like a typical coronavirus? This while not yet statistically significant seems to suggest it might unfortunately be the latter though again it is preliminary so not yet statistically significant information.

  • @Smokey.Tackle
    @Smokey.Tackle 4 роки тому +2

    I like the fact when I'm watching these I never get the sense of any political bias in the video. It's just straight facts unlike what you get on the major news networks. I feel like I am better informed with the knowledge needed to go about my business in life. Thank you for these videos.

  • @blabo6427
    @blabo6427 4 роки тому +6

    I almost died because of Covid 19 and I am afraid to go back to work (I am a health worker) and become infected again by being in contact with affected patients. I was 3 weeks connected to a respirator and I don't know if I will be victorious in another assault.

    • @noahludford3667
      @noahludford3667 4 роки тому +3

      Please if you think someone will live because your there, think of the line they will leave behind them. The world needs another Einstein, another Di vinci, another MLK. Or if things get bad another McArthur. That's the effect your chosen profession has on this world. It makes the best of what we stand for possible. You are a hero.

    • @jasonnugent963
      @jasonnugent963 4 роки тому +3

      Thank you for your service as a health-professional !.. I don't know you, but I was Hospitalized for 38 days (16 days in ICU on a Ventilator).. and my deepest respect goes out to every single Hospital employee who was committed to working to save my life. You all are true heroes !!

    • @devashish6704
      @devashish6704 4 роки тому

      Can you please elaborate your symptoms of both bouts?

    • @blabo6427
      @blabo6427 4 роки тому +1

      @@devashish6704
      Looking at your comments I see that you are one of those deniers, God knows why. I don't like wasting time with people like flat earths and other fauna. But I also know that you have to be patient and practice the important work of health education. Send me an email address so I can communicate and I will gladly give you all the information you want since as you will understand I will not publicly expose personal details about my convalescence. I hope this way I can make you see that this disease is not a fantasy. Thanks for your curiosity.

  • @jameswallace9906
    @jameswallace9906 4 роки тому

    You should lead with the statistical significance and disclaimer of the lack of definitive Information, rather than conjecture and speculative information that has yet to under go peer review.

  • @shawnsolo7860
    @shawnsolo7860 4 роки тому +3

    The shirt is creating an optical illusion.

    • @jasonnugent963
      @jasonnugent963 4 роки тому +1

      I saw a Light House!.. No wait,. it's a Sail boat !... OH GOD IT'S A RICK ROLL..

    • @artman2oo3
      @artman2oo3 4 роки тому

      Jason Nugent SciShow is never gonna give us up... never gonna let us down...

  • @taylanhoca
    @taylanhoca 4 роки тому +1

    One channel that i trust and get news from. Keep it going guys. You are amazing 🙏🏻

  • @Karishma_Unspecified
    @Karishma_Unspecified 4 роки тому +5

    I read the title. I am upset by it. Watching the video anyway

  • @jessicaonymous4352
    @jessicaonymous4352 4 роки тому +1

    Thank you for providing clear information and continuing to update about Covid research, while still being honest about areas we don't know everything in yet

  • @ricardoabh3242
    @ricardoabh3242 4 роки тому +6

    Excellent clarifications!
    Silent re-infection is scary...
    And i knew cat are 😈 and cute

    • @martin518441
      @martin518441 4 роки тому +1

      Blatant disregard from schi show , corona viruses have been known to affect cats and dogs for decades , corona viruses have also affected humans for decades , this particular virus strain we are talking about does not affect cats and dogs , scishow was just throwing around buzzwords with this , corona viruses have been known for decades , corona virus strains that don't affect humans ,affect cats and dogs m scishow really should have elaborated on this instead of sewing misinformation without context.

  • @reflex8843
    @reflex8843 4 роки тому +1

    thank you for being more understanding than the news when it comes to covid

  • @MarijnvdSterre
    @MarijnvdSterre 4 роки тому +15

    Could there might be some difference because of the severity the first time? It is extremely incidental, but the couple of reinfection cases I heard of had mild reactions the second time around if the first time was bad and vice versa.

    • @ooooneeee
      @ooooneeee 4 роки тому +3

      I agree. The stronger an infection, the stronger the immune memory would make sense. I know that Vaccinations need to be high enough dose for a strong reaction (think light fever), but not too strong (think high fever). Or lower dose plus strong adjuvant, which is basically any chemical that irritates the immune system so that white blood cells show up at the site of vaccination and take the smaller dose more seriously.

    • @devashish6704
      @devashish6704 4 роки тому

      Quite Possible. But the majority of reinfections are mild both times

  • @Cvile69
    @Cvile69 4 роки тому

    Thank you for the accurate sourced content.
    Hard to find it thhese days..

  • @MartyInTheWoods
    @MartyInTheWoods 4 роки тому +21

    Trump: *Science doesn't know*
    maybe he should subscribe to your channel ^^

    • @bipolarminddroppings
      @bipolarminddroppings 4 роки тому +5

      To someone like Trump, not knowing and changing your mind when assimilating new information are signs of weakness. Its a common trait of stupid people.

    • @crushsatan
      @crushsatan 4 роки тому +2

      Isn't that what the guy in the video says "we don't have enough information"?

    • @huangec
      @huangec 4 роки тому +2

      I doubt if he can understand the language used here. Hell, I think he would even find Sesame Street difficult to follow.

  • @maryavatar
    @maryavatar 4 роки тому

    Oh crap. I had it back in March and ended up in hospital with pneumonia. And after months of sitting at home, I’m WAY less healthy now than I was in March.

    • @sparkle1596
      @sparkle1596 4 роки тому

      have the symptoms just been getting progressively worse? i'm so sorry to hear that and I hope you can start to recover soon!

  • @maxm3512
    @maxm3512 4 роки тому +3

    If we get tested for the common cold, what's the possibility of testing positive for it?

    • @seanpeacock4290
      @seanpeacock4290 4 роки тому +4

      you will test positive for the common cold but not covid19

    • @christelheadington1136
      @christelheadington1136 4 роки тому +3

      There are a lot of different viruses that get dubbed the common cold.

  • @David_T
    @David_T 4 роки тому +2

    The fact that you mention only two cases of re-infection speaks loads about the probability of getting reinfected.

    • @cf3714
      @cf3714 4 роки тому

      Wow now, hold up. He only *used* two examples. That doesn't mean there were only two.

    • @devashish6704
      @devashish6704 4 роки тому

      I’ve personally read about 50-100 cases of reinfection. But that’s still insignificant compared to the number of total cases. Except 1 or 2, all of them were milder the second time

    • @cf3714
      @cf3714 4 роки тому

      @@devashish6704 Currently, the number of reinfections in medical journals is low, but there are several things to keep in mind.
      Each case study is usually pretty thorough, looking at the genome of individual case, and making sure it isn't mutating into a new strain. They aren't looking at every possible reinfection, just the ones that are confirmed 100% or stand out in some way.
      There haven't been any large meta-studies, as each study is rather low in the N department. One study has 3 patients (who all died), another one has 11. Until someone puts them together, or does a massive study, N will remain low.
      Most of the young, healthy cases have been medical staff who've been randomly tested. The rest are usually old, have a number of medical conditions (heart failure, AIDS, cancer), or both. So there is a selection bias for people who spend large amounts of time in medical facilities.
      And for the most part, the young, healthy people have milder symptoms the second time, while the old and ill people have severe, and are usually fatal, the second time around.
      Try this. scholar.google.com
      covid-19 OR sars-cov-2
      reinfection OR rebound OR relapse

    • @devashish6704
      @devashish6704 4 роки тому

      C F I haven’t read about any Reinfection fatality case. Can you provide the links for it?

    • @cf3714
      @cf3714 4 роки тому

      @@devashish6704 That's why I said use google scholar. First one that popped up for me.
      onlinelibrary.wiley.com/doi/full/10.1111/jgs.16728

  • @labrat6333
    @labrat6333 4 роки тому +3

    2 of the most recent cases in my neck of the woods were individuals who had previously had it and recovered and then tested positive again. Due to the small amount of actual new cases these 2 cases are most likely not a new virus but a flare up of the original infection as there has not been any other new cases reported for a while and at least one of the individuals was a child and kept isolated at home. The other individual had been cleared and returned to work but no new cases have been detected since they retested so luckily nobody else has been exposed. (knock on wood).

  • @rayzorrayzor9000
    @rayzorrayzor9000 4 роки тому +1

    Thankyou for clearing up the misinformation about reinfection, to me this was the highlight of vid
    Take Care . R .

  • @MrKydaman
    @MrKydaman 4 роки тому +3

    "Hey guys, I'm here to tell you what we don't know."
    Just kidding, thanks for keeping us up to date, and being clear about what is and isn't known.

  • @FrankJFischer
    @FrankJFischer 4 роки тому

    Thanks for using the term 'physical distancing' rather than the more common 'social distancing'.

  • @anthonysmith8981
    @anthonysmith8981 4 роки тому +18

    This makes the vaccine question even more pertinent. If previous infections don’t prevent future infections,; will SARS-2 vaccinations fare better.

    • @cherrybomb6451
      @cherrybomb6451 4 роки тому +3

      Or if people who already recovered even need vaccines.

    • @Real28
      @Real28 4 роки тому +8

      The answer is no. That's how a vaccine works. It creates the needed antibodies. But if your body doesn't keep antibodies long enough, then a vaccine becomes less effective.
      Ive read a couple abstracts from testing on antibody lifespan and it's not been promising.
      We just need to focus on really good treatment. I'm not holding out for a vaccine.

    • @ag135i
      @ag135i 4 роки тому +1

      @@Real28 thanks for the sad update.

    • @crazymonkey8389
      @crazymonkey8389 4 роки тому +4

      @@Real28 Why not both? Hopefully few months of lowered chances of getting infected duo to vaccine(hopefully 60%) paired with face masks and distancing could imo really help. But countries would need to keep an eye on travelling afterwards, unlike many countries did in last few months in EU.

    • @georgelopez9411
      @georgelopez9411 4 роки тому +4

      Despite a "Natural" infection not conferring long-lasting protection, vaccines can be designed to create long-lasting immunity. A great example of that are protein-polysaccharide vaccines used for Streptococcus pneumoniae infections. While a "Natural" S. pneumoniae infection does not confer a long lasting immunity, the recently developed vaccines amplify the immune response, giving immune protection for at least 5 years.

  • @Swnsasy
    @Swnsasy 4 роки тому

    I had the virus back in April and it is NOTHING like the flu, it's 5xs worse and they said my husband and I had a mild case!! I looked at it like this, I can get the flu more than once so I can get this more than once. I keep that in mind until sometime knows 100% either way.. Thanks so much for the information..

  • @ApertureCombine
    @ApertureCombine 4 роки тому +4

    If more-severe reinfections were a common occurrence, I feel we would've seen a LOT more of those than we are (apparently 1, which isn't exactly statistically significant)

    • @ghwk-phd2784
      @ghwk-phd2784 4 роки тому

      Anyone that is interested in immunological science in relation to the SARS- COV-2 pandemic, here is a very basic virology overview, that for some reason is not being discuses by the scientific community, yet is all fully verifiable with over 65 years of empirical epidemiological understanding and logic.
      Because we have all been exposed to several different Corona viruses from past pandemics and they all share similar RNA code and borrowed and hijacked micro-molecular machinery, there is partial T-Cell immunity memorization response happening in every new infection with SARS-COV-2 even though it is considered a novel virus. This is precisely why in the vast majority of the infections the symptoms are very weak or completely benign. (MPIE) mass population immunization by exposure (herd immunity) is the only way this type of virus outbreak ever comes to an end, through virulence dilution by infection saturation throughout the healthy population. This is nothing new however and is precisely how all past corona outbreaks have ever ended.
      History dictates that a vaccine will not be effective for SARS-COV-2, as they have never been effective for any Cor/viruses, (and very poor flu virus response also) due to the rapid antigenic shift (mutating) properties of the spike or surface proteins within the viral RNA polymerase caused by the hijacked malfunctioning Ribosome's, replication transcription system inside the cells nucleus. By the time a vaccine is developed and tested the viral RNA genomic blueprint will have altered enough to make the vaccines effectiveness nullified and useless and round it goes with microbiologists/chemists, always playing a dog chasing its tail catch up game with a perpetually error prone and weakening virus.
      The risk and damage with SARS-COV-2 by all the scientific evidence, data and math is several magnitudes less than what is being discussed by the scientific community. At the end of Dr. David Katz podcast he cites in detail the most comprehensive detailed scientifically data based summery to date, with sources and hyperlinks to the references of all the actual data and numerical statistical math, verifying this immunological and mathematical fact and reality, that the damage from SARS-COV-2 is massively less than previously understood and currently being reported.
      It is long overdue for the world leaders to acknowledge this, instead of the constant round and round cycle, from a small community of career infectious disease experts, politicians and the media trying desperately to remain relevant and prove to the world that they were right! ua-cam.com/video/q6LB2Rp44zA/v-deo.html ua-cam.com/video/urCPH8W2M4Y/v-deo.html globalnews.ca/news/7085775/coronavirus-vaccine-false-hope/

  • @jessebob325
    @jessebob325 4 роки тому +3

    Great information. Thank you SciShow staff. Stay safe! 🍻

  • @kripht
    @kripht 4 роки тому +3

    Or could it just be as simple as the different strains have differing strengths of effects.

    • @willboyheroify
      @willboyheroify 4 роки тому +2

      Nothing is ever "simple" when talking about viruses or anything really that has to do with the immune system. There are so many variables that we don't even know yet. Its better not to assume things from to be simple bc if they were we would have it figured out

    • @ghwk-phd2784
      @ghwk-phd2784 4 роки тому

      Anyone that is interested in immunological science in relation to the SARS- COV-2 pandemic, here is a very basic virology overview, that for some reason is not being discuses by the scientific community, yet is all fully verifiable with over 65 years of empirical epidemiological understanding and logic.
      Because we have all been exposed to several different Corona viruses from past pandemics and they all share similar RNA code and borrowed and hijacked micro-molecular machinery, there is partial T-Cell immunity memorization response happening in every new infection with SARS-COV-2, even though it is considered a novel virus. This is precisely why in the vast majority of the infections the symptoms are very weak or completely benign. (MPIE) mass population immunization by exposure (herd immunity) is the only way this type of virus outbreak ever comes to an end, through virulence dilution by infection saturation throughout the healthy population. This is nothing new however and is precisely how all past corona outbreaks have ever ended.
      History dictates that a vaccine will not be effective for SARS-COV-2, as they have never been effective for any Cor/viruses, (and very poor flu virus response also) due to the rapid antigenic shift (mutating) properties of the spike or surface proteins within the viral RNA polymerase caused by the hijacked malfunctioning Ribosome's, replication transcription system inside the cells nucleus. By the time a vaccine is developed and tested the viral RNA genomic blueprint will have altered enough to make the vaccines effectiveness nullified and useless and round it goes with microbiologists/chemists, always playing a dog chasing its tail catch up game with a perpetually error prone and weakening virus.
      The risk and damage with SARS-COV-2 by all the scientific evidence, data and math is several magnitudes less than what is being discussed by the scientific community. At the end of Dr. David Katz podcast he cites in detail the most comprehensive detailed scientifically data based summery to date, with sources and hyperlinks to the references of all the actual data and numerical statistical math, verifying this immunological and mathematical fact and reality, that the damage from SARS-COV-2 is massively less than previously understood and currently being reported.
      It is long overdue for the world leaders to acknowledge this, instead of the constant round and round cycle, from a small community of career infectious disease experts, politicians and the media trying desperately to remain relevant and prove to the world that they were right! ua-cam.com/video/q6LB2Rp44zA/v-deo.html ua-cam.com/video/urCPH8W2M4Y/v-deo.html globalnews.ca/news/7085775/coronavirus-vaccine-false-hope/

  • @RoseDragoness
    @RoseDragoness 4 роки тому

    THANK YOU! This is really needed in the maelstorm of 'theories' and people that start to think getting infected early on is good! (Which I also considering it...)

  • @bubbajones6907
    @bubbajones6907 4 роки тому +10

    There's no "second wave" in Sweden, so this is not really an issue.

    • @frikativos
      @frikativos 4 роки тому +2

      There is a big second wave in Spain, though. I don't know why things are going worse here than anywhere else in Europe, but I have few ideas. Maybe more super-spreaders, more social interaction with friends and relatives in general... There must be a reason.

    • @dannulik
      @dannulik 4 роки тому +2

      Yeah, ans The think is even if at the end Swedens way of handling didn't save more lives than other methods they atleast didn't have the big economic decline.

    • @ag135i
      @ag135i 4 роки тому +1

      @@frikativos how many matadors got infected?.

    • @frikativos
      @frikativos 4 роки тому +3

      @@ag135i I don't know, but if some of them died I wouldn't be as sad as when I see a nurse, teacher or doctor die.

    • @rekstroop4391
      @rekstroop4391 4 роки тому +4

      Daniel Hozak except they did suffer the economic decline. It’s reported all over the place

  • @ericscott1701
    @ericscott1701 4 роки тому

    You do a great job presenting info. Love your work.

  • @cherrybomb6451
    @cherrybomb6451 4 роки тому +5

    I had coronavirus 2 months ago( mild) . I feel pretty safe at so few cases of reinfection so far.out of 30 million cases ( yes I wear my mask )

    • @frikativos
      @frikativos 4 роки тому +2

      I think the same. Reinfections seem possible, but not that common. If they were, we would have noticed by now.

    • @cherrybomb6451
      @cherrybomb6451 4 роки тому

      @@frikativos true but maybe in time it could wear off immunity. But certainly I am feeling pretty comfortable so far .

    • @cherrybomb6451
      @cherrybomb6451 4 роки тому

      @@frikativos my question is when a vaccine comes out should I take it ? It's a big question for me . Knowing if I have immunity already helps my decision. I dont want unnecessary vaccinations

    • @RobotacularRoBob
      @RobotacularRoBob 4 роки тому +1

      How long before people with the regular common cold are misdiagnosed (unintentionally or otherwise) as Covid infections? I anticipate more inflated numbers this fall than ever before.

    • @crazymonkey8389
      @crazymonkey8389 4 роки тому +1

      @@cherrybomb6451 I think we have planty of time for more studies before vaccine gets approved. So you have time to make decision.

  • @maxidaho
    @maxidaho 4 роки тому +1

    Everyone is freaking out about rates of infection. Increase testing by 100% and you are going to discover more infections. But, how many of those people actually got sick? Also, the more we test the lower the mortality rate goes.

    • @ghwk-phd2784
      @ghwk-phd2784 4 роки тому

      Anyone that is interested in immunological science in relation to the SARS- COV-2 pandemic, here is a very basic virology overview, that for some reason is not being discuses by the scientific community, yet is all fully verifiable with over 65 years of empirical epidemiological understanding and logic.
      Because we have all been exposed to several different Corona viruses from past pandemics and they all share similar RNA code and borrowed and hijacked micro-molecular machinery, there is partial T-Cell immunity memorization response happening in every new infection with SARS-COV-2 even though it is considered a novel virus. This is precisely why in the vast majority of the infections the symptoms are very weak or completely benign. (MPIE) mass population immunization by exposure (herd immunity) is the only way this type of virus outbreak ever comes to an end, through virulence dilution by infection saturation throughout the healthy population. This is nothing new however and is precisely how all past corona outbreaks have ever ended.
      History dictates that a vaccine will not be effective for SARS-COV-2, as they have never been effective for any Cor/viruses, (and very poor flu virus response also) due to the rapid antigenic shift (mutating) properties of the spike or surface proteins within the viral RNA polymerase caused by the hijacked malfunctioning Ribosome's, replication transcription system inside the cells nucleus. By the time a vaccine is developed and tested the viral RNA genomic blueprint will have altered enough to make the vaccines effectiveness nullified and useless and round it goes with microbiologists/chemists, always playing a dog chasing its tail catch up game with a perpetually error prone and weakening virus.
      The risk and damage with SARS-COV-2 by all the scientific evidence, data and math is several magnitudes less than what is being discussed by the scientific community. At the end of Dr. David Katz podcast he cites in detail the most comprehensive detailed scientifically data based summery to date, with sources and hyperlinks to the references of all the actual data and numerical statistical math, verifying this immunological and mathematical fact and reality, that the damage from SARS-COV-2 is massively less than previously understood and currently being reported.
      It is long overdue for the world leaders to acknowledge this, instead of the constant round and round cycle, from a small community of career infectious disease experts, politicians and the media trying desperately to remain relevant and prove to the world that they were right! ua-cam.com/video/q6LB2Rp44zA/v-deo.html ua-cam.com/video/urCPH8W2M4Y/v-deo.html globalnews.ca/news/7085775/coronavirus-vaccine-false-hope/

  • @jennijones9176
    @jennijones9176 4 роки тому +11

    If reinfections end up being worse in most cases, does that make a vaccine have the opposite intended effects?
    Also generally if reinfections are possible, does that make a vaccine impossible to lessen the effects?

    • @quintinbassett9467
      @quintinbassett9467 4 роки тому

      I’d wager that a vaccine would still be beneficial. I don’t have any successful examples, but scientists are hopeful about the development of an HIV C vaccine, which was this video’s example of a disease that commonly reinfects.

    • @ArgandTabletop
      @ArgandTabletop 4 роки тому +1

      To your first question: I don't know, I'm not an expert.
      To your second: From the information given in the video, this hypothesis is (thankfully) probably false. Vaccines would probably at least reduce the severity of infections (assuming your first hypothesis is incorrect, which it hopefully is, but again, I'm no expert). You may also just have to regularly get a new Covid-19 vaccine, much like flu shots.

    • @CorwynGC
      @CorwynGC 4 роки тому +2

      @@quintinbassett9467 You mean HEP C?

    • @BLZNGFR
      @BLZNGFR 4 роки тому +4

      Quintin Bassett even when rushed? I mean serious crap can happen to you including paralysis and death. Drug companies also have legal protections under any circumstances.

    • @badpanda1532
      @badpanda1532 4 роки тому +1

      Think about flu vaccine, you end up needing to get the latest version every year before flu season, and it lasts for only ~4-5 months. And guess what? It's novel, so we'll all find out together... (ah crap)

  • @Quismo12
    @Quismo12 4 роки тому

    Testing positive or developing symptoms after 2-3 months is a common phenomenon among health care workers here in Bangladesh where protection measures are weak.