The Longest Time (Without TP)

Поділитися
Вставка
  • Опубліковано 29 лис 2024

КОМЕНТАРІ • 129

  • @Staineless84
    @Staineless84 3 місяці тому +2

    I don't know why I thought of this in 2024 but such fond memories.

  • @Lufreine
    @Lufreine 5 років тому +50

    This feels like a requiem now /giggle.
    RIP TP!

  • @NatyaVT
    @NatyaVT 5 років тому +16

    RIP TP 2010-2019.
    You won't be missed. xD

    • @DarkRijin
      @DarkRijin 4 роки тому +2

      i really don't miss it!

  • @blackh9604
    @blackh9604 5 років тому +25

    I guess now none of us will have TP for the longest time...

  • @Roxasedge
    @Roxasedge 3 роки тому +6

    I ran out of TP about 2 years ago and it still hasn't refilled

  • @BurningBlood517
    @BurningBlood517 4 роки тому +3

    TP? Haven’t heard that name in a long time.

  • @Dioxa
    @Dioxa 8 років тому +52

    holy crap I was expecting just to laugh but this is seriously quality work!! you've got a fantastic voice!

  • @Dracas42
    @Dracas42 2 роки тому +2

    I'm so glad someone showed me this blast from the past, rest in peace Goad. You will not be missed.

  • @Ranos17
    @Ranos17 4 роки тому +5

    Still a masterpiece to this day

  • @languidhusk
    @languidhusk 8 років тому +19

    Jesus christ that's impressive. Nice vocals you've got there!

  • @Sovietr2d
    @Sovietr2d 8 років тому +21

    This is clever af. I'm sharing this with all my Melee friends in 14

  • @james916927
    @james916927 8 років тому +7

    No joke.. watched this like 30+ times since last night I love it.
    Subbing!

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  8 років тому

      I'm so glad you like it! Thanks for the sub and the views =]

  • @mila_nightsafe
    @mila_nightsafe Рік тому

    This is the first FFXIV Music Video I've see and after all this years it's still one of my favorite songs I hear on UA-cam!
    Thank you for this amazing and funny Song! Your voice is amazing 🥰 I'm still listening to your newer songs and I still love them all ❤️ thank you ❤️

  • @kagemaru026
    @kagemaru026 8 років тому +31

    if you only had an A S T
    you could simply lean on good ol' me
    ask for the spire
    i know that's what you require
    you will have TP for the longest time

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  8 років тому +3

      Beautiful lyric! And so true. We're actually running ast/sch for raid now X3

  • @patriceguerrero7649
    @patriceguerrero7649 7 років тому +4

    Uhm wow the singing and harmonies in this were on POINT! Was smiling for the longest time (pun intended haha) well done!

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  7 років тому +1

      Thank you so much! Glad to hear I could make you smile :)

  • @tiniestcat1615
    @tiniestcat1615 7 років тому +1

    Shared this with my raids monk and bard...they sing this whenever they run low now. I regret nothing xD

  • @Deadeye2907
    @Deadeye2907 8 років тому

    This video makes me so happy, thank you so much for making this

  • @Balader1Cz
    @Balader1Cz 8 років тому +8

    Rly nice voice!

  • @Ultimusvivi
    @Ultimusvivi 5 років тому +1

    Sad tp is now a relic of the past

  • @jamesfulton915
    @jamesfulton915 8 років тому +2

    not gonna lie. at first I was dissapointed that it wasn't toilet paper TP but was pleasently surprised by the lyrics and performance. Good on ya!

  • @bbarrett726
    @bbarrett726 8 років тому +1

    I've seen your other FF14 parody songs, and I think this is so far my favorite. Funny and just overall well-made.

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  8 років тому

      I'm so glad you liked it! I always hope my production technique in terms of video and audio improves over time, so this kind of feedback is really good to hear! =]

  • @NicotineAndSilence
    @NicotineAndSilence 3 роки тому

    I don't know why I love this as much as I do.

  • @TheSirGummy
    @TheSirGummy 8 років тому

    just did this battle last night for the first time... now it makes so much sense

  • @michaelbruen6565
    @michaelbruen6565 8 років тому

    You did it again!...What an awesome job!!

  • @JetHammer
    @JetHammer 8 років тому +3

    I love this! Gonna link this everywhere

  • @ShouldIbeVacuuming
    @ShouldIbeVacuuming 6 років тому

    omg, this is amazing on all sorts of levels! also, it took me back to how warrior felt for me awhile back, lol, thanks for sharing!

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  6 років тому

      Thanks so much for watching and enjoying! And, no, you don't need to be vacuuming :)

  • @vampirenimz
    @vampirenimz 8 років тому +2

    That was incredible I enjoyed it. Well done.

  • @marks3301
    @marks3301 7 років тому +2

    this deserves more views

  • @TheRealLink
    @TheRealLink 8 років тому +3

    Great job! Loved the lyrics.

  • @neophobicnyctophile8264
    @neophobicnyctophile8264 3 роки тому +1

    Wow, amazing vocals!

  • @yeolliepop9017
    @yeolliepop9017 8 років тому +3

    I love your song videos they're so funny!!

  • @ExplosivePeeps
    @ExplosivePeeps 8 років тому +2

    LOL! Corporal Punishment lyric got me. xD

  • @NarutoFoxBoy30
    @NarutoFoxBoy30 8 років тому

    Your vocal's got so much beter! Thank you for this

  • @Flaky1990
    @Flaky1990 8 років тому +2

    Really good quality, keep up the great work!

  • @Gshadin
    @Gshadin 4 роки тому

    Ngl this sounds really good

  • @brovskibouqloir
    @brovskibouqloir 8 років тому +5

    that voice.

  • @Nuptup67
    @Nuptup67 8 років тому

    This was fantastic! Excellent work.

  • @catcatcatcatcatcatcatcat90000
    @catcatcatcatcatcatcatcat90000 8 років тому +2

    I started playing FFXIV very recently and I'm still figuring things out but this is rly fun to listen to while playing??? Its a genuinely good cover, too. You have rly good harmonies and i like how you sound a lot.

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  8 років тому +1

      Thank you so much for your comment! I'm glad you're enjoying the game, and my song :)

    • @catcatcatcatcatcatcatcat90000
      @catcatcatcatcatcatcatcat90000 7 років тому +1

      One year later, still playing, and still listening to this song. \o/ Hope 4.0 is treating you real nice

  • @Deon
    @Deon 7 років тому +2

    As a monk, I need to set up some kind of discord bot to play a part of this every time we do A9S.

  • @Meno4lyfe
    @Meno4lyfe 8 років тому +3

    This was a lot of fun to do. Good job on editing and the singing!

  • @30SECONDSREMAINING
    @30SECONDSREMAINING 8 років тому +2

    loved it

  • @genericasian
    @genericasian 8 років тому +1

    This is hilarious! You win an internet :D

  • @teejay818
    @teejay818 8 років тому

    Great job Eyrhil!!! Instant classic :)

  • @shanegrayson7068
    @shanegrayson7068 8 років тому +2

    That was so damn good.

  • @LyconaDaCheeChee
    @LyconaDaCheeChee 7 років тому +1

    This is Beautiful. Please do more! :)

  • @PleasantDevil
    @PleasantDevil 8 років тому +2

    this is awesome!!

  • @mr.reaper3093
    @mr.reaper3093 5 років тому

    Tp isnt even a thing anymore and this is still great

  • @marcoklepsky
    @marcoklepsky 7 років тому +5

    this is what happens when arrow is put on the monk

  • @teejay818
    @teejay818 8 років тому

    Dragoons don't get weakness, they get carrying exhaustion.

  • @sgbsflgbsf
    @sgbsflgbsf 7 років тому

    You are a surprisingly good singer :o

  • @jessicles23
    @jessicles23 8 років тому

    This is my new fave song ❤️

  • @Crabchann
    @Crabchann 7 років тому

    this song is so epic

  • @foxdash
    @foxdash 8 років тому

    Still can't stop watching this, it's so damn catchy xD

  • @Xyniss
    @Xyniss 8 років тому +5

    Love it and I'm on Lamia too. Your voice is amazing and this is awesome c: Everyone in this video is awesome!

  • @Sarepean
    @Sarepean 8 років тому

    Amazing!

  • @ordinaryguysgaming2655
    @ordinaryguysgaming2655 6 років тому

    I'm so sad it took me this long to just discover these songs.

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  6 років тому +1

      Well better late than never! :D Thanks for enjoying them.

  • @MrCarlislec
    @MrCarlislec 2 роки тому +1

    I just found this, f In the chat for everyone who did Alex during tp era

  • @Lubbydubs
    @Lubbydubs 7 років тому

    you have the voice of a fucking angel my man

  • @deefour28
    @deefour28 8 років тому

    i love the git gud hidden in there (check captions if u dont know what im talking about)

  • @Zephyrnull
    @Zephyrnull 5 років тому +2

    Hah, no TP anymore boys!

  • @yuriwolfvt
    @yuriwolfvt 4 роки тому

    2020: out of tp for the longest time

  • @zegichiban
    @zegichiban 4 роки тому +4

    New players after 5.0: TP? What's that? Is it tasty?

  • @rachaelsherry3593
    @rachaelsherry3593 8 років тому

    this is incredible it's as addictive as dangerous to go alone 😂

  • @kazedan
    @kazedan 7 років тому

    This is fucking amazing

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  7 років тому

      Thanks for the comment. Glad you liked it :)

  • @schneehase7834
    @schneehase7834 8 років тому

    rly nice :D!!!

  • @mattvermeil6662
    @mattvermeil6662 7 років тому

    Awesome ! XD

  • @7thdayfallout
    @7thdayfallout 8 років тому +3

    first for eyrhil smellz

  • @IzanagiTempest
    @IzanagiTempest 3 роки тому +1

    This song makes me cry I kinda miss tp tho it was a pain lol

  • @Yoji75
    @Yoji75 8 років тому +9

    sooooo.... when is the next song o.o

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  8 років тому +2

      Haha, I have two semi-abandoned projects that I will try to revisit. If I can't make them work, the next song is going to be approximately a month after inspiration strikes! :P

  • @etramoonsong592
    @etramoonsong592 4 роки тому +1

    Fun fact, my gf has no idea what tp is because she started playing after the death of the tp bar.

  • @simplexbox
    @simplexbox 5 років тому +3

    Caaaaaaan we get a link to the lyrics? Y'know?... for posterity.

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  5 років тому +1

      Hey, thanks for the comment! If you want to read the lyrics, you can click the CC button while watching the video. Or, you can click the little "..." to right of the like / dislike buttons and select "open transcript". Not sure if that works on mobile, but you should be able to read all the lyrics there on desktop :)

  • @interstella57
    @interstella57 7 років тому +3

    This is absolutely amazing! I gotta ask, did you do the harmony part and other backup vocals along with the main melody? :o

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  7 років тому +1

      Yes, I did all the vocals, recorded on my home computer. I'm really glad you liked it!

    • @interstella57
      @interstella57 7 років тому +1

      You're amazing. :o I'd love to do duets with someone like you. :o

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  7 років тому +1

      Send me an idea and a sample of your recording and I'll see what can work ^_^

  • @fetzel5055
    @fetzel5055 6 років тому +4

    Yoshi p saw this video and took it a bit too serious i think

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  5 років тому +2

      Lmao, people who start after 5.0 will have no idea what this song is even.

    • @GothKiitsune
      @GothKiitsune 5 років тому

      Eyrhil Vimaxthri I joined during the last few HW patches before Stormblood and I’m a tad confused :|
      Maybe cuz I just recently hit max lvl about 3 weeks ago and I don’t really raid

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  5 років тому

      @@GothKiitsune If you mean you're confused about Fetzel's comment above you, that's because he wrote it after it was announced that TP would be removed from the game in 5.0. Also, a lot of the song's lyrics are specific to just that fight, so don't worry about being confused. Thanks for watching and congrats on hitting max level :)

  • @kiri92azel
    @kiri92azel Рік тому

    Oh I had forgotten to was a thing😂

  • @dadoclear160
    @dadoclear160 8 років тому +1

    Monk's life in A7S haha *pressing TP song macro* :p

  • @Shalaca
    @Shalaca 2 роки тому +2

    Sounds nice makes me curious what tp is

    • @neophobicnyctophile8264
      @neophobicnyctophile8264 2 роки тому +1

      All those abilities that don't use up MP used to use up TP, with very rare exception. Even Sprint used up TP....

    • @neophobicnyctophile8264
      @neophobicnyctophile8264 2 роки тому +1

      It was yellow

    • @Shalaca
      @Shalaca 2 роки тому +1

      Okay, I can understand why it was removed sounds interesting but deaths would be brutal.

    • @neophobicnyctophile8264
      @neophobicnyctophile8264 2 роки тому

      @@Shalaca It wasn't an issue and never really ran out...
      Unless you died.

  • @Kionu-
    @Kionu- 8 років тому

    What's the lyric at 1:19? "I wire stack tight"? Love the video, I can't stop watching it!

    • @Kionu-
      @Kionu- 8 років тому

      Ahh, nvm, it's something like "high wire stacked high" - with 'high wire' being the debuff the boss gets on deaths. That makes a lot more sense.

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  8 років тому

      "Highwire's stacked high"... You can click "CC" to view the lyrics while watching =]

  • @roxxasthedemonslayer6935
    @roxxasthedemonslayer6935 6 років тому

    huh looks like TP changed a lot from XI -Gain tp In combat by landing blows (or getting hit) and was mainly used for Weapon Skills to hit hard and Form elemental Skilchains.... at the cost of ALL your TP for the one Skill.

  • @ReinGD
    @ReinGD 5 років тому

    Rip TP ;-;

  • @deefour28
    @deefour28 8 років тому

    by far the best parody. how long did this take to make. also if anyone cares to answer, whats so hard about A7S. i joined this patch so only savage i have experienced is A9S

    • @Riyshn
      @Riyshn 8 років тому

      deefour28 A lot of semi-random elements that required everyone to react correctly at a second's notice, high party damage (each raidwide blast put a lightning vuln on everyone, stacking up to 2 times), superbeam (Sizzlebeam on random DPS while having 2 stacks of vuln, which also then applies a DoT with the vuln snapshotted), and a no-mercy mechanic (if anyone died for any reason, he got a permanent stacking damage up buff).

    • @deefour28
      @deefour28 8 років тому

      Nicholas Warren jesus christ

  • @lorizanibackon
    @lorizanibackon 4 роки тому

    there's "without MP" version too? XD

  • @darekun46
    @darekun46 2 роки тому

    Was it just my crowd making Bungholio jokes back when TP was a thing?

  • @Gandalf_the_White
    @Gandalf_the_White 4 роки тому +1

    What's TP lol

  • @SyncOnari
    @SyncOnari 8 років тому

    Anyone who hasn't been in AS7 won't get this.. ;;

  • @The-Nomad1
    @The-Nomad1 7 років тому

    fucking great but uh... ever heard of invigorate :p

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  7 років тому

      It's on cooldown :(
      Thanks for the comment! :)

  • @RagDollEyes
    @RagDollEyes 7 років тому

    Great song but Invigorate? x3

    • @MimiriaRuu
      @MimiriaRuu 7 років тому

      Nico Cox it's on cool down ❤️

  • @ThatFreikugel
    @ThatFreikugel 8 років тому

    LOL

  • @dieCG
    @dieCG 4 роки тому

    And the song you covered for a rewrite of the cover is... ?

  • @somaz.9294
    @somaz.9294 5 років тому

    F TP

  • @HyouVizer
    @HyouVizer 5 років тому +6

    5.0: what's that?

  • @HyouVizer
    @HyouVizer 7 років тому

    "this song is the best, also *Arrow* " >:P

    • @EyrhilVimaxthri
      @EyrhilVimaxthri  7 років тому

      Lol, we had no Astro in our group at the time, but maybe we should've had one ;)

  • @Malexan06
    @Malexan06 7 років тому +1

    that voice