Whitesnake - Stand Sound Profiles
Вставка
- Опубліковано 28 вер 2024
- Fine, I'll do it myself.
I do not own any of the clips in this video.
All rights to Hirohiko Araki and David Productions.
Comment if I missed any, but this should include:
-Every Whitesnake Voice line
-Every Whitesnake/Disk related sound
from the first 12 Stone Ocean episodes so far.
![JJBA: Doppio v. Risotto Full Fight [Supercut]](/img/n.gif)
To anyone watching the gun part that isn't a stand user, it would just look like the gun is just floating....
Yep, but no one was watching at that time except for Jolyne and Pucci.
@@TheOverlordEND sadly
mcqueen could see whitesnake giving the discs did not see them float?
Whitensnake is basically like one of those stand that can be seen by non stand-users , sort of like Love Deluxe and Anubis
@@Toji-gl4vi Wait, really? That would explain why Pucci didn't end Jolyne despite the stand couldn't be seen by people because he is afraid normal people would seen it.
But there wasn't any explanation that White Snake can be seen by normal people.
0:40 i can rewatch this scene so many times, it's so crazy to me that this finally got animated
I’ve already watched this scene like 75 times by now. I absolutely love Whitesnake/Pucci, and the music + terrifying idea of Jotaro being rendered a vegetable in just one swipe of a hand + Whitesnake’s elated voice inflection is just perfect
i re-watch it everyday
Just wait for the next 2 steps behind
@@gamersfun98 honestly the heavenly horse would be so cool animated
@@ssmetallic yeah, can't wait to watch it in 2023/2024... why does netflix have to do this to us
This stand literally have it own personality
Like purple haze
like echo stand koichi kun
@Kurt golden experience requiem is Giornos sub conscious
Like cheap trick
@@andrewww52 cheap trick is the stand user's personality
what makes white snake scary is that he has its own personality and *he can grab guns and try to shoot at you like as if its not a stand*
And his range is the same as hirophant green, he can still totally reach you no matter how far you run. The gun just adds disrespect.
@@diegobrando3409 and once he reaches max range, he can still just snipe you with a gun
Like imagine getting away, you think youre safe so you rest and mf starts just blasting
@@nikemegu1142 "lemme tell you right now before we go any further, they'll be no fightin me, I shoot mothafuckas" -whitesnake
@@nikemegu1142 He can also throw discs lol
@@0202fran It might reflect his psyche. Pucci does truly evil things throughout the part. But he usually never does them directly and even justify it and remaining completely ignorant to what he is doing, distancing himself from the truth. Whitesnake is who pucci is deep down, but he keeps his own evil intentions so far in his soul they are given form. And since whitesnake thinks for himself he can just not even think about the brutality and cruelty he is dishing out to the guards and prisoners. It makes sense for whitesnake be such.
I like how they made White Snakes punching and disc sound effects slimy and squishy.
Makes its acid attack feel consistent with the rest of its abilities.
A stand that makes you dream while being dissolved by acid whiletaking your mind and stand in form of a disc which can be inserted into other people. You can't deny that this is quite *bizarre*
He did it he said the thing
for his neutral special, he wields a gun
1 question , can he survive from EMERALD SPLASH
Cool*
Spoiler
Plus he can disguise into somebody in a short time
This stand has it’s personality and voice, his range is 20 meter, his ability is powerful and that’s will make his user mysterious and dangerous , this is very smart way to make the villain dangerous to the protagonist without making theme overpowered or immortal only
One of the most broken Stands.
Long range, decent strength despite its range, acid/dream ability, and the fucking DISC ability that made quick work of Jotaro, give abilities to people, and even give commands like make something explode??? Worst part is this isn't even its final form
I only know the stands from the anime so far, but he’s basically a combination of:
-Yellow Temperance/Ratt/Notorious BIG/Green Day (corrosion)
-Death 13 (dream manipulation)
-Osiris/Atum (soul stealing)
-Boy II Man (Stand stealing)
-Black Sabbath (giving people Stands)
-Hierophant Green/Justice/Heaven’s Door/Surface (puppeteering/commands)
-Killer Queen (making things explode)
@@humanoid251 i feel it’s more like heaven’s door in the sense he can add/remove aspects of a person
@@humanoid251 I agree for the most part, but I just wanted to say that WhiteSnake doesn't control dreams, it simply makes people fall asleep, sorta. Meanwhile, Death 13 could control dreams, but it couldn't make people fall asleep, it had to wait for them to
@@dinoboi7756 I wouldn’t even say it puts them to sleep it just puts them in an illusion dream sort of state since white snake injected Manhattan transfer into the dream even though jotaro and Jolyne had never seen it before
Whitesnake is shown to be very weak in a fight. Stone Free, Diver Down and Weather Report all hand him his arse in a straight fight.
0:43 was so scary but 🔥 at the same time.
I just noticed when WS gets Jotaro's memory and stand disc those have the form of where they came from (One has the form of Jotaro's hat hand and one has the form of his nose)
Oh wow I did not see that
I was wondering why the bumps were gone later on and thinking about it makes so much sense
I've never thought about that
Whitesnake is one of the coolest stands ever.
2:59 zamn ws is being so realistic
“Get real”
Because of numbers on body
@@SmallSimin123 it would be evil to force the animators to draw the patterns on his skin
@@woopterthewooper1263 GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
@@woopterthewooper1263 probably CGI
Tomokazu seki did perfection in both Pucci and White Snake
Jotaro has been "DISC"qualified from being a stand user
🤣🤣🤣🤣🤣
for now, and then pucci dies
@@julianss550 uhh how should i put this
@@julianss550 pucci did die but uhhhhhhhh
@@averagemusiclover dont do it my man
White Snake constantly sounds wheezy and sort of tired, I love it
0:56 The disc on the top has a ridge. His hat is officially a part of his body.
0:56 Whitesnake RKs Jotaro and says “ez”
Whitesnake rker >:(
OMG IS THIS A YBA REFERRENCE. Jk ws bad get him be rker
the : "I found it" fits so fucking well
3:40
"Atta zo!"
What is so scary about Whitesnake to me is how it makes stands seem so fragile and vulnerable in comparison to itself.
Stands are always depicted as being inseparable from their users, intertwined with their very souls, but the moment Whitesnake is introduced, the safety of knowing "At least my stand will always protect me" goes completely out the window as he can just take it away from you
This is probably my favorite stand in terms of sounds
When getting jotaro disk.
White snake: Ez
Yba
Yba joe mama disk momeny
Stand + ability to speak normally = op
Hey ya is OP? (I mean it's good advisor and motivator)
Whitesnake is smarter than all my classmates
Man white snake's voice is epic
I know I'm a bit late but I really love the sounds of the discs and the illusion made by Palesnake.
I can’t wait for Whitesnake using a dude to play music to become a certified Jojo meme
0:17 oh, yes, the gulp-gulp 9000
'White snake'
'Pale snake'
'Pale Cobra'
Missed opportunity
Albino serpent
white viper
Shady Snake
3:45 love this part
2:41 enrico talking while white snake is just anime punching poision dart frogs
I’ve met this guys voice actor.
0:16 "This is my kingdom come"
I like how casually White Snake just hands Pucci a disc.
このドロドロ音クセになる
ASMR味を感じる
Man, Jolyne really was Jotaro's only weakness.
I wonder what would happen if pale snake and Pucci will have an argument , maybe pale snake will just punch pucci
ws is not dragons dream
That and do *not* call white snake "pale snake" if you do not want to get bullied
@@ericraululyeetusdelyeetus5028 pale snake is not that bad imo.
Stuff like Filthy Acts At A Reasonable Price though...
fucking "palesnake"
@@ericraululyeetusdelyeetus5028 Leave the anime-only alone you weirdo, we know what he means.
I like how whitesnake basically puts you in a genjutsu
This is my kingdom come
This is my kingdom come
0:26 me when you're mom is at my house
Your*🤓🤓🤓
Seeing his nucleotide bases not lining up properly makes my inner biologist scream in terror.
Whitesnake may be scary but, It just getting started
@rimu your right 😓
i love the ATASO part at 3:40
It would have been cool if The World had its own sentient mind with Dio
What would it and killer queen will do tho
I have a question for you Enrico Pucci do you believe in gravity c 🌕
I like how gooey and melty white snake sounds
Everyone after NNN:
なんか可愛いｗ ホワイトスネーク＾＾
3:51 truly, a stand that lives in USA💀
When i watch the 2nd batch, i forgot this ability's existence
Edit: i mean the dream world one
kingdom come
why was there a bruh sound effect
It would’ve been cool to see Pucci and Whitesnake talk to each other
You may not have seen it before, but there is a White Snake impersonator in Japan.
This is my kingdom come, this is my kingdom come!
I don’t get it can non stand users now see stands or something
Whitesnake flying is kinda cute
No matter what we breed....
We still are made of seed...
this literally reminds me of a biblical reference of the snake deceiving adam and eve
White Snake: *calls Jotaro invincible*
Giorno: Am I a joke to you?
Giorno cant beat pucci because back to zero only work when someone do some ability time erase and time stop and look on google giorno power level and pucci power level and u will see and yeah i have 15 soo you cant say i lie
@@hello123a I struggled trying to read that XD. Heavy spoilers ahead btw. Also I wasn't implying that Pucci is weaker than Giorno, because idk how GER would affect MIH. I was just saying that Giorno's GER would be invincible compared to Jotaro's Star Platinum. Although you make a good point since requiem stands are given whatever ability the user needs at that moment, and Giorno needed to treat Diavolo to a fate worse than death, via the infinite death loop. Since Giorno never shows up again after part 5 and never will since parts after part 6 take place in another universe, we don't have very much evidence that suggests that GER works on anybody. Although that also means we don't have enough evidence that suggests GER *doesn't* work on anybody, so it's really up to the fan base to decide for themselves (or Araki flat out saying whether or not GER would work on Pucci's stands). Phew that was a lot to say.
He never met Giorno so of course, he'll say he's invincible.
@@RubyKagayakinotsuki ger is not work on made in heaven because is heaven stand
@@hello123a again, this is a bit hard to read
and why did you come back to this comment that I made *2 months ago?*
C U M S T A N D O
I'm still kinda disappointed of pucci's voice I kinda wanted it to be like the eoh voice
ngl im fine with it but its hard to get used to but this pucci VA is more menacing
neah, still good
0:12 when first time you meeet you're online girlfriend for 4 years:
0:11 jolyne was having fun with me
Wonder if they have movies on discs
This is my kindome come
0:44 x2 lol 😂😂
mmmh so a normal person getting stabed by the requiem arrow gives the personn a STRONG STAND = to gods and have ther own personalities ( Looks at Whitesnake cuz he talks but not at the image of pucci but has a real living soul of his )
Puccis just talking through White snake. Like Diabolo and King Crimson
@@manciarmani7259 This is a lie, it has been shown several times that Whitesnake's conscience is separated from Pucci's.
Plus, There's no such thing as an arrow just for requiem
3:44
This is my kingdom come this is my kingdom come.
Whitesnake sound scary as hell ngl
This guy literally want views xd
who doesnt want views?
i think EOH’s pucchi and whitesnake had a better voice
Only Pucci, I'm fine with Whitesnakes voice
3:44 😍
Jotaro got nerf so bad that he didn't use what Dio writes on a book about how to achieve heaven
That cuz to achieve the heaven you have to do some messed up things and jotaro will never do that (well in the game eye's of heaven , he just copy the world over heaven lol xd)
Yeah why Jotaro don't do the whole Ritual to sacrifice alot of peoples Souls to create a Dio clone, who he would need fuse, then go tho Canaveral Cap during a New Moon to get the power to remove people free will...
_Yeah it really a Plot hole_
@@star41xd44 just now realised, instead of green baby, pucci could have used star platinum since green baby is supposed to be a replacement of ZA WARUDO and
ZA WARUDO=star platinum
@@Nova-1238 actually... not at all
Jotaro never do such a thing, You remember the fight with Kakyoin? Jotaro say he consider Evil someone who use weak people for his plans, plus he is a good person
神父のスタンドがボンテージ姿の変態というアンバランスさ。
What if you
Wanted to go to heaven
But god said
1:15
Macuiiiin-kun
Whitesnake actually same king crimson angry
1:18
This is my kingdom come this is my kingdom come
Love him.
Plus, his name is White snake but he is literally Slime Shady
I hate how this would have been a better name.
100% prefer slime shady
@This channel got trashed No! Bad coomer! BAD!
Whitesnake, Palesnake, Slime Shady or even Whitevenom, any name is good
U mean pale snake
He has a very long range, multiple abilities, his own voice/personality, interesting powers and cool design.
He is a chad
Tooru : so its same type of stats as Wonder Of U
Isn't getting discs his only ability? And of course from that you can get more stands. Or did he have the sleeping stand from the beginning?
Only 20 meter bruh
@@brzodroid the dreaming ability yes is also part of his power. He can also enslave people and make them obey orders (like the exploding frog or the guard shooting at Jolyne)
This isn't even his final form
2:39 White Snake throwing light jabs at poison dart frogs is something I never knew I needed.
This barrage was horrible
@@Rony_15.33 he was punching frogs, so he held back
@@falcorthewishdragon3657 but all his punches are horrible from afar
@@Rony_15.33 well white snake is weak compared to star plat, so he doesn't go haywire 💀
@@Rony_15.33
*complaining about stand with D tier speed having a bad barrage*
0:54 oh god that voice🙌
Eyzo
@@LucasSantos-ce2sw Ez*
Sudeni dekte itana
@@asylbektursynbai 👌
@@danielendless ???
This is my most favorite stand ever.
Same
Yea same doe he look badass
I think it has the best design so far
@@roofs817 like van darkholme gachiBASS
Me to and godlen experience raqwiam
3:40 he looks happy in this scene 🤣🤣
It's adorable and I don't know why
Bro, idc if the the heros lose.. Whitesnake is just too *epik*.
His voice, His style, His powers MMMMMM IT'S JUST TOO GOOD BRO!!
Y'all ready for C-moon?
Can't wait to see C-moon) Btw when will thete be more episodes?
I hope they don't change his voice
@@Daniel_Scarlet like March I think
Cmoon one of my favourite stands
they don´t lose and c moon doesn´t show till near the last episode
White Snake's personality is just epic. I really would've wished for a Stand like that, to talk with when nobody else have free time.
Isn’t he evil?
@@veteranpg3d156 well he is, but ofc it's because of Pucci personality. If someone kind would have Whitesnake he would be also kind... Kindsnake...
I wonder how WhiteSnake's abilities could be used for more benevolent purposes. The only one I can think of at the moment is removing a Stand from someone not strong enough to have one, like when Holly got sick.
@@dinoboi7756 deleting the harsh memories or traumas.
@@dinoboi7756 Perfect anesthesia
Bro ws saying “ez” after getting Jotaro’s disk
Yba players.
@@laugh6519 yba moment
yba do be like that d o e
🤓🤓🤓
Yba Joe after killing a prestige 0
2:03 “It was just bait bro”
[insert whitesnake as a wojak]
1:18 Manga : Just like the killer who killed Kennedy...
He said that in the manga?
@@Gaciet017 yeah. in the manga he said about the killer of Lee Oswald, the one that assassinate JFK
@@bravoprozac7620 A shame these cultural references were removed
the coom stand
*C o o m s n e k*
Now we know why he’s called white snake
3:17 that frog is lucky god damn it.
Ah, a frog of culture I see
Bro literally can play DVD on everyone
i can also play dvd on him
The different personalities really create some weird situation, like how the first attack it was Pucci himself controlling, cold and ambitious. And last act is White Snake's personality itself, childish and rushing.
Probably because he had succeeded in the first situation. In the second, he was swearing and yelling since the stand disc was out of his reach and he failed at protecting the discs. The situations were basically a demonstration of pucci’s volatile mindset and desperate attempts at dealing with situations against him or just failure in general.
@@asmagamer728 seeing the stand cursing by himself is actually quite funny
@@mr_box1264 Ikr lmao
He can do the flurry barrage punch
Put people in a deep sleep real like dream
Slowly melt w acid
Stole a memory
Stole a stand
Give a stand
Give a memory
Hold a gun
20M effective range
Can be evolved twice
Can speak and have mind on his own
Can utilise multiple stand power like the one that he make the frog explode
They really make him one of the broken stand
But he's still not the strongest.
@@seeforkat yeah he's not the strongest. He lost to stone free easily. His stand aren't made for brute force but rather as a strategist and the users require battle iq for it. It's balance since he's not strong. But he have more advantages than disadvantages
@@awesomenurmzamri5789 like Kirah Quin
Theoretically anyone following the path to Heaven could have their Stand evolved. Dio initially presumed that it will be him who will achieve the Heaven, so it is at least not Whitesnake exclusive.
can control anyone
can create illusion
can shapeshift
can play mixtape
You're no longer the protagonist, Jotaro!
Old Jospeh: You'll get used to it like I did. "pats on shoulder"
Giorno:wait,you were a Main Character in more than 1 part?
0:13 this is my kingdom come
The voice sounds so scary but epic at the same time
2:40 whitesnake just wildly throwing punches makes me laugh for some reason