@@Toji-gl4vi Wait, really? That would explain why Pucci didn't end Jolyne despite the stand couldn't be seen by people because he is afraid normal people would seen it. But there wasn't any explanation that White Snake can be seen by normal people.
A stand that makes you dream while being dissolved by acid whiletaking your mind and stand in form of a disc which can be inserted into other people. You can't deny that this is quite *bizarre*
I’ve already watched this scene like 75 times by now. I absolutely love Whitesnake/Pucci, and the music + terrifying idea of Jotaro being rendered a vegetable in just one swipe of a hand + Whitesnake’s elated voice inflection is just perfect
@@brzodroid the dreaming ability yes is also part of his power. He can also enslave people and make them obey orders (like the exploding frog or the guard shooting at Jolyne)
@@diegobrando3409 and once he reaches max range, he can still just snipe you with a gun Like imagine getting away, you think youre safe so you rest and mf starts just blasting
@@0202fran It might reflect his psyche. Pucci does truly evil things throughout the part. But he usually never does them directly and even justify it and remaining completely ignorant to what he is doing, distancing himself from the truth. Whitesnake is who pucci is deep down, but he keeps his own evil intentions so far in his soul they are given form. And since whitesnake thinks for himself he can just not even think about the brutality and cruelty he is dishing out to the guards and prisoners. It makes sense for whitesnake be such.
I like how they made White Snakes punching and disc sound effects slimy and squishy. Makes its acid attack feel consistent with the rest of its abilities.
I wonder how WhiteSnake's abilities could be used for more benevolent purposes. The only one I can think of at the moment is removing a Stand from someone not strong enough to have one, like when Holly got sick.
This stand has it’s personality and voice, his range is 20 meter, his ability is powerful and that’s will make his user mysterious and dangerous , this is very smart way to make the villain dangerous to the protagonist without making theme overpowered or immortal only
Bro, idc if the the heros lose.. Whitesnake is just too *epik*. His voice, His style, His powers MMMMMM IT'S JUST TOO GOOD BRO!! Y'all ready for C-moon?
One of the most broken Stands. Long range, decent strength despite its range, acid/dream ability, and the fucking DISC ability that made quick work of Jotaro, give abilities to people, and even give commands like make something explode??? Worst part is this isn't even its final form
I only know the stands from the anime so far, but he’s basically a combination of: -Yellow Temperance/Ratt/Notorious BIG/Green Day (corrosion) -Death 13 (dream manipulation) -Osiris/Atum (soul stealing) -Boy II Man (Stand stealing) -Black Sabbath (giving people Stands) -Hierophant Green/Justice/Heaven’s Door/Surface (puppeteering/commands) -Killer Queen (making things explode)
@@humanoid251 I agree for the most part, but I just wanted to say that WhiteSnake doesn't control dreams, it simply makes people fall asleep, sorta. Meanwhile, Death 13 could control dreams, but it couldn't make people fall asleep, it had to wait for them to
@@dinoboi7756 I wouldn’t even say it puts them to sleep it just puts them in an illusion dream sort of state since white snake injected Manhattan transfer into the dream even though jotaro and Jolyne had never seen it before
I just noticed when WS gets Jotaro's memory and stand disc those have the form of where they came from (One has the form of Jotaro's hat hand and one has the form of his nose)
The different personalities really create some weird situation, like how the first attack it was Pucci himself controlling, cold and ambitious. And last act is White Snake's personality itself, childish and rushing.
Probably because he had succeeded in the first situation. In the second, he was swearing and yelling since the stand disc was out of his reach and he failed at protecting the discs. The situations were basically a demonstration of pucci’s volatile mindset and desperate attempts at dealing with situations against him or just failure in general.
People seem to forget how fucking OP White Snake is: -20 meters range -above average power and speed -can extract people memory and stands (1 shot ability) -can use the stolen stands to make enemies -can read anyone memory even if he incompatible with stand -can FUCKING COMMAND ORGANISMS with DISCs -can trap you in your sleep and kill you in your sleep by melting you away -can project whatever the HELL he wants in the dream realm Downside: is visible (but can still scare away non stand users probably lmao)
He can do the flurry barrage punch Put people in a deep sleep real like dream Slowly melt w acid Stole a memory Stole a stand Give a stand Give a memory Hold a gun 20M effective range Can be evolved twice Can speak and have mind on his own Can utilise multiple stand power like the one that he make the frog explode They really make him one of the broken stand
@@seeforkat yeah he's not the strongest. He lost to stone free easily. His stand aren't made for brute force but rather as a strategist and the users require battle iq for it. It's balance since he's not strong. But he have more advantages than disadvantages
Theoretically anyone following the path to Heaven could have their Stand evolved. Dio initially presumed that it will be him who will achieve the Heaven, so it is at least not Whitesnake exclusive.
Whitesnake having a seemingly global range, is sentient yet still has the strength of a close range stand is baffling, but most of all *his damn good voice* is just 👌
I was expecting Whitesnake to have literally the same voice and spoke the same way Pucci would, but after so long without watching the anime, i forgot that Stands actually spoke in a monotone, almost robotic way, i love that style honestly.
What is so scary about Whitesnake to me is how it makes stands seem so fragile and vulnerable in comparison to itself. Stands are always depicted as being inseparable from their users, intertwined with their very souls, but the moment Whitesnake is introduced, the safety of knowing "At least my stand will always protect me" goes completely out the window as he can just take it away from you
A stand that has crazy diamond level speed and strength with a 20 meter range is op as hell alone. Nevermind that he can turn into acid or steal parts of you and put them in dvds.
@@michaelmorbillionmorbius3596 Anasui clearly states in the Heavy Weather arc that a close range power type stand could easily overpower and outspeed white snake
Nope, McQueen only became a stand user after Whitesnake inserted the Highway to Hell disc... Plus remember that McQueen only had 2 discs when Ermes knocked him out, not 3... It's most likely that Whitesnake is visible even to non-stand users... This makes sense since Whitesnake is Pucci's stand-in when dealing with others, meaning that he must be visible else the stand can't communicate with non-stand users... This is also supported when Whitesnake retreated when guards started showing up at the end of the Operation Savage Garden arc, meaning that there's a chance others might see the stand without necessarily being stand users themselves...
@@Mr_Myst13 Except all the times when non-stand users don't see it because non-stand users can't see stands. Do you think it's just a coincidence that Highway To Hell fits McQueen so perfectly?
No, that's untrue. There are types of Stands that are more corporeal than others in the series. These types of Stands can be seen by anyone, regardless of their capacity to see Stands. Usually they take the form of an object they’ve possessed, but that doesn't mean it's impossible for a humanoid Stand to be visible even while not bound to a normal object. How else do you explain how McQueen only had 2 disks yet could see Whitesnake? How else could Pucci use WS to be his voice if non-Stand Users can't even hear Stands (see the Aerosmith/Lil' Bomber fight from part 5)? WS is visible to non-Stand Users, hence why Pucci is so careful in How he gives people abilities, like when he knocked Miraschon out to give her Marilyn Manson/Mary Lee Manson.
@@givlupi2686 Yes, it is. Straight up. If you're an anime-only, you’ll see what I mean next season when Jolyne returns to the Punishment Ward. There's a Stand User there whose nature matches what his given Stand ability does rather perfectly, and we know for a fact WS picked it up elsewhere. Whitesnake is one if the most unique Stands in the series, so stop treating it like a 'normal' Stand. Hell, it's one of a few Stands that have its own independent personalities, like Echoes or Spice Girl, which already sets it apart
I'm still here, it's just that netflix kinda killed all hype for the show. Maybe if the finale is super dope and has 80 percent of the budget poured into it, then I'll make a part 2 including lines from the recent batch and the 3rd batch :)
![JJBA: Doppio v. Risotto Full Fight [Supercut]](/img/n.gif)
To anyone watching the gun part that isn't a stand user, it would just look like the gun is just floating....
Yep, but no one was watching at that time except for Jolyne and Pucci.
@@TheOverlordEND sadly
mcqueen could see whitesnake giving the discs did not see them float?
Whitensnake is basically like one of those stand that can be seen by non stand-users , sort of like Love Deluxe and Anubis
@@Toji-gl4vi Wait, really? That would explain why Pucci didn't end Jolyne despite the stand couldn't be seen by people because he is afraid normal people would seen it.
But there wasn't any explanation that White Snake can be seen by normal people.
A stand that makes you dream while being dissolved by acid whiletaking your mind and stand in form of a disc which can be inserted into other people. You can't deny that this is quite *bizarre*
He did it he said the thing
for his neutral special, he wields a gun
1 question , can he survive from EMERALD SPLASH
Cool*
Spoiler
Plus he can disguise into somebody in a short time
0:40 i can rewatch this scene so many times, it's so crazy to me that this finally got animated
I’ve already watched this scene like 75 times by now. I absolutely love Whitesnake/Pucci, and the music + terrifying idea of Jotaro being rendered a vegetable in just one swipe of a hand + Whitesnake’s elated voice inflection is just perfect
i re-watch it everyday
Just wait for the next 2 steps behind
@@gamersfun98 honestly the heavenly horse would be so cool animated
@@ssmetallic yeah, can't wait to watch it in 2023/2024... why does netflix have to do this to us
He has a very long range, multiple abilities, his own voice/personality, interesting powers and cool design.
He is a chad
Tooru : so its same type of stats as Wonder Of U
Isn't getting discs his only ability? And of course from that you can get more stands. Or did he have the sleeping stand from the beginning?
Only 20 meter bruh
@@brzodroid the dreaming ability yes is also part of his power. He can also enslave people and make them obey orders (like the exploding frog or the guard shooting at Jolyne)
This isn't even his final form
Love him.
Plus, his name is White snake but he is literally Slime Shady
I hate how this would have been a better name.
100% prefer slime shady
@This channel got trashed No! Bad coomer! BAD!
Whitesnake, Palesnake, Slime Shady or even Whitevenom, any name is good
U mean pale snake
2:39 White Snake throwing light jabs at poison dart frogs is something I never knew I needed.
This barrage was horrible
@@Rony_15.33 he was punching frogs, so he held back
@@falcorthewishdragon3657 but all his punches are horrible from afar
@@Rony_15.33 well white snake is weak compared to star plat, so he doesn't go haywire 💀
@@Rony_15.33
*complaining about stand with D tier speed having a bad barrage*
This is my most favorite stand ever.
Same
Yea same doe he look badass
I think it has the best design so far
@@roofs817 like van darkholme gachiBASS
Me to and godlen experience raqwiam
0:54 oh god that voice🙌
Eyzo
@@LucasSantos-ce2sw Ez*
Sudeni dekte itana
@@asylbektursynbai 👌
@@danielendless ???
what makes white snake scary is that he has its own personality and *he can grab guns and try to shoot at you like as if its not a stand*
And his range is the same as hirophant green, he can still totally reach you no matter how far you run. The gun just adds disrespect.
@@diegobrando3409 and once he reaches max range, he can still just snipe you with a gun
Like imagine getting away, you think youre safe so you rest and mf starts just blasting
@@nikemegu1142 "lemme tell you right now before we go any further, they'll be no fightin me, I shoot mothafuckas" -whitesnake
@@nikemegu1142 He can also throw discs lol
@@0202fran It might reflect his psyche. Pucci does truly evil things throughout the part. But he usually never does them directly and even justify it and remaining completely ignorant to what he is doing, distancing himself from the truth. Whitesnake is who pucci is deep down, but he keeps his own evil intentions so far in his soul they are given form. And since whitesnake thinks for himself he can just not even think about the brutality and cruelty he is dishing out to the guards and prisoners. It makes sense for whitesnake be such.
This stand literally have it own personality
Like purple haze
like echo stand koichi kun
@Kurt golden experience requiem is Giornos sub conscious
Like cheap trick
@@andrewww52 cheap trick is the stand user's personality
I like how they made White Snakes punching and disc sound effects slimy and squishy.
Makes its acid attack feel consistent with the rest of its abilities.
3:40 he looks happy in this scene 🤣🤣
It's adorable and I don't know why
White Snake's personality is just epic. I really would've wished for a Stand like that, to talk with when nobody else have free time.
Isn’t he evil?
@@veteranpg3d156 well he is, but ofc it's because of Pucci personality. If someone kind would have Whitesnake he would be also kind... Kindsnake...
I wonder how WhiteSnake's abilities could be used for more benevolent purposes. The only one I can think of at the moment is removing a Stand from someone not strong enough to have one, like when Holly got sick.
@@dinoboi7756 deleting the harsh memories or traumas.
@@dinoboi7756 Perfect anesthesia
This stand has it’s personality and voice, his range is 20 meter, his ability is powerful and that’s will make his user mysterious and dangerous , this is very smart way to make the villain dangerous to the protagonist without making theme overpowered or immortal only
Bro, idc if the the heros lose.. Whitesnake is just too *epik*.
His voice, His style, His powers MMMMMM IT'S JUST TOO GOOD BRO!!
Y'all ready for C-moon?
Can't wait to see C-moon) Btw when will thete be more episodes?
I hope they don't change his voice
@@Daniel_Scarlet like March I think
Cmoon one of my favourite stands
they don´t lose and c moon doesn´t show till near the last episode
0:43 was so scary but 🔥 at the same time.
One of the most broken Stands.
Long range, decent strength despite its range, acid/dream ability, and the fucking DISC ability that made quick work of Jotaro, give abilities to people, and even give commands like make something explode??? Worst part is this isn't even its final form
I only know the stands from the anime so far, but he’s basically a combination of:
-Yellow Temperance/Ratt/Notorious BIG/Green Day (corrosion)
-Death 13 (dream manipulation)
-Osiris/Atum (soul stealing)
-Boy II Man (Stand stealing)
-Black Sabbath (giving people Stands)
-Hierophant Green/Justice/Heaven’s Door/Surface (puppeteering/commands)
-Killer Queen (making things explode)
@@humanoid251 i feel it’s more like heaven’s door in the sense he can add/remove aspects of a person
@@humanoid251 I agree for the most part, but I just wanted to say that WhiteSnake doesn't control dreams, it simply makes people fall asleep, sorta. Meanwhile, Death 13 could control dreams, but it couldn't make people fall asleep, it had to wait for them to
@@dinoboi7756 I wouldn’t even say it puts them to sleep it just puts them in an illusion dream sort of state since white snake injected Manhattan transfer into the dream even though jotaro and Jolyne had never seen it before
Whitesnake is shown to be very weak in a fight. Stone Free, Diver Down and Weather Report all hand him his arse in a straight fight.
Whitesnake is one of the coolest stands ever.
I just noticed when WS gets Jotaro's memory and stand disc those have the form of where they came from (One has the form of Jotaro's hat hand and one has the form of his nose)
Oh wow I did not see that
I was wondering why the bumps were gone later on and thinking about it makes so much sense
I've never thought about that
Bro ws saying “ez” after getting Jotaro’s disk
Yba players.
@@laugh6519 yba moment
yba do be like that d o e
🤓🤓🤓
Yba Joe after killing a prestige 0
2:59 zamn ws is being so realistic
“Get real”
Because of numbers on body
@@SmallSimin123 it would be evil to force the animators to draw the patterns on his skin
@@woopterthewooper1263 GATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC
@@woopterthewooper1263 probably CGI
Bro literally can play DVD on everyone
i can also play dvd on him
The voice sounds so scary but epic at the same time
2:03 “It was just bait bro”
[insert whitesnake as a wojak]
The different personalities really create some weird situation, like how the first attack it was Pucci himself controlling, cold and ambitious. And last act is White Snake's personality itself, childish and rushing.
Probably because he had succeeded in the first situation. In the second, he was swearing and yelling since the stand disc was out of his reach and he failed at protecting the discs. The situations were basically a demonstration of pucci’s volatile mindset and desperate attempts at dealing with situations against him or just failure in general.
@@asmagamer728 seeing the stand cursing by himself is actually quite funny
@@mimkels Ikr lmao
1:18 Manga : Just like the killer who killed Kennedy...
He said that in the manga?
@@Gaciet017 yeah. in the manga he said about the killer of Lee Oswald, the one that assassinate JFK
@@bravoprozac7620 A shame these cultural references were removed
3:17 that frog is lucky god damn it.
Ah, a frog of culture I see
You're no longer the protagonist, Jotaro!
Old Jospeh: You'll get used to it like I did. "pats on shoulder"
Giorno:wait,you were a Main Character in more than 1 part?
0:42 listening to whitesnake speak is just good for the soul
2:40 whitesnake just wildly throwing punches makes me laugh for some reason
That slime sound effect is so satisfying. The sound design is amazing.
People seem to forget how fucking OP White Snake is:
-20 meters range
-above average power and speed
-can extract people memory and stands (1 shot ability)
-can use the stolen stands to make enemies
-can read anyone memory even if he incompatible with stand
-can FUCKING COMMAND ORGANISMS with DISCs
-can trap you in your sleep and kill you in your sleep by melting you away
-can project whatever the HELL he wants in the dream realm
Downside: is visible (but can still scare away non stand users probably lmao)
blowing up the frog isn’t a power he just hit it really hard with the disc lmaooo
I wonder what he look like from non-stand user eyes considering he seems to be made out with same liquid he spitting for the majority of his body
He can also disguise as anyone with enough smoke
@@Coostard No?
Not exactly visible, but partially
He can do the flurry barrage punch
Put people in a deep sleep real like dream
Slowly melt w acid
Stole a memory
Stole a stand
Give a stand
Give a memory
Hold a gun
20M effective range
Can be evolved twice
Can speak and have mind on his own
Can utilise multiple stand power like the one that he make the frog explode
They really make him one of the broken stand
But he's still not the strongest.
@@seeforkat yeah he's not the strongest. He lost to stone free easily. His stand aren't made for brute force but rather as a strategist and the users require battle iq for it. It's balance since he's not strong. But he have more advantages than disadvantages
@@awesomenurmzamri5789 like Kirah Quin
Theoretically anyone following the path to Heaven could have their Stand evolved. Dio initially presumed that it will be him who will achieve the Heaven, so it is at least not Whitesnake exclusive.
can control anyone
can create illusion
can shapeshift
can play mixtape
the coom stand
*C o o m s n e k*
Now we know why he’s called white snake
Tomokazu seki did perfection in both Pucci and White Snake
Whitesnake having a seemingly global range, is sentient yet still has the strength of a close range stand is baffling, but most of all *his damn good voice* is just 👌
He has the strength of a close range stand only at close range
His range is bout 20 meters
@@Narvalo_Lastar I guess it's a callback to how Star Platinum brought stuff for Jotaro in part 3
He's not as strong as close range stands. He's probably weaker than killer queen
@@myronbourne6937 He seemed to be really good against Stone Free. I guess Pucci just guesses how enemies will attack from his experience
White Snake constantly sounds wheezy and sort of tired, I love it
the : "I found it" fits so fucking well
3:40
"Atta zo!"
I was expecting Whitesnake to have literally the same voice and spoke the same way Pucci would, but after so long without watching the anime, i forgot that Stands actually spoke in a monotone, almost robotic way, i love that style honestly.
What is so scary about Whitesnake to me is how it makes stands seem so fragile and vulnerable in comparison to itself.
Stands are always depicted as being inseparable from their users, intertwined with their very souls, but the moment Whitesnake is introduced, the safety of knowing "At least my stand will always protect me" goes completely out the window as he can just take it away from you
2:48
Pucci: Pale Snake! Give me a disc!
Whitesnake: ok bro
Why tf Whitesnake have a nose?
@@LordZygon woah! i wonder if that was in the manga too?
0:56 The disc on the top has a ridge. His hat is officially a part of his body.
Jotaro has been "DISC"qualified from being a stand user
🤣🤣🤣🤣🤣
for now, and then pucci dies
@@julianss550 uhh how should i put this
@@julianss550 pucci did die but uhhhhhhhh
@@averagemusiclover dont do it my man
1:03 oh dont mind me i think this line is cool
I think part 6 definitely is my favorite artstyle wise when it comes to the anime, good mix between all the previous parts and future parts
I just realized now how funny is that Pucci decided that he was more fitting to thrown a disc at a frog than his stand
Oh it's because his stand was protecting him from the incoming frogs
I love how pucci and white snake are just homies 😂😂😂
"This is my kingdom come, This is my kingdom comeeee"
@ׁ for a mouse, you’re pretty active on the internet
0:31 Thats just epic
Nice pfp, looks familiar
This stand is legit asmr to me
i cant even lie whitesnake has got to be the coolest stands especially for the 1st stage of an evolving stand
I find whitesnake just so cool because he seems like he has a mind of his own
0:56 Whitesnake RKs Jotaro and says “ez”
Whitesnake rker >:(
OMG IS THIS A YBA REFERRENCE. Jk ws bad get him be rker
This is my favorite stand ever.
I like how intellectual whitesnake is.
I love how white snake has a personallity and emotions.
A stand that has crazy diamond level speed and strength with a 20 meter range is op as hell alone. Nevermind that he can turn into acid or steal parts of you and put them in dvds.
@@extremeos He is really strong. He comes very close to that level.
@@extremeos Whitesnake is literally able to go toe to toe with Stone Free at one point
@@extremeos you’re an anime only arent you
@@extremeos reread the manga then lol
@@michaelmorbillionmorbius3596 Anasui clearly states in the Heavy Weather arc that a close range power type stand could easily overpower and outspeed white snake
This is probably my favorite stand in terms of sounds
0:11 What happens when a medieval knight sees the princesses ankles
Naaaah☠️☠️
McQueen saw White Snake, which means that he would have had to already be a Stand user in the memory Hermes sees
Nope, McQueen only became a stand user after Whitesnake inserted the Highway to Hell disc... Plus remember that McQueen only had 2 discs when Ermes knocked him out, not 3...
It's most likely that Whitesnake is visible even to non-stand users... This makes sense since Whitesnake is Pucci's stand-in when dealing with others, meaning that he must be visible else the stand can't communicate with non-stand users... This is also supported when Whitesnake retreated when guards started showing up at the end of the Operation Savage Garden arc, meaning that there's a chance others might see the stand without necessarily being stand users themselves...
@@Mr_Myst13 Except all the times when non-stand users don't see it because non-stand users can't see stands. Do you think it's just a coincidence that Highway To Hell fits McQueen so perfectly?
No, that's untrue. There are types of Stands that are more corporeal than others in the series. These types of Stands can be seen by anyone, regardless of their capacity to see Stands. Usually they take the form of an object they’ve possessed, but that doesn't mean it's impossible for a humanoid Stand to be visible even while not bound to a normal object. How else do you explain how McQueen only had 2 disks yet could see Whitesnake? How else could Pucci use WS to be his voice if non-Stand Users can't even hear Stands (see the Aerosmith/Lil' Bomber fight from part 5)? WS is visible to non-Stand Users, hence why Pucci is so careful in How he gives people abilities, like when he knocked Miraschon out to give her Marilyn Manson/Mary Lee Manson.
@@givlupi2686 Yes, it is. Straight up. If you're an anime-only, you’ll see what I mean next season when Jolyne returns to the Punishment Ward. There's a Stand User there whose nature matches what his given Stand ability does rather perfectly, and we know for a fact WS picked it up elsewhere. Whitesnake is one if the most unique Stands in the series, so stop treating it like a 'normal' Stand. Hell, it's one of a few Stands that have its own independent personalities, like Echoes or Spice Girl, which already sets it apart
2:45 that sound.. "I order you!"
1:38 My heart after meeting new people
. . .
"That's a Stand who can makes you dream whenever he wants !"
Jotaro : *lali-ho flashback*
I know I'm a bit late but I really love the sounds of the discs and the illusion made by Palesnake.
0:01 this is my kingdom come
yes
@@obi8875 no
Oh my god- STOP WITH THIS MEME. ITS NOT FUNNY ANYMORE.
@@YourLocalBobloxPlayer bro- it was 4 months ago. At that moment it was still popular
Man white snake's voice is epic
Ngl, whitesnake disc ability is cool af
Whitesnake is smarter than all my classmates
Stand + ability to speak normally = op
Hey ya is OP? (I mean it's good advisor and motivator)
Jotaro lost his protagonist privileges.
He lost his plot-armour.
@@Gabycretin impossible
@@Gabycretin I don’t get plot armor if it makes sense a character doesn’t die then how is it “plot armor’
ねっとりした声が不気味さを醸し出すホワイトスネイクですが、2倍速で再生すると不思議と怖さが薄れ、むしろハイテンションな感じのキャラに聞こえてきます。
1:15 「KOKODA☆」
0:33 that voice tho
I love how he deadass pulled a gun out, and tried to shoot a bird like it was hunting season
0:15 me when home alone
Anasui exaggeration
0:33
When you see your parents returning
Tamud
I can’t wait for Whitesnake using a dude to play music to become a certified Jojo meme
'White snake'
'Pale snake'
'Pale Cobra'
Missed opportunity
Albino serpent
white viper
Shady Snake
When getting jotaro disk.
White snake: Ez
Yba
Yba joe mama disk momeny
This is whitesnake kingdom C-
3:45 love this part
0:16 "This is my kingdom come"
I like how speaking counts as stand sound.
0:26 me when you're mom is at my house
Your*🤓🤓🤓
I like how casually White Snake just hands Pucci a disc.
2:17 when F.F is sad I’m sad I don’t care If it’s not F.F yet it’s still F.F
2:41 enrico talking while white snake is just anime punching poision dart frogs
Stand:
Summon-3:50
Barrage-2:39
Heavy-3:45
Y move-3:47
Gun-3:51
F move-0:40 - 3:41
Stand off:
Barrage-2:37
Y move-2:51
F move-0:33
Based on AUT ws
Yba's WS is better
@@January1983_1 umm okay, yba is mid anyway
@@TheToastThatGotStolenstill better than aut
@@26ul it wouldn't called mid if it wasn't better than aut
White Snake has a very nice voice acting and effects
1:15 the way he delivers this line is lowkey creepy lol
It's sarcasm
Seeing his nucleotide bases not lining up properly makes my inner biologist scream in terror.
I like how whitesnake basically puts you in a genjutsu
このドロドロ音クセになる
ASMR味を感じる
What a bizarre set occurrences if I do say myself.
Oh hell nah he got tyler the creator's mayongas
@Etg Sur UA-cam on an escalator
@@ncxo1975 hes going up
@@silverius678 so see ya later
This man just posted this vid and left, never to be seen again
I'm still here, it's just that netflix kinda killed all hype for the show.
Maybe if the finale is super dope and has 80 percent of the budget poured into it, then I'll make a part 2 including lines from the recent batch and the 3rd batch :)
Man, Jolyne really was Jotaro's only weakness.
I CANT WAIT FOR C MOON TO GET ANIMATED AS WELL
The way he says “ezo” is so funny
Almost panicked when Jotaro was beaten
Your fly is too low quality it cant trick me
@Lord TDG im going fucking insane
@Lord TDG I am going super Saiyan 17
@@jotarouchiha5950 I’m going- wait what? Super Saiyan 17? 🤨🧐
@@izimari yes
Moody Blues been real quiet since he showed up
Whitesnake makes the user and Pucci is the stand.