Why Farmers Can’t Legally Replant Their Own Seeds
Вставка
- Опубліковано 29 вер 2024
- Try Audible Plus for free for thirty days at audible.com/hai
Get a Half as Interesting t-shirt: standard.tv/co...
Suggest a video and get a free t-shirt if we use it: halfasinteresti...
Follow Sam from Half as Interesting on Instagram: / sam.from.wendover
Follow Half as Interesting on Twitter: / halfinteresting
Discuss this video on Reddit: / halfasinteresting
Video written by Ben Doyle
Check out my other channel: / wendoverproductions
Lay's tried to sue some farmers in India for growing patented potatoes and took the case to court.The court ruled in favour of the farmers and now no company can hold crop patents now.
That's India. Here in Merika, the supreme court is squarely in Monsanto's pocket.
@@SeattlePioneer Farming sector in India is unorganised and largely unregulated. So what you end up with is lower connectivity areas using older seeds probably even centuries old and hyper connected areas end up with productive seeds. Add to it, the subsidies provided to farmers, huge no of seed companies, farmer vote bank and government bodies conducting the agri research. It is combination of everything, some farmers end up with low produce, some end up being one of richest, some companies bleed and some excels.
@@SeattlePioneer they can grow for own use but not for comercial use. So they can do for their own family, not for comercial sell. I guess local sell still happens but not big contract.
@@johndunn9819 Why should you not get a patent for inventing something that massively increases crop yields? Should tractor manufacturers also work for free or something?
The seed control is one of the scariest things ive ever realized.
IT ALL ABOUT CONTROL OUR GOVERNMENT IS EVIL
scarier than the nazis?
Nazis didn´t control the global food supply so yes@@ohhi5237
@ohhi5237 to me it's about on par because it poses the same threat to peoples
@@ohhi5237 It sounds like something the nazi's would have have in place
I’m a farmer and confirm that this is true, but there’s not point to waste expensive land planting seeds that aren’t meant to be seeds (I know it makes no sense.) Basically crops such as soybeans are bred to make more oil, so the seeds are less potent as seeds
The second-generation seed is mostly inbred, which means it won't yield nearly as much or have the same characteristics as the parent. That's what was used a lot back in the 1940s and earlier when the same ground yielded around 1/4 what it does now.
Thank you for the work you do making the food that keeps society running
So, uhh, where do the seed-seeds come from? Or is it more Monsanto's lawyers ready to grease your backdoor up?
I support and Protect Heirloom seeds.
@@Nope_handlesaretrash I thought (but I'm not 100% sure), that they make seeds like that by cross-breeding two other plants that will result in the desired seeds
its so insane that people can patent a raw food and get away with it
@Niglet9-11 its not only us tho... its almost for entire world
It would be antisemitic to stop the Monsanto family
I mean, they literally spent millions of dollars developing a seed that people would want to buy because it was genetically superior. So it is their very own developed variant that they have a patent
@@TheTiagones yah a patent that makes it so you cant plant your own seeds becouse if anyone around your farm is using thier seed they will come and sue you... its a blackmail worth millions of dollars.
@@ninjadamian1997 It says in the video that it has never happened. No one's been sued for not using their seeds. And if you care so much about replanting your seeds, you could just buy seeds from someone else
I strongly oppose the ability to file a patent for genetic information, especially in a case, when you cannot prove that a specific mutation could not occur naturally. Even worse, if pollen from your patented plants is being transmitted by insects and contaminates nearby fields, it is ridiculous that the one who contaminated can sue the victim of such contamination. This is wrong, both morally as well as logically. The company must accept the risk of cross-pollinating other fields as part of their business plan. If they do not like it, then they should not do it. Period. The US is setting a very bad example for the rest of the world. The so called land of the free is creating modern-day slaves, when they strip farmers of their own seeds, which they had the right to keep and use for the next planting and harvest since humanity began with agriculture. The rich get richer and the poor get poorer. Disgusting!
people have free speech to plant seeds from the crops they grow.
@@SamSitar a plant isn't speech, and is therefore not protected by the 2nd amendment
Breeding/creating new varieties is expensive and without the patents there's no way to recoup the costs. After all farmers would only have to buy a handful of seeds and within a few years of replanting those they'd be able to grow fields full of them. Making them sterile to do it without patents only works with a small handful of high-yield plants that you can easily clone, like bananas.
The chance that new plant varieties are genetically near-identical to naturally occurring ones is bordering on the impossible. The genetic code is millions of base-pairs long and getting the exact same mutations in the exact same parts of the code without a ton of random mutations in other places just won't happen.
Monsanto is a terrifyingly unethical mega-corporation but as dumb as it seems at first the issue is nuanced.
It would be very easy to prove statistically that a given plant with matching genetic information to a patented variety could only have come from that variety. We're talking about exceedingly rare mutations here, while genetic modification allows you to splice in whole 100-1000 nucleotide sequences. The probability of similarities like that arising due to chance mutations is incomprehensibly low. That being said I completely agree with you that this whole suing people whose fields you contaminated thing is absurd and erodes the basic premise of the American legal system.
I think we can all agree that new, higher production crop varieties with beneficial traits are a good thing right?
If a company’s have no way of parenting seed they have no way of profiting on the development of new seed varieties. How can we expect companies to invest millions of dollars developing better varieties if they cannot be compensated for their work?
Fun fact: it's not just plants that can be patented. Natural animal genome sequences can be too. For instance, some spider silk genes of naturally occurring spiders are patented presently. Human genetic information was banned from being patented in the US unless synthetic (such as genetic treatments), but I'm not entirely familiar about just how much can be patented from other animals and the like. UA-camr scientist Thought Emporium actually ended up using semi-randomized, then hand-tweaked genetic protein coding for making his own spider silk that can bond with graphene and other materials while being produced from yeast; he had to do this in part due to genetic patents in the first place, but admittedly he also thought he could make spider silk with interesting artificial properties. Thankfully in his case, he made it open source, since he's against this kind of stuff being patented. Still, it's very interesting.
a fellow man of culture I see!
Truely an interesting person.
Making genome sequences open-source sound VERY interesting...
@@GameMaker3_5
The source code be like: CTGGAAGCTAGTAGCAGTCGATGACGAGCAGTCGATCGATGAATATCTCTCGACGTAGCTAGAGGACTGATGCATGCGCGCGCGGGGGAGGAGACTATGTCGTATGACTAGCTGCAATCGATGCTAGCTGATGAGAGAGTTAAAAGCGCTGAGCGCGCGTAGGGCTGCGTCGTCCTGGAAGCTAGTAGCAGTCGATGACGAGCAGTCGATCGATGAATATCTCTCGACGTAGCTAGAGGACTGATGCATGCGCGCGCGGGGGAGGAAAAGACTATGTCGTATGACTAGCTGCATAAAAGCGCTGAGCGCGCGTAGGGCTGCGTCGTCCTGGAAGCTAAGATCGATGCGGCGCGCGCAGTAGCAGTCGATGACGAGCAGTCGATCGATGAATATCTCTCGACGTAGCTAGAGGACTGATGCATGCGCGCGCGGGGGAGGAGACTATGTCGTATGACTAGCTGCATAAAAGCGCTGAGCGCGCGTAGGGCTGCGTCGTC
So if covid alters your genes can they patent your genes now?
Also viruses....
My farm still uses open pollinated corn and wheat as well as several other crops. We gave up modern soybeans and corn years ago. We avoid the big seed companies by just telling them to piss off.
Meeting the investigators with a shotgun is probably a great way to tell them to piss off.
Thank you for your comment, that is AWESOME. I've been doing a whole series on TikTok and people just don't understand . " Hippie Happenin"
Love it!yeah piss off click click boom!
I like you👊🏻🤣
Good for you! Those lower yields really showed them!!!
Just file a restraining order for them to keep there pollen out of your fields, then if they find anything in your fields you can use it against them in court.
Witnessed Monsanto ruin a very well respected 10th generation family farm operation in Indiana over seed cleaning!
I really enjoyed this video and you hit the nail on the head for the most part. I am a farmer, and what we have to sign when we buy seed is more or less a "technology agreement" (basically another terminology for a contract). Basically, saying what you said: we can't save seed. However, most times, this only applies to genetically modified crops (of which there are only 12 of in the world). This *normally* does not apply to conventionally bred crops as all of those processes were produced naturally. Take for example, wheat. Most wheat varieties you will find in an American farmer's field (at least in my area) are naturally bred, so they are non-GMO. Also, organic and non-GMO are two completely different things and topics that I am not going to dive into on a comments section of a video. We are actually allowed to save wheat seed back from our harvest to plant our next crop of wheat since it is not genetically modified. The only thing we're not allowed to do with wheat is sell it to another producer so they can use it for seed unless if it is certified seed (which again is a seperate rabbit hole in itself). I know this is not true for crops like corn and sorghum that are conventional, so it is moreso on a crop by crop basis. It's super confusing and can have some serious implications if done wrong, but most times its kind of "sweep it under the rug" type deals (at least in my area).
Yes. I remember in the sixties, in my country, as part of USA Reforma Agraria, farmers were offered loans to buy seeds at the same time their own seeds became illegal.
This is why most hobby farmers use heritage breeds of plants, the are essentially the creative commons of the plant world. Actually heritage crops and plants are protected by law to prevent patented crops from accidentally cross pollinating them if the person growing the heritage crops is part of an organization that is part of the preservation and cultivation of heritage plants. Back in 2015-16 Monsanto actually got in pretty big trouble because they knowingly were growing crops too close to farms that were cultivating heritage soybeans and corn and then suing those farms for collecting seeds with the cross pollinated patent. Unfortunately they did that to one of the farmers who was also a lawyer for one of the heritage preservation groups and he coutersued them and won because his endangered and very rare crop of heritage soybeans was worth a *lot* more than the patented crops (because it was specifically for propagation of seeds) and was protected by law as having higher priority than hybrid/patent crops.
"...only person on Earth who intentionally buys a can of Pepsi."
*Sadly sips from my can of Pepsi*
Ha, that means there are 2 of us!
Pepsi drinkers unite!
Dude needs to visit Scandinavia. Pepsi Max is the best selling soda here... by quite a margin....
the main thing I learned from this video is that Monsanto's logo looks like it was drawn by a child
"I like reading in theory", that's scarily relatable. lol
I want to believe that somewhere out there there is a branch of open source plants that are free for everyone to replant but have a reverse copyright that prevents you from selling a modified version of them or selling them at all, but you can replant them forever
Look for Heirloom varieties, that's basically what you described.
Why don't you get busy and do just that ----- for FREE! You would have to get yourself education in agronomy, conduct research, buy buildings and such to store the seeds, and you reward would be....
Non monetary.
No one is stopping you, after all.
This video gives a misleading impression that IP disputes are something recent and are caused by monopolistic multinational corporations.
Long before the invention of terminator genes and genomic sequencing, seed companies and processors asserted intellectual property rights over their plant varieties through patent law and private contracts. For example, in the 1970's, before distributing seed of its patented cucumber variety, a cucumber pickling company would have agricultural producers/growers sign a private contract stating that if there was any seed left over after planting, it would be returned to the pickling company or be destroyed and that the agricultural producer would not save any seed from the plants grown. Sweet corn production was done under similar contracts. Nobody could buy Green Giant Niblets corn seed at a store.
Hybrid maize/corn has been patented for a very long time with seed production being controlled by patent licensing and private contracts that forbid seed growers from retaining seed. There have been some large court cases in the U.S.A. over seed production companies keeping seed. Maize growers in the U.S.A. have complained about having to buy new hybrid maize seed every year from when hybrid seed first became available. There are a few agricultural producers that grow open pollinated maize and maintain heirloom varieties.
Developing new plant varieties is very expensive and developers want a return on their investment within the limited time of plant variety patent law. Genomic sequencing and other new biotechnology techniques can lower costs and the time to create and get regulatory approval but at a price.
The video also confuses IP terms by applying the term "patent" to information that should be described as existing under copyright which is a different, yet related can of worms.
I get that the focus of the video is specifically on the GMO plants and not IP specifically but it's exactly this conflation of terms that helps lobbyists to confuse IP debate in their favor.
i find the concept of patenting plants (or any other life form) quite disturbing for many reasons
@@dave8599 Giving Monsanto credit for all of agriculture now?
Why? Is a plant not just a series of building blocks assembled together? How is it any different from a chair?
@@TheOwenMajor One relevant difference is that chairs aren't self-replicating.
@@Tzizenorec Why is that relevent?
@@TheOwenMajor In a normal patent, the patentholder only controls whether you get one of the thing; they don't control what you do with it. However, with a self-replicating thing, the normal use of that thing is generally to _let_ it self-replicate. That then means that the patentholder controls not just whether you have the thing, but how you can use it. That's much more invasive than merely controlling the initial sale!
I enjoy when people come rushing in to attack seed patents and how evil the companies are for not letting farmers keep their seeds while ignoring the minor detail that... Farmers don't WANT to save those seeds. GMO crops typically do not produce stable offspring, resulting in dramatically reduced yields for second generation seeds.
Ah that is rather interesting! It still seems rather annoying that the company could potentially sue farmers even if they didn’t intend to replant seeds
@@ionic7777 It is technically possible for a company to sue a farmer for unintentional replantings, but every example case out there had the farmer deliberately trying to circumvent the company's patents and replant the seeds (or find other creative ways to get their hands on the patented genes). Monsanto doesn't really care if some corn kernels blow into your field and sprout next year.
Glad to see someone else aware of that. I've got a number of relatives who farm, and they've explicitly said that even for non-gmo crops, trying to re-use seeds just isn't worth the time and effort.
@@jarynn8156 that’s fair enough, as long as the company does it in a just manner then it’s understandable
@@ionic7777 The issue is the farmers who get caught stealing cry innocence. And while rural folk will roll their eyes, city folk will naively believe their nonsense stories and decry the evil corporations.
In eastern europe you can buy seeds whatever you want and you can do whatever you want to do with them, never heard about their corporate greed here.
Replant me!
So, this is where the plot of Jurrasic World Domion came from.
As a farmer, i was so confused about this as a kid. Now as im older, im rather pissed.
I could perhaps understand this for potatoes, since every potato of a given sort literally IS the same plant. But anything which is pollinated is a different plant. Sure some plants are so genetically stable that two of the same specimen has 99.99% identical genomes... until they cross pollinate with any compatible specimen.
but. Sam, if this is a big problem for farmerX why don’t they just grow non patented plants
This is insanity. I heard a story of a farmer who was sued by Monsanto because even though they did not use Monsanto seeds, a farm nearby did, and the wind had carried seeds to the other farmer's field and started to grow. I'm not sure this is accurate but in the world we live it, it sounds not only plausible but likely.
What I heard was the Monsanto crop pollinated the normal crop....🙁
This has happened several times. The modified patented seed cross germinated with the others. Monsanto sued. Monsanto lost. Each time.
Because, you cannot sue someone else over the effects of natural events. Even though many corporations and people keep trying.
RiceTech filed a patent for basmati rice, a plant cultivated for 5000+ years in India purely on the basis that no one had claimed it yet.
In a just world, it would be thrown out due to prior art, but that’s me being too hopeful…
they cant just claim rice, they can only patent a specific variety that they created and can prove that they own
@@corberus3119 They did, and they were granted the patent. It was only when India complained that the courts took away the patent. You can look up the details for yourself; there's a whole Wikipedia article about it.
"It should be perfectly clear that what RiceTec patented was not the genome of basmati rice or a genetically developed variety (RiceTec makes the point that all its products are natural). It was simply a hybrid of basmati obtained from cross-breeding with an US long rice variety."
MONEY ,Everyone's reason for doing everything, MONEY !
Johnny Appleseed
I meant Johnny Government Seed
We don't talk about Pickle Rick. He has already done enough damage to the sanity of our digital society.
Who is Pickle Rick?
@@probablynot1368 Funniest shit I've ever seen.
3:55 Wrong. in a case of cross pollination, they could not sue you, because what you have on your field is a hybrid plant not covered by their patent.
But you could sue them and ask them to clean your field, from their product.
As for percy schmeiser he deliberately used roundup to screened for Monsanto plants in a nearby field and grew them.
not a case of a hybrid between regular plants and patented plants.
They did point out that his number was suspiciously high.
@@nicholaslewis8594 they should have also explained why it was high. they are playing to the anti-GMO lobby, and "forgot" to tell us that at the end Monsanto payed HIM for cleaning his field from Monsanto GMO.
This video is a subtle cocky sting and I love it
This is the reason I only grow old heirloom varieties in my garden.
I remember Monsanto testing Canola in the '80s on farmland sold by my family not long before. I heard soon after that that farmers who never purchased Monsanto seeds had their crops contaminated by genetically modified pollen and were not allowed to plant their own crops, and conspiracy theory has it that Monsanto can spot their genetically modified crops using satellite photography. Not sure how true that is, but because I heard that rumor in the '90s I think it's a load of rubbish.
It's not unbelievable that sat imagery could be used. I don't know much about crops but if you told me your canola flowers at a slightly different color or density or time, I could probably find the right satellite and associated analysts to compare known fields using it to other fields in the region looking for similarities.
Rubbish, yes indeed.
You're mistaken, if you plant 200 seeds from the same tomato you have a greater chance of getting zero tomato than anything else. These seeds have a large probability of not growing into a full grown plant, that's why the same plants produce a large part of them so that very few pass the natural selection process. Industrial farming has circumvented this shortcoming through artificial selection of seeds and that's why many farmers prefer to buy their plantinf seeds than use their own.
Nonsense. I own my seeds and my tractors and refuse to cooperate with anyone who would say otherwise.
Heirloom Seeds is where it's at. We grow and swap with local farmers/gardeners who do the same.
Monsanto will sue the farmers to hell and back.
Can farmers normalize the killing of corporate executives and normalize blatantly disregarding plant patents?
But that would be anarchy! (Good)
Farmers actually quite like the corporate executives that got them seeds that don't die to caterpillars or draught. It's actually a symbiotic relationship but for some reason (greenpeace) people think that farmers preferred the 1800's.
@@pokekick4185 yeah but farmers should be allowed to replant their own seeds. I would be willing to agree that farmers shouldn't be allowed to sell the seeds from their crops, but they should be allowed to replant them on their own land. Just no selling the seeds or giving them away to other farmers for free. Idk about other crops, but for corn, farmers are most likely not going to replant even if they could because they won't have the spare land and equipment for seed corn.
@@RealCheesyBread You are not going to believe this but farmers actually work together with breeders to make seeds they think are ideal for their farms. I would know i work on farm that grows 10 million heads of lettuce every year.
To show why we currently have this model. Every seed of lettuce currently costs 1 cent to produce in production cost, 5 cents in R&D for new varieties and 0.5 cents of profit.
Let's say i change to a new variety of lettuce every 5 years the R&D cost of the varieties don't change. The seed company would charge me 2.5 million for my first seed to recoup R&D cost and then 1.5 cents for every following seed. Because if they don't i just start breeding my own seeds at much lower price because i don't need to pay for R&D but they do. They might also give me a contract that i need to buy 10 million seeds at 6.5 cents a piece for the next 5 years to avoid paying 2.5 million because most farmers don't have that much money on hand. Then i can't switch seed supplier for 5 years.
And yes worldwide a few billion a year is spent on breeding better varieties of lettuce. Like really something like 5 000 000 000. And that is for a relatively minor crop.
My uncle taught me how to save seed from our harvest. We planted only heirloom seeds. We never purchased fertilizer, we made our own organics fertilizer from cow, chicken dung, and fish guts from a fish processing plant! We never purchased herbicide, we made it from natural ingredients!
I was actually jumpscared because I literally have that exact same rick and morty body pillow...
@0:20 Math Sam Math 😅
200^1 = 200
200^2 = 40.000 ( NOT 4.000)
200^6 = 64 billion NOT 320 Trillion)
(4 more times)
ALSO..... 1 seed of tomato could actually produce 100 to 300 tomatoes, not just 1 😂😂
They should just anonymously spread the seeds everywhere all over the country. "Oh shoot, can't put the genie back in the bottle TOO BAD"
WOAH love the enthusiasm keep up the good work!!
USA! USA! USA!
Ruled on by the Supreme Court too. Farmers who don't grow said plant, but if their plants are cross pollinated by a nearby farm, then they still count as having used it.
It's crazy because they technically didn't make it. They found and and used something that was already available to everyone
Just shows how corporations own the law makers
because if they could, then big companies couldn't sell them more seeds 🤔🤷
The Monsanto seeds don’t produce as much harvest as the old heirloom seeds did. Also the roundup poisons the ground over time.
Your post is false. Monsanto does not exist. GMO technology seeds produce much much bigger harvests and the reason farmers overwhelmingly use them and pay more to get them.
Seems like this only applies to farmers who sign a contract. And if planting a seed ...or cultivating a plant that grows from a specific seed is like manufacturing a patented product then the patent holder has to include the soil as a codefendant...
Also it seems that the only way to prove ownership of the Monsanto patent is to see if the plant is in fact invulnerable to their pesticide..if it isn't then Monsanto has no ownership claim
Any farmer can begin to grow crops using his own seeds IF his last purchased seed came from an organic/heritage seed supplier. All of Monsanto seed is a GMO product with their patent to make them 'RoundUp Ready." I am always amazed why any farmer would buy into the cycle of Monsanto.
Monsanto does NOT exist. There are many companies even foreign companies producing and selling everything Monsanto used to. Farmers love the pure safety of Roundup which is always used with another herbicide and the high yielding gmo technology seed and they pay more to get them.
Indonesian farmer:
Hahahahahaha we replant our plants with no issue😂
It’s illegal if you are re-using seeds from Mosento. But that’s it. You are free to not buy from them, and replant your own seeds. What Mosento sells you is a product.
This actually one of the biggest threats on the food security of the world. Think about it in near future you would not farm anything without the consent of a handful of farming companies on any place on earth.
It is not illegal if you have heirloom seeds. These are the 'originals'. And using seeds from your crops does not generate lesser yields.
I do all of my own gardening myself for my family's own consumption. I always save seed from all food and preserve it to be planted next spring. I have very close to 100% germination every year doing this. I need no other human being on this earth's permission to do this. FACT.
Not completely true. You can save seeds from Heirloom crops and replant those. Many people start out a seed saving business by doing just this very thing. You can even save and replant seeds from crops you buy from the store. The only seeds that you may get in trouble is from seeds/plants that are trademarked.
90% of commercial crops are GMO 😮. So no you can't use store bought.
Farmers could get around this by having a guy come "steal some of the seeds/kernels" and then buy them back from him for a lower price than monsanto
$10 for a tomato??? Madness
'Bartow J. Elmore - Seed Money' is not free on Audible. Great video nonetheless.
well there is something like contracts.. so you read it.. you accept or not.
farm er can plant THEIR seeds..
Partly true heirloom seeds are not owned by any company
Similar to what tech companies are doing with ongoing subscription fees.
patents are one of the worst thing humans ever thought of. imagine basing your society on the premise of preventing people from using good ideas.
This video proposes an entirely false history while not sourcing any country of origin. Its incongruent with technological advances of the 1930s. They did not even have a chemistry formula for producing Nitrogen from Methane at that point. Prior to the prohibition era, farmers were growing cotton while making Vodka and Liquor instead of selling enough food in specific regions. Famines, World Wars, sharecropping, dustbowl, crop rotations, Almanacs, cross pollination, hereditary breeding, so many search topics that entirely nullify the timeline and techniques presented here.
This is why it's illegal to bring GMO's into Ecuador. No patents on heritage plants.
Yeah ok
One word, Monsanto....
Thirty second of information condensed into six and a half minutes.
Time for Armageddon.
And that is why you shouldn't eat corn or soybean, or anything roundup ready. If it can survive roundup. Then just how healthy can it be?
When the law is unjust , it's your duty to break it
Loophole:
I'm not a Farmer.
straight from "how to control our food" manual by bayer bill gates and WEF
As a farmer.. This is dead on.
Like GMO crops like canola etc? Last I checked oats, wheat, barley, you know food grains are fine
You can replant any seeds for personal use. You just can’t sell the second generation
Nothing makes me more annoyed than YT advertizing something as "free"
The natural end result of allowing marketing people and landlords participate in society as if they were fully human.
Yup, it's why during disaster relief in Haiti when Monsanto made a "charitable" donation of seeds, the farmers knew that they were being led into a system of reliance on Monsanto, so they piled up all the seeds they received and burned them.
Based farmers.
@@DeathsOnTheYAxis why give Monsanto and the US/Haitian govt a reason to come make some "interventions"?
@@DeathsOnTheYAxis because if you plant them for one year they will cross pollinate with everything around them. That means any seeds produced, whether on an organic farm or not, could contain patented Monsanto genetics.
@@DeathsOnTheYAxis correct, the video implies that large seed companies haven’t been *suing* many small farmers… because they don’t have to. Once the patented seeds cross-pollinate the plants grown on any nearby organic farm, that organic farm is essentially destroyed, unless the farmer wants to buy all new seed every single year. It’s not only about lawsuits.
Good.
It's called the MONSONTO protection act. It's a law that was quickly pushed (with considerable lobbying) to prevent farmers from using the seeds again.
What is MONSONTO?
@@Solaamii Google didn't say, only shows results for Monsanto with an A.
@@daniel4647 oh my dumbass didn't realise what he meant💀
googleuser, you are repeating something false, that you didn't even remember right.
First of all, there was no law ever called the Monsanto Protection act. That's something that anti-GMO agitators called a certain law, although that law didn't have anything to do with saving seeds, and didn't mention Monsanto. But yes it is a law that Monsanto certainly liked.
In fact, it wasn't even a general law. It was section 735 of a "continuing resolution" which funded part of the government while Congress was trying to pass the final appropriation for funding some government department. And it only counted for the few months until that appropriation bill was passed, after which it became moot.
So what was that section 213 really about? It was about GMO sugar beets. By 2012, sorry if I don't have the exact year, almost all sugar beets grown in the US and Canada were genetically modified, something like 95%. These had been approved by all three US agencies that regulate genetically modified food, seven years before. They were also approved by the regulating bodies in Canada. But an anti-GMO organization brought suit against the US Department of Agriculture, claiming that the previous approvals were invalid because the Department had failed to file an environmental impact statement. In fact, the DOA had filed an environmental assessment. The trial judge decided that an environmental assessment was not equivalent to an environmental impact statement. He therefore ruled, just after the spring planting was complete over most of the US, that the sugar beet fields would have to be pulled up. This would obviously be costly to sugar beet farmers. It would also be costly to consumers because there would be sugar shortages.
Before you worry about whether an environmental impact statement would offer some extra environmental protection, let's make sure we understand what about the environment would be protected. According to the plaintiff, when the sugar beets have flowers and produce pollen, that pollen could drift or be carried by insects to fertilize other beet flowers, even organic beet flowers, making the resulting seeds produced by those flowers non-organic. This may have convinced the judge, but it was mostly nonsense. Why?
First, sugar beets do not produce flowers in the year they are planted. They could produce flowers, then seeds, in the second year, but there is no second year because the sugar beets are harvested in the fall of the planting year. So there is no pollen to fertilize the flowers of the organic sugar beets.
The only exception would be farms growing sugar beets specifically to produce seeds, not sugar. But all such farms in the US (and there are none in Canada) are in a small area of the state of Oregon, the Willamette Valley. Yet the judge ordered the sugar beets to be uprooted all across the US. That made no sense.
The US Secretary of Agriculture ordered an Environmental Impact Statement to be drawn up, but to do that without being contemptuous, it needed to be done right, a process that would take about a year. Nobody seriously expected the E.I.S. to be different from the Environmental Assessment already done. Everyone knew that the plaintiffs were really only making trouble for trouble's sake. So the judge's ruling was appealed. The Sec. of Agriculture also issued a permission for farmers to leave their crops in the ground until the appeal could be heard in court.
The law you are calling the Monsanto Protection act was limited to saying that the Sec. or Agriculture could do that.
When the appeal of the judge's foolish ruling was heard by an appeals court, it was overturned. I think the plaintiff tried to take it to a second appeal, but I might remember that wrong.
So you see, the law had nothing to do with saving and replanting seeds, protected farmers much more than it protected Monsanto, and was both appropriate and necessary. You also put in the phrase "with considerable lobbying", which contradicts the anti-GMO organizations claim that section 213 was sneaked into the bill without the knowledge of the chairman of the Senate Committee, Sen. Mikulsky of Maryland.
No no, call it by the more correct term. Bribing.
In India farmers can plant seeds from the crop they have sown. Monsanto and Bayer tried to stop them, but Supreme Court ruled in favour of farmers that seeds can't be patented and you can't deny farmers planting seeds from their produce. Some have even crossbreed these patented seeds with generic ones and sell them cheaper.
Good!
Good to know there are some legislators who support the farmers in this.
In America corporations have bought the Supreme Court just to stop verdicts like that in the USA. It’s a reason Corporate paid millions to put their people on the court. Trump never ever heard of the judges before he appointed them. It was all decided by corporate America. Obviously in this instance India is less corrupt than USA.
@@vigilantcosmicpenguin8721 the small farmers in India are fighting tooth and nails for their rights. Did you miss the 2020 Indian farmers protests 250 million people took part in and lastet over a year?
@@jakx2ob People don't care what happens in shithole countries. Like how people weren't making a big deal out of wars in Africa or US bombing the middle east, but suddenly when some white europeans get attacked by russia it's everyone's problem.
If those protests were held in Canada, France or the US, we would have known about it.
Two comments: This episode should be called "Half as Depressing." Also, I loved how freaky the talking Pepsi logo was.
Angry Talking Pepsi Logo was an HAI highlight, to be sure.
Half as Sick.
Nah, it's not half as depressing; it's wholly depressing
No, what's depressing is having half as much yield and everybody's starving to death. But at least nobody's making money breeding plants, right?
This topic has been one of the best probes I found so far to find out if someone is actually checking the validity of the bull* he heard from his hippie friend that does not want to vaccinate himself or he just buys it as it is. Oh, the evil seed selling companies, forcing farmers with guns to stock up on their inferior to natural product, we need to make a revolution quickly before people start reading books and realize how painfully stupid the common myths are.
I plant seeds from my plants in city parks and government property to spite the government. City hall probably thinks they got a wild pinto bean problem. 😂
🤣🤣🤣🤣🤣🤣🤣🤣🤣 funny ass prank
The logic that 200 seeds equals 200 tomatoes genuinely hurt. 200 seeds=200 plants which probably have 20-40 tomatoes(large) and possibly hundreds (cherrys) so 200 seeds is more 1000+ tomatoes lol
Yeah but its also wrong in the opposite way aswell. I mean if you plant 200 seeds I find it very unlikely that you get to harvest from all 200. I doubt all 200 even sprout. I'm no farmer, but I dont think seeds have a 100% chance of sprouting
@@scottstroh2564 My patent seeds do sprout 100% of the time, trust me bro
@@lentilad *Source: trust me*
Add to that that 200 * 200 = 4000 somehow.
@@busimagen Two years ago I found some raddish seeds from the 1990s I had forgotten about (no, I hadn't forgotten *all* about the 1990s, only that I had bought those seeds and a few other minor details). I didb't get much yield from those seeds but I did actually get some raddishes.
---
That's nothing compared to the Judean date palm resurrection project though; they are actually using 2,000 years old seeds to grow a palm species that were supposed to be extinct.
All that being said, I've been a farmer my entire life using whatever seeds I can get. You can bet for sure I'm planting the seeds from the harvest regardless of what someone says. Those are my plants not theirs.
If I understand from the other comments planting and using Monsanto seeds multiple years will cross pollinate the species and destroy the crop ( but maybe I’m misunderstanding, also good on you FUCK MONSANTO and anyone who believes crops can be privatized)
Agreed fuck them
Yesss
Good idea admitting & posting that online! Hopefully you’re small time enough that they don’t come crack down on you…
@@se7enthedge382 He's provided literally no information about who or where he is, I think he's in a pretty safe position to admit what he's doing.
I'm not sure what state you're located in but here in Ohio I have met many many many farmers who continuously save backup percentage of their seeds that are purchased from Monsanto or Syngenta and replant them the next year. At some point the patent on older hybrid seeds fall off, and farmers are able to plant those once patented seeds.
So farmers are left with a dilemma do you buy patented seeds that will result in a yield of 200 bushels per acre of corn where do you use the older form of seeds that you can regrow and are almost free that will get you 80 bushels of corn per acre?
In the end they go with the first one and then figure out how many they can keep back for the next year without getting in trouble with their local seed dealer.
Yeah once patent expired those old seeds are obsoleted due to productivity anyways. The problem without these old seeds though, is there will be no bargaining power against a monopoly. Yes, you still need to buy from Monsanto but at least you have some bargaining power if you have an alternative like the older seeds.
Sad. So they do use monsanto crap. We all know monsanto doesnt care about your health, at all
The government has fucked up the corn industry. We don't even need to grow all of this corn we just do.
@@maggiejetson7904 did you really need to post that twice?
@@amosmoses5630 Gotta make that oh so green ethanol biofuel which requires more energy to produce than you get from burning it! If we were actually trying to be environmentally friendly we'd be making it from sugarcane where its actually a net gain rather than a loss, but then the corn industry would lose their monopoly on ethanol production.
The very idea of criminalizing growing crops is one of the most repugnant things I’ve ever heard of.
They would charge for air we breathe if they could 😂
its only for GM seeds just plant non patented seeds
This feels like something you’d see in The Outer Worlds video game. One company owning the universal right to grow food on one whole planet of surviving colonists. What could possibly go wrong?
Oy vey, don't attack the Monsanto family, that's antisemitic ! 👃
Damn folks can’t go anywhere and be great😮💨
Man that game was GREAT, loved that plot. Very true, crap like this would be right at home there.
Bruh that game was crap
@@DameOfDiamonds delete your account 😭
But Sam! If this is such a big problem for farmers, why don't they just grow non-patented plants? I'm a stupid loser and the only way I can make myself feel better is by sowing dissent in your comments section!
_perfection_
In a few years, they'll find a way to patent dissent, and prevent you from sowing it, without a signed contract granting you the rights.
THEN where will you be, huh?
Somebody had to do it.
My guess is non patented plants have much lower yield.
@@coinvestnet Lower yield and not "Roundup ready." Meaning they have to "cultivate" (i.e., weed) their fields several times during the growing season.
There are also some non genetically engineered crops that also fall under contract.
Also, some crops do not have a contract, but depending on the breeding method, you will have poor results of you replant them. Hybrid breeding is a big example. Sorghum almost never has a contract, but being hybrid, you don't want to plant its offspring. Corn, genetically engineered or not, usually is hybrid.
Some common crops that have lots of patent or contract free varieties are wheat, non genetically engineered soybeans, Alfalfa, heirloom vegetables, and plants for haying or grazing.
Yep, like you say pretty much every unique cultivar is subject to patents. So literally every seed producer has a patent on their seeds. So, it’s pretty much impossible for farmers to buy any kind of seed that isn’t subject to some sort of patent protection. :( Genetic mod or not.
Corn is a selectively breed (gmo) of maize, the old maize from native americand not European corn
What are the plants that nature made that fall under contract?
@@rttrttyan beans and corn
@@rttrttyan we sell some of our crop to seed companies that simply just bag them and brand them.
Took a botany class and my professor used to work for Lays potato chips. She said that their security was so intense while she had to go into the lab that they would have to do a full examination to make sure you weren't stealing any modified seeds to sell to competitors
Full examination? What do you mean by that? 🤔
@@iNyttowlleven the butt
Like how in shows, you see people working with drugs in their underwear so they don’t steal any product
... Don't potatoes sprout?
Can't the competitors go and buy the seeds from the same place the farmers get them?
Hey, it's like Ancient Egypt. The farmers were lent seeds by the government, and were required to send them back after the harvest (obviously using the new seeds grown).
Good Point!
And that's what made the Bronze Age world so resilient!
Straight from Historia Civilis, I see.
America is like Egypt in so many ways. The red, white, and blue. An Egyptian symbol for Uranus was the Star Spangled Man. We have our north and south kingdom and the civil war. We have obelisks and pyramids all over, and there are tons of reasons Britain, Switzerland, and the Vatican are Egyptian.
@@EmeraldEyesEsoteric we’re more like Rome. Steadily collapsing.
Imagine getting punished to regrow crops.
Go figure why there is food shortages across the world.
Edit: I didn't know that this would blow up like it did... I honestly did NOT know how controversial this was.
Note: I do recognize that there are other reasons why there is food shortages... Even before I made this comment, but as a pro capitalist I find it hard to understand why crops should be patented? It makes no sense to me when anyone can get their hands on the seeds, and can theoretically grow the crop as many times as need. Without anyone noticing. Which is possible.
From a random stranger stilling the seeds off a plant before it is harvest.
To a farmer keeping some seeds hidden away so he can breed them later to create a new crop breed.
To a child secretly growing a second generation to 10th generation of the crop somewhere for the hell of it.
Then you have scenarios where some of the seeds, like cotton for example, would accidentally start growing cotton on the side of the road.
I have seen it done before. In fact I'm trying to grow some road side cotton right now.
Also, if I cross breed it a couple of times, and inbreed it a few times to increase certain traits. I can create my own breed of cotton that I can then theoretically patent.
In the end though when it is said, and done, I still believe it is the dumbest thing I've ever heard.
Ikr? This is the kind of law that deserves to be broken. Hell. If it was me I’d plant the seeds anyway and give those specific vegetables and fruits to the homeless and hungry. These greedy corporate bastards can take their stupid patent laws and shove it.
Fight the power!
@@Traumaqueenamy Also there is no 'profit' its an equal exchange, or if you want to get really technical - sold at a loss. Farmers work for 'free'. Its up to tax authorities and courts to prove they have value which they can't do. Keep on farmin' and keep on ownin guns
@@Traumaqueenamy agreed. We need more laws that doesn't benefit the corrupt, or greedy.
👍
Profit. NO CORPORATE WEENIE GIVES A SHIT IF YOUR ENTIRE NATION DIES if it doesn't purchase their product.
I'm a farmer (also a doctor). To get hybrid corn, you plant two different varieties in 6 row swaths. The daddy corn gets to keep his tassels because that's where plant sperm (pollen) comes from. The mommy corn holds out her silk and the wind blows the pollen to the silk. The baby corn will grow much taller and be more productive than the parents. To get a dual hybrid you start with a hybrid mommy and a hybrid daddy. But hybrids don't breed true. (basic genetics: look at Mendel's peas, and by the way, he fudged his data). So if you really want to, you can replant your seeds but harvesting will be difficult and you won't get anywhere near the yield you get from the hybrid stuff. It's true that Monsanto behaves just like any other monopoly. Alas, power always corrupts.
The corrupt seek power
@@herotime3726 bingo.
Yup, Mendel was a bad boy. He didn't know about crossover and decided his numbers should match his expected results. My favorite response to someone mentioning Mendelian genetics is "what, fudge the data so it fits our model?"
: )
@@troyclayton he was still right about most things though
It's always nice to see someone point out that Mendel is a _partial_ quack.
2016 I moved to Kansas to keep an eye on a friend’s 900 ac., I quickly learned how it works… the property owner contacted with a local farmer/land owner with equipment, that farmer purchased GMO seed from Beyer, which he planted, then he purchased fertilizer from Beyer, then purchased weed killer from Beyer which wouldn’t kill the GMO corn or soybeans, at harvest time farmer harvested and sold crop to Beyer. Sometimes he would store the crop and sell when prices went up. Profit to the land owner was small.
Interesting note the corn you see as you drive across the Midwest is not for human consumption, it goes to corn syrup, fuel, animal feed, alcohol.
There are many companies even foriegn companies that sell everything that Bayer does. Your post is ignorant jlr3636.
This reminds me of a program introduced in Bali in the 1970s. The Indonesian government recommended a "technology package" of new rice varieties, chemical fertilizers and organic pesticides. As part of the "Green Revolution", this program claimed the new strain of rice would be ready for harvest a few weeks earlier than native varieties, and therefore the same field could be planted again more quickly. Rice is grown year-round as Bali has a near perfect growing climate all year long. The problem was the newer variety was more susceptible to insect pests. Not to worry, the company offering the seeds (undoubtedly paying off some bureaucrats to push the product), also sold the pesticides for their genetically modified rice. Many farmers couldn't afford that, and those that did buy it ended up harming the ecosystem. The native rice varieties are much better. Duck guano provides good fertilizer, and chemical sprays are not generally needed. Clean land, clean water. Healthy ecosystem. It's a great system that worked very well for untold generations over the millennia. But where's the money in that for Monsanto, Shell, and similar companies?
There engineering a food shortage
how much duck poop do you think there is in the world? modern fertilizers, pesticides and genetically modified crops are essential for an efficient agricolture. you aren't going to feed 10 billion people with "traditional" methods.
20 bushels of wheat per acre and 180 bushels of wheat per acre are a huge difference.
There are varieties of genetically modified corn that can produce 300 bushels per acre during a drought! it's insane! And that's all thanks to technology. The companies that invest billions of dollars in research and development deserve to be compensated for the use of their intellectual property.
@@matteomarino3511 We shouldn't have 10 billion people, honestly. This just goes back to corporations creating a problem they sell you a solution to.
@@matteomarino3511 You think Monsanto is feeding 7.6 billion. Stop drinking the kool-aide!
Suharto and the New Order really was a disaster for Indonesia.
kind of an evil law..
VOTE
@@pfzht Voting doesn’t do shit cause all politicians care about is their own selves, gathering more votes near election time with false promises to stay in power and the short term money gains. there is no politician in the world that cares about the actual people/citizens
@@Mrgodzilla1990 indeed. Since voting is broken and we all acknowledge this as an observed fact of the 2020 election, let's talk about the recourse options available to us, with all this in mind.
@@pfzht as far as i can tell, from all the evidence. Seems Trump lost 2020 legally. Sucks to be you buddy.
We live in an evil world....
I don't know about other crops, but throughout my whole life growing wheat in Kansas we kept a few hundred bushels from our best producing field for that autumns sowing. I will say there was one year Dad sowed our whole acreage with totally new seed and the next year was one of our best crops we ever harvested, although the weather conditions where nearly perfect that year also. If he sold any veriety it was only a small amount to some smaller farmer.
people like you get sued to shit by monsanto "ICH HABE ES NICHT GEWUSST"
It was probably one of the thousands of un patented seed varieties. Most of the seed from Monsanto you can't replant even if you didn't have to worry about legal bullshit. They sell mostly hybrids which are awful when replanted and lose alot of their qualities that make them desirable.
Wheat has very few varieties that are under contact. Maybe 10% of what seed growers carry have a signed deal to not regrow. That leaves 90% of varieties you can save back and regrow from seed you raised. You just can't resell it to others as seed unless you have it certified.
I am a farmer. There are plenty “publicly owned” seeds. Virtually all corn seed is and historically has been purchased by farmers. Corn seed is a hybrid and even before genetic engineering, you couldn’t plant the offspring you grew. Wheat, barley, soybeans, sunflowers and lots others have public varieties available.
Huh? If you can't replant them, how do you get more?
@@obvfw
Hybrid plants are the mating of very different plant lines. The first generation cross is predictable - subsequent generations revert back to parenting lines unpredictably. The way to reproduce hybrid plants is to recross parent lines.
@@bradshultz8385 UA-cam farmers need your help for sure.
@@obvfw Look up hybrid plants and look up Gregor Mendel.
Then look up seed patents and you'll find that farmers have been signing seed contracts agreeing not to plant the resulting seeds since 1930. EVERY farmer knows about seed contracts. GMO row crop seeds didn't come along until 1996.
@@obvfw Because you can. The only seeds you can’t replant are the ones actually developed by the big agritech companies. The reason people use those seeds instead of the strains you can use seeds from is because they’ve been genetically modified to be unaffected by herbicides and pesticides, meaning you can easily spray them to kill unwanted pest species.
"You'll own nothing and you'll like it"
“You’ll complain about it, but you’ll do NOTHING about it”
Eat the bugs bigot
"In fact, half of you will actually praise the corporations holding you down"
Aaaand, on that list.
Klaus Schwab to blame