How Bad Leap Day Math Took Down Microsoft

Поділитися
Вставка
  • Опубліковано 12 чер 2024
  • A look into one of the largest leap day bugs in history, as well as how Microsoft Azure's compute platform works (well, worked - it has been over 10 years. Though the fundamentals likely remain the same).
    Sources:
    azure.microsoft.com/en-us/blo...
    Chapters:
    0:00 Intro
    0:43 Cloud Stuff
    3:41 Azure VM Stuff
    5:10 The Incident
    7:59 Mitigation
    10:23 Aftermath
    Corrections:
    -
    Music:
    - Ubiquitous by Diamond Ortiz
    - Jane Street by Track Tribe
    - Blackout by LEMMiNO ( • LEMMiNO - Blackout (BGM) )
    - Cipher by LEMMiNO ( • LEMMiNO - Cipher (BGM) )
    - Funk Game Loop by Kevin Macleod
  • Наука та технологія

КОМЕНТАРІ • 428

  • @hadipawar2539
    @hadipawar2539 Місяць тому +1147

    "instructed to do it 3 times cause 2 isn't enought and 4 is too many" I am dying at this

    • @theborg6024
      @theborg6024 Місяць тому +71

      well i do have it on good authority that 3 is the number of the counting

    • @rixxan
      @rixxan Місяць тому +44

      ​@@theborg6024 And I have heard that 5 is Right Out.

    • @Bleenderhead
      @Bleenderhead Місяць тому +24

      Two is not enough, excepting that thou then proceed to three.

    • @satunnainenkatselija4478
      @satunnainenkatselija4478 Місяць тому +11

      Next up: Microsoft removes leap day from calendar because it was too complex. This comes after Microsoft demanded leap second be removed because it's too complex.

    • @enderger5308
      @enderger5308 Місяць тому

      @@rixxanand that three is the third number

  • @abebuckingham8198
    @abebuckingham8198 Місяць тому +661

    "Double it and give it to the next person" - Automatic Service Healing, on bugs

    • @StromMakeVid
      @StromMakeVid Місяць тому

      🤣🤣🤣Underrated Comment

  • @MasonBitByte
    @MasonBitByte Місяць тому +1037

    Azure AD, also known as Microsoft Identity, also known as Entra ID, also known as sadness

    • @influx__
      @influx__ Місяць тому +42

      no idea why they switched from azure to entra... Let's pick an even MORE arbitrary word

    • @JITSoftware
      @JITSoftware Місяць тому +67

      Then they hit you with the "NOTE: Microsoft Entra ID is the new name for Azure AD. No action is required from you." On every single Microsoft documentation page

    • @yufgyug3735
      @yufgyug3735 Місяць тому +3

      fuck ad or entra, or whatever its called

    • @dalar2
      @dalar2 Місяць тому +13

      Spent the last 6 weeks studying and revising for a specific Azure Certification... and at the last minute they updated the exam material to reference Microsoft Entra instead of Azure AD.... FUCK MY LIFE.

    • @boomknuffelaar
      @boomknuffelaar Місяць тому +7

      I just went through madness with their deprecated library passport-azure-ad, the npm listing for this package doesn't even mention that it's deprecated.

  • @MidnightMidas
    @MidnightMidas Місяць тому +567

    A libaba cloud, oracle cloud, IBM cloud, google cloud. Its golden

    • @orangejjay
      @orangejjay Місяць тому +18

      I prefer Nimbus cloud but will settle for Cumulonimbus from time to time.

    • @jeanlasalle2351
      @jeanlasalle2351 Місяць тому +25

      I feel blue balled

    • @donatocapitella
      @donatocapitella Місяць тому

      😂😂😂😂

  • @huy1k995
    @huy1k995 Місяць тому +658

    Y2K wished it would be like this.

    • @Weissenschenkel
      @Weissenschenkel Місяць тому +111

      Wait until Y2K38 and all legacy crap running on 32 bits...

    • @ShrirajGPethe
      @ShrirajGPethe Місяць тому +2

      And on wider space

    • @1234567qwerification
      @1234567qwerification Місяць тому

      It was already a problem for software dealing with near future, as 'now + 20 years' 🤷🏼‍♂️

  • @catcatcatcatcatcatcatcatcatca
    @catcatcatcatcatcatcatcatcatca Місяць тому +264

    Imagine waiting 75 minutes for a VM initialisation. Why would it take 25 minutes? Is there an intern hand-delivering the public key across the facility?

    • @thewhitefalcon8539
      @thewhitefalcon8539 Місяць тому +32

      They usually spin up in minutes but they don't actually promise that.

    • @kv4648
      @kv4648 Місяць тому +37

      The intern had time to wander off, have a nap, do a lap and have a snack too

    • @hubertnnn
      @hubertnnn Місяць тому +107

      Its the cloud. They are waiting for the correct weather.

    • @Caphalem
      @Caphalem Місяць тому +6

      @@hubertnnn Meanwhile preparing the air balloon to go up there

    • @blikthepro972
      @blikthepro972 29 днів тому +3

      you aren't a real tech company if you haven't assigned a stupid job to an unpaid intern

  • @Lars16
    @Lars16 Місяць тому +269

    Love that the datacenter in Australia was upside down. Nice touch

    • @magentamonster
      @magentamonster Місяць тому +4

      Perhaps the one in South America should be upside down too. Given that the upside down Australia joke is due to Australia being in the Southern Hemisphere. But the joke says "Australia" rather than "Southern Hemisphere" to be funnier.

    • @oliverer3
      @oliverer3 5 днів тому

      ​@@magentamonsterisn't that more because south-up maps are much more common in Australia?

    • @magentamonster
      @magentamonster 4 дні тому

      @@oliverer3 No, because south-up maps are rare, even in Australia. Almost all the maps we use are north-up. Apparently south-up maps are used as souvenirs, but that's because of the joke.

    • @oliverer3
      @oliverer3 4 дні тому

      @@magentamonster Huh, the more you know. I appreciate the lesson. :)

  • @InspectorGadget923
    @InspectorGadget923 Місяць тому +384

    10:20 I love that you rolled the date over to 2/30.

    • @Anonymous-df8it
      @Anonymous-df8it Місяць тому +6

      MDY is like putting the tens place before the ones place before the hundreds place

    • @magentamonster
      @magentamonster Місяць тому +2

      @@Anonymous-df8it Irrelevant. MD is just as much a part of YMD as MDY. And YMD is the best. DMY may be in order, but DMYhmsp (11 May, 2024 at 12:42:18 PM) isn't, and neither is hmspDMY (12:42:18 PM on 11 May, 2024) for that matter. To be consistent, you'd have to use something like smHDMY (18:42:12 on 11 May 2024). No one uses this truly little endian time format, nor do they use smhpDMY (18:42:12 PM on 11 May, 2024).
      Also, as users of a left-to-right script, we use big endian numbers, making big endian the only truly consistent time order for us.

    • @Anonymous-df8it
      @Anonymous-df8it Місяць тому +2

      @@magentamonster We should also get rid of months, hours, minutes, and seconds, and just represent every point in time as year-day, where the day is the number of (fractional) days that have passed since midnight on New Year's Day
      Also, the original video used MDY and not YMD, so your point is moot

    • @Pixiuchu
      @Pixiuchu 20 днів тому +2

      @@magentamonster YMD is in fact based! Seeing 2024/12/31 pleases me.

    • @andycivil
      @andycivil 5 днів тому +1

      @@Pixiuchu This is why it's the International Standard (ISO 8601). It pleases most people.

  • @eco_craft
    @eco_craft Місяць тому +340

    I thought it was pronounced Azure

    • @johndoe4290
      @johndoe4290 Місяць тому +45

      Nah you are wrong, its pronounced Azure

    • @Dr-Zed
      @Dr-Zed Місяць тому +30

      I'm pretty sure you're both wrong, it's definetely called Azure.

    • @mme725
      @mme725 Місяць тому +24

      Classic mistake, it's Azure

    • @aze4308
      @aze4308 Місяць тому +19

      no its azure duh

    • @Bajo85
      @Bajo85 Місяць тому +11

      I'm hearing a Nordic accent... Are you Swedish?

  • @ShrirajHegde
    @ShrirajHegde Місяць тому +326

    0:50 skipping AWS was a nice gag 😂

    • @JCel
      @JCel Місяць тому +23

      Twice even 😂
      That was a real push and pull there lol

    • @31redorange08
      @31redorange08 Місяць тому +4

      What is AWS?

    • @williamdrum9899
      @williamdrum9899 Місяць тому

      Amazon Web Services

    • @uSkizzik
      @uSkizzik Місяць тому

      @@31redorange08 Amazon's primary business - Amazon Web Services.

    • @FugaceFugite
      @FugaceFugite Місяць тому +19

      @@31redorange08 an AWP with a typo, probably

  • @ShadowSlayer1441
    @ShadowSlayer1441 Місяць тому +267

    It's a good day when Kevin Fang uploads.

    • @kjyu
      @kjyu Місяць тому +1

      It definitely wasn't a good day for those involved!

  • @jonathangawrych5195
    @jonathangawrych5195 Місяць тому +104

    Just wait for Y2K38. The Epochalypse will do this to tons of outdated, unmaintained, embedded systems, or just faulty code worldwide.

    • @WoolyCow
      @WoolyCow Місяць тому +26

      i love that its called the epochalypse lol

    • @jan.tichavsky
      @jan.tichavsky Місяць тому +12

      We already saw effects of outdated unmaintained software and embedded systems when the GPS epoch rolled over. Nobody expected it would work for more than 20 years.

    • @Nadia1989
      @Nadia1989 Місяць тому +6

      Airports, for sure. Some of them run on XP

    • @mfaizsyahmi
      @mfaizsyahmi Місяць тому +6

      @@Nadia1989 apparently the entire airline industry's booking system runs on win3.11 or something.

    • @notyourfox
      @notyourfox Місяць тому +4

      2106 will also be that, but won't really matter at that point
      ...legends say after Jan 19, 2038; 3:14:07 it will be Jan 01, 1970; 00:00:00 again...

  • @C.I...
    @C.I... Місяць тому +65

    The Zune also had a similar bug. I believe the solution was simply to wait until it was no longer the day in question.

    • @YoshiAsk
      @YoshiAsk Місяць тому +5

      Zune mentioned, raahhhhh!

    • @spaghetto181
      @spaghetto181 Місяць тому +4

      microsoft

    • @renakunisaki
      @renakunisaki 8 днів тому

      As did the PlayStation 3, though that manifested on Dec 31, when the system couldn't comprehend that it was the 366th day of the year.

    • @spaghetto181
      @spaghetto181 8 днів тому

      @@renakunisaki true... and it was a disaster(plus it happened in the same timeframe playstation network got hacked severely)

  • @justicefool3942
    @justicefool3942 Місяць тому +72

    0:50-0:55 The lengths you went to avoid saying AWS is commendable.

  • @MHX11
    @MHX11 Місяць тому +39

    I'm in love with your visualizations, they're eye candy

  • @nicholascopsey4807
    @nicholascopsey4807 Місяць тому +67

    I’ll tell you why it took 5 hours to fix the bug, they spent 4 hours and 50 minutes in meetings strategizing about how the engineers would identify the bug and the procedure to test any changes that would go out.

    • @samuvisser
      @samuvisser Місяць тому +31

      Absolutely. Also, these systems are massive and from experience i know sometimes u can know what the bug is based on observed behavior but it still take hours to identify the code that causes the bug because there are so darn many systems talking with each other all in their own git repo

    • @XxZeldaxXXxLinkxX
      @XxZeldaxXXxLinkxX Місяць тому +22

      In incident response this is actually crucial.
      The last thing you want is to do something wrong and cause even more issues. Measure twice, cut once applies wholeheartedly here

    • @aeghohloechu5022
      @aeghohloechu5022 Місяць тому +7

      ​@@XxZeldaxXXxLinkxXthey fucked up 7 servers anyway though so uh

    • @XxZeldaxXXxLinkxX
      @XxZeldaxXXxLinkxX Місяць тому +7

      @@aeghohloechu5022 OK and? If you have actually managed production servers you would understand why incident response takes time. If you haven't, maybe one day you'll get it when you footgun yourself while haphazardly trying to hotfix a production system.

    • @andyvirus2300
      @andyvirus2300 Місяць тому

      @@XxZeldaxXXxLinkxXwell not everywhere, I’m sshing and viming my way into fixing prod every other week.
      Losing time in useless meetings isn’t the way most of the time.

  • @baconerie
    @baconerie Місяць тому +20

    why is it always the dates

  • @aeghohloechu5022
    @aeghohloechu5022 Місяць тому +14

    i like the fact that all the high availability/disaster recovery stuff inevitably ends up making the situation into something way worse than if we had just let it fail and tell customers to go take a break

  • @amyisreallybored
    @amyisreallybored Місяць тому +25

    the AWS teasing at the beginning had me feeling the square hole trauma all over again

  • @pdlbackup
    @pdlbackup Місяць тому +111

    It was fixed the next day??? They might as well have done nothing and it would've fixed itself!

    • @redyau_
      @redyau_ Місяць тому +36

      Well no, as whole clusters were HI by then.
      But you have a point 😅

    • @cskiller86
      @cskiller86 Місяць тому +11

      I was going to comment the same thing.
      Since they found the problem so late in the day, and the fix was ultimately deployed in March, why not reboot everything without the fix on March 1st? It would have been less downtime probably.
      And, after that, they had 4 years at their disposal to create and test the fix.

    • @ribstogo12
      @ribstogo12 Місяць тому +3

      They might have known that, but imagine what their bosses face would have looked like if they had just sat on their hands while support calls kept rolling in. Not a good look.

    • @xelspeth
      @xelspeth Місяць тому +3

      And then 4 years later it all happens again

    • @tbuk8350
      @tbuk8350 28 днів тому +6

      Well, they still had to restore all the clusters. A couple VMs were corrupted because of the constant shifting, and a couple clusters were all stuck in the HI state.

  • @worgenzwithm14z
    @worgenzwithm14z Місяць тому +54

    Everytime a coworker suggests building our own date library

    • @mangodude-nq6su
      @mangodude-nq6su 18 днів тому

      Bet it's the same guy who makes livecoding problems

    • @grumpy989
      @grumpy989 7 днів тому

      Force them to watch the tom scott video on timezones for 12 hours straight

  • @TheHadrian54
    @TheHadrian54 Місяць тому +20

    Surprise PHP facts! PHP DateTime implicitly "fixes" impossible dates except instead of going to the last day of the month, it goes to the next month and adds the number of days missing. For example, 02-31 becomes 03-02.
    This means that adding 1 month to the following series of dates:
    01-28 01-29 01-30 01-31 02-01 02-02
    Will result in this:
    02-28 02-29 03-01 03-02 03-01 03-02
    Isn't that awesome? 😊

    • @williamdrum9899
      @williamdrum9899 Місяць тому

      Trying to wrap my head around how Microsoft couldn't think of this

    • @TheHadrian54
      @TheHadrian54 Місяць тому

      ​@@williamdrum9899 With the solution that PHP went with you're a lot less likely to cause a catastrophic failure but you still run into some issues just different ones 🤷‍♂
      At the end of the day the issue with dates is that our brain takes the way they work for granted when they're actually really complex

    • @HenryLoenwind
      @HenryLoenwind Місяць тому +4

      Every good date library does that. But that requires people to actually use a date library and not do things "by hand".

    • @grumpy989
      @grumpy989 7 днів тому

      Rare PHP W

  • @seifenspender
    @seifenspender Місяць тому +8

    Insane that this first happened only 12 years ago.
    I had to double check why this didn't occur earlier and made the realization that azure really is only 14 years old. Crazy.

  •  Місяць тому +15

    Some months ago I was manually typing DAX formulas in Powerquerry and one consisted on subtracting one year. It only took me 5 minutes to realise "but what about leap years". How did Microsoft not think about this?
    Sadly, by the time a leap year comes, everyone at work will have forgotten my Excel.

    • @subanark
      @subanark 24 дні тому

      Powerquery is a language like DAX, PowerQuery can be used inside Excel and PowerBi, DAX can be used in PowerBi, but not Excel. Microsoft has a lot of engineers and there are a lot of places this could fail. We have leap year awareness notices, training and detection to mitigate something like this in the future.

  • @FinlayDaG33k
    @FinlayDaG33k Місяць тому +101

    Man, if only there was a numeric standard that didn't really care about whether the date actually exists or not as long as the number isn't higher than the other number.
    But a'las, we'll have to wait for Apple to invent it in 5 years or so.

    • @Dr-Zed
      @Dr-Zed Місяць тому +35

      *laughs in unix time*

    • @Aura_Mancer
      @Aura_Mancer Місяць тому +5

      I assume this is a joke for the unix timestamp right. Because yknow, there's that

    • @Weissenschenkel
      @Weissenschenkel Місяць тому +10

      @@Aura_Mancer true, but Y2K38 is coming. Everything in 32-bit will be kicked back to 1970-01-01 00:00.

    • @Aura_Mancer
      @Aura_Mancer Місяць тому +32

      ​@@Weissenschenkel Most unix timestamp things use 64bit nowadays. So it is going to be a non-issue, if people have foresight. Which some will not, which will make for Kevin Fang videos. Win win if you ask me

    • @twentylush
      @twentylush Місяць тому +16

      microsoft doing everything in their power to not use unix timestamp, even when it means using 3 different epochs in their kernel

  • @Phroggster
    @Phroggster Місяць тому +10

    These are so freaking good! I particularly loved the timeline at 10:19, as that is such a Microsoft thing: resolving an issue on February 30th.

  • @iamfinkyuk
    @iamfinkyuk Місяць тому +12

    I was working at Microsoft around 2008-9 and, whilst on a training course in Stockholm (or Prague, I forget which), the whole of Azure went down during day 1 or 2 of the course which resulted in a few of us jokingly saying to each other "did you just break azure?". It later transpired (publicly) that the entire platform went down because of an SSL certificate expiry that cascaded across the entire cloud infrastructure. Some time later, I asked the NOC to get a copy of the transcript of what happened and how it was handled and these guys were REALLY good. Abject professionals the whole way. The reason there are large time delays between "finding a fix" and "making it live" is the huge volume of testing needed for approval.

  • @willpeterson3943
    @willpeterson3943 Місяць тому +24

    Can't wait for all the bugs in 2100, which is NOT a leap year

    • @guy7329
      @guy7329 Місяць тому +6

      why wait so long? We'll have tons of problems in 2038 when 32 bit system clocks just wrap back to 19xx or something.

  • @jamescollier3
    @jamescollier3 Місяць тому +128

    As a materials engineer, I know the words "Automated service healing," is not created by men who work past 5pm

    • @Fay7666
      @Fay7666 Місяць тому +13

      That is, until they work past multiple 5pms in a row.

  • @francescourdih
    @francescourdih Місяць тому +30

    10:20: the graphics says it’s the 30 of February
    **azure cluster**: wanna see me going down again?

    • @cirkulx
      @cirkulx Місяць тому +8

      feb. 31:
      patch again 💀

    • @francescourdih
      @francescourdih Місяць тому +6

      @@cirkulx I wouldn’t blame the developers for forgetting the 30th of February

    • @Anonymous-df8it
      @Anonymous-df8it Місяць тому +2

      @@francescourdih That was actually a real date in Sweden at one time

  • @shkron
    @shkron Місяць тому +3

    Man, I just want to tell you that your videos are amazing, and every time a new one comes out, it is like the happiest day of my life

  • @Berdes1
    @Berdes1 11 днів тому +2

    11:00 "0 UTC happens at the same time everywhere". I don't know how widespread this practice is, but I know of some large services that have a couple of instances running with a clock configured 24 hours and/or 7 days ahead of time to catch those kind of bugs.

  • @3rdalbum
    @3rdalbum Місяць тому +80

    Whenever I watch a Kevin Fang video, I know my next piece of amateur hacky software at the office will be better designed and less vulnerable. And that's good for everyone in my directorate.
    EDIT: My software won't break on leap year, but every February it delays archiving a few days of support tickets until the following month, lol.
    EDIT 2: I'm impressed at the systems Microsoft had to try to heal its service automatically and migrate VMs onto other servers when there's a suspected hardware problem. Shame it blew up in their faces this time.

    • @boomknuffelaar
      @boomknuffelaar Місяць тому +4

      Wouldn't a delayed archive make you MORE vulnerable? If the February bug required a rollback you'd lose more data.

    • @3rdalbum
      @3rdalbum Місяць тому +4

      @@boomknuffelaar Archiving is just to "get this old resolved ticket out of my hair", it's not a backup. The data is all stored in SharePoint lists and as such it's all backed up and versioned automatically in the cloud, regardless of whether it's in the archive or the main list.

  • @AndersonPEM
    @AndersonPEM Місяць тому +11

    HONEY! STOP EVERYTHING! KEVIN FANG DROPPED A VIDEO! GRAB THE POPCORN!

  • @richardfarrer5616
    @richardfarrer5616 Місяць тому +10

    Been there, done that (just on a much smaller scale). The product I work on reads in messages where some dates are fully represented, and some come in with just day and month specified. We know those are on or before certain other dates so we can calculate the correct year, but leap days regularly broke this. Just to add to the fun, the values have to be passed around as dates before we complete the validations. Since we know the dates will only be within a year or so of today, there is a marvellous bit of code which gives a dummy year of 1968 for these values prior to validation. Why 1968?
    1. It's long enough ago that no real date will be for that year.
    2. It's a leap year.
    3. It's the year the developer was born.
    And, yes, I do happen to be 56 as it happens.😀
    Oh, and then there's the code which adds one day by adding 24 * 60 * 60 seconds to a date - which works unless a day has 23 or 25 hours, i.e. daylight saving or local equivalent.

    • @hubertnnn
      @hubertnnn Місяць тому +2

      It reminds me of a payment platform we used that accepted integers that could be both in dollars and in cents and decided which one it is based on the amount.
      Someone rewritten a library that had an overloaded method, that accepted integer in cents or float in dollars into language where all numbers are stored as a float.

  • @rabik_dev
    @rabik_dev Місяць тому +13

    You need to post more videos Kevin

  • @riddixdan5572
    @riddixdan5572 Місяць тому

    Love your videos. Very educational and entertaining. Keep em coming

  • @jayfraxtea
    @jayfraxtea Місяць тому +4

    The way you pronounce Azure remembers me of the good old days in 2012, when almost every Microsoft marketing employee pronounced it differently. My favourite back then were some German Microsoft representatives who pronounced it like [aˈʒuːɐ̯] ... as it would be a blend of a Polish-German word.

    • @aboxinspace
      @aboxinspace 28 днів тому +1

      I work in a company that has folks from USA, India, Brazil, Mexico... saying the word "Azure" is a language bomb 😂 Almost leads to an argument every time, then everyone just says "Microsoft Cloud"

    • @jayfraxtea
      @jayfraxtea 28 днів тому

      @@aboxinspace, speaking about a language bomb ... better don't use Azure Cognitive Services Translator Service, now re-named as Azure AI Translator, to translate sentences that contain the word "Azure" 😜

  • @gamerk316
    @gamerk316 17 днів тому +2

    To be fair: Any software engineer who's had to work with time zone/leap day/year/second(!) logic knows that every time format we have *sucks*. The only acceptable solution is to do everything in UTC and convert back to the users desired time zone after the fact.

  • @megamasterbloc
    @megamasterbloc Місяць тому +4

    negative leap seconds are gonna be fun to watch

  • @BerlingoQC
    @BerlingoQC Місяць тому +1

    There is not enough of your video , can't wait for the next

  • @Nico-qq7xl
    @Nico-qq7xl 17 днів тому

    such a good explenations keep up the good work boss!

  • @Xavier-xb7is
    @Xavier-xb7is Місяць тому +1

    Best tech channel by a tremendously large margin. Can't get enough of these.

  • @AraniWendinah
    @AraniWendinah Місяць тому +6

    Let's go Kevin upload their videos again. Grab snacks!

  • @Froschkoenig751
    @Froschkoenig751 Місяць тому

    Your humor and animations are the greatest!

  • @NicosLeben
    @NicosLeben Місяць тому +2

    10:19 Nice touch with the 2/30.

  • @Akaterial
    @Akaterial Місяць тому

    I love your videos. You make theses dry and boring subjects entertaining.

  • @magic_pink_horse
    @magic_pink_horse Місяць тому +1

    The stock explosions are still my favorite ❤

  • @alejandroalzatesanchez
    @alejandroalzatesanchez Місяць тому +1

    Timezones are lovely!

  • @earthling_parth
    @earthling_parth Місяць тому

    Finally, a new video! Banger as usual 😆
    Rhat restart logic being 3 times was hilarious

  • @nexdemise4182
    @nexdemise4182 Місяць тому +1

    This year a leap day bug in Sothos's software knocked my workplace offline. Not sure what happened exactly there, I experienced it as issues with AWS Secrets Manager (can't pull the secret down, not sure if you could manually pull the values out, I think I tried and that failed too), there were probably other issues as well but that's how it manifested to me since that's generally the first error most applications I work on will throw. My guess it could also be something about authentication, certificates, etc. I didn't really dig because if it's on the other end then not like I can fix it.
    So I just kicked back and relaxed, I'm a developer, it's the operations' problem. It worked the next day but like that'd happen anyways.

  • @2k18banvalaki5
    @2k18banvalaki5 Місяць тому +1

    The VM was like “Double it and give it to the next cluster”

  • @tgz39j4ndywmm7
    @tgz39j4ndywmm7 Місяць тому +2

    That VR headset analogy was very good. As a VR headset i approve of this

  • @psicommander
    @psicommander Місяць тому +1

    Does the timeline really end on 2/30/2014? :D Hope they could create certificates on that date, though

    • @Anonymous-df8it
      @Anonymous-df8it Місяць тому +1

      Yes, it ended on the second of Octovigintember

  • @wardrich
    @wardrich Місяць тому +1

    0:06 I've always found it weird how people fumble over the word "azure". It's a shade of blue. There was also a once popular torrent client named Azureus (named after the dart frog. It's now called Vuze). Anyway, every one of those pronunciations said in that section were wrong too 😂. It's like.. a-zhur where the zh is like an "sh" but not quite lol

  • @xnehaxixh
    @xnehaxixh Місяць тому

    Bro wake up, Kevin Fang uploaded a new video!

  • @SegNode
    @SegNode Місяць тому

    Great video, I was chuckling the whole way through lol

  • @AnindoSarker
    @AnindoSarker Місяць тому +1

    The irony of my laptop crashing exactly at 5:38 is too surreal. Crashed twice

  • @MasanaAnta
    @MasanaAnta Місяць тому

    love how you always find new ways to present information!

  • @frag0638
    @frag0638 Місяць тому +2

    Not using epoch timestamps?

  • @dom1310df
    @dom1310df 28 днів тому

    Great code review picking up on that error ahead of time.

  • @davefellows
    @davefellows Місяць тому

    I remember very well when this happened, it wasn't a good day for cloud computing. Amazing how far things have come since then.

  • @NithinJune
    @NithinJune Місяць тому +1

    great vid as always

  • @hadipawar2539
    @hadipawar2539 Місяць тому +1

    welcome back Kevin!

  • @ItsVingtdeux
    @ItsVingtdeux 18 днів тому

    how to make a kevin fang video:
    1. add stock footage
    2. represent programs with amogus characters
    3. overuse that one explosion sound effect

  • @DiamondLegends
    @DiamondLegends Місяць тому

    That VR headset analogy was perfect

  • @Andrew90046zero
    @Andrew90046zero 21 день тому

    I saw what you did with the upside down servers for Australia xP

  • @nathanr136
    @nathanr136 Місяць тому

    You need a patreon, greatly explained videos I always enjoy watching and would like to contribute :)

  • @NithinJune
    @NithinJune Місяць тому +2

    how long before you think Primeogen reacts to this vid

  • @donchaput8278
    @donchaput8278 26 днів тому +1

    "Because 2 isn't enough and 4 is too many" @6:15
    -Five is right out. Once the number three, being the third number, be reached......

  • @BenMclean007
    @BenMclean007 27 днів тому

    There are actually companies that currently provide rentable computing power in space. So not literally in the cloud, but literally above the cloud

  • @Manabender
    @Manabender 9 днів тому

    10:20 Can we talk about how you have "February 30th" on the timeline?
    Brilliant.

  • @codeman99-dev
    @codeman99-dev Місяць тому

    Oh my goodness! I kid you not... I received an in-video ad for Azure right as Kevin is explained the VM crashes (roughly 6:25).

  • @shubhamsawant1551
    @shubhamsawant1551 Місяць тому

    the funniest part in 2018 in My Diploma in computer Engineering i wondered why we write code to print dates today i understand specially i understand why we calculate leap month and all

  • @eddydude100
    @eddydude100 Місяць тому

    Another great video!

  • @nessitro
    @nessitro Місяць тому

    the missile blast got me rofl. keep em' coming :D

  • @harsha1306
    @harsha1306 Місяць тому

    I love that you included a Feb 30th

  • @_tsu_
    @_tsu_ Місяць тому

    The man himself is BACK!

  • @skythra2895
    @skythra2895 Місяць тому

    Fantastic delivery as always

  • @elliot20201
    @elliot20201 16 днів тому

    I may be out of the loop but I totally thought the -zure was stressed in azure

  • @djdog120
    @djdog120 20 днів тому

    I'm not the only one who got an Azure ad while watching, right?

  • @hamburgerfatso
    @hamburgerfatso Місяць тому

    Holy shit i just searched to see if you had any videos recently and there's one 15 minutes ago

  • @caduhidalgo4996
    @caduhidalgo4996 Місяць тому

    Feels good to have a new Kevin Fang video! 🙏
    Thanks for the great upload!

  • @arjix8738
    @arjix8738 Місяць тому +1

    why were the certificates even using human dates?
    if it was using a unix timestamp and it simply added one year to it, it would be fine...

  • @shubhamsawant1551
    @shubhamsawant1551 Місяць тому +1

    Pls Make video on 2022 Microsoft port wan port change Issue I still remember teams And all office products are down

  • @spyrex3988
    @spyrex3988 21 день тому

    bro engineers at microsoft writing non-exceptional handling code is the most bizarre thing ever

  • @MickmickWashesThings_Official
    @MickmickWashesThings_Official 22 дні тому

    "And Asus" Was funny for me.

  • @alex_zetsu
    @alex_zetsu Місяць тому +1

    5:38 Why does the GA fail when it tries to generate the certificate with the expiration of a non existent date? Wouldn't that just mean it made a non expiring certificate? So shouldn't think not cause a problem until the next year?

    • @HenryLoenwind
      @HenryLoenwind Місяць тому

      Because the code to actually create the certificate is in some library and is not doing the date math itself but does verification on the date it gets as a parameter.

  • @zidaryn
    @zidaryn День тому

    This is like "Mayday" but for the tech world. Love it. Just wish I knew more about coding. Still entertaining.

  • @exodus_20_15
    @exodus_20_15 24 дні тому +1

    Saw a Microsoft Azure ad before this #badtiming

  • @mrmarkom
    @mrmarkom Місяць тому +1

    Once they figured the source of problem, they could have just wait for a day to pass. Next day the bug would not manifest, and they would have 4 years to deploy fix. Recovery lasted until tomorrow anyway :)

  • @chuckfarley7642
    @chuckfarley7642 Місяць тому

    Hard to believe this was over 12 years ago. I remember it like it was yesterday. I was working for Microsoft at the time and my service got impacted by this. It was a long 12 hours. There was no laughing at that rookie mistake!

  • @TickUwU
    @TickUwU Місяць тому +3

    Now my brain is HI

  • @m1m1c_
    @m1m1c_ Місяць тому

    MY GLORIOUS KING RETURNS

  • @ThompYT
    @ThompYT Місяць тому +2

    They should've just added 31536000 to unix time

  • @robertbeisert3315
    @robertbeisert3315 Місяць тому

    Time is the bane of most developers. Few in the world are aware of just how many kinds of time we deal with and how many problems that can cause.

  • @Amonimus
    @Amonimus Місяць тому +1

    I just love random explosions

  • @Caphalem
    @Caphalem Місяць тому

    This is... easily the most entertaining developer channel on UA-cam. As a mainly BE oriented developer, I'm dying xD

  • @xiao2634
    @xiao2634 Місяць тому

    My Microsoft Teams shows time as 12:10 AM, making me think something like this will happen to them again.

  • @bami2
    @bami2 Місяць тому

    I just can't get enough of animations like 7:30